Starting /dee2/code/volunteer_pipeline.sh SRR1799542 current disk space = 3088260784128 free memory = 1580089232 SRR1799542 SRAfilesize 2c3808509f09a4c248bcc831c1facae5 SRR1799542.sra SRR1799542.sra file validated SRR1799542 is paired end SRR1799542 is conventional basespace SRR1799542 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799542_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0735 34.0 33.0 34.0 31.0 34.0 2 33.272 34.0 34.0 34.0 31.0 34.0 3 33.391 34.0 34.0 34.0 31.0 34.0 4 36.65625 37.0 37.0 37.0 35.0 37.0 5 36.6405 37.0 37.0 37.0 35.0 37.0 6 36.61425 37.0 37.0 37.0 35.0 37.0 7 36.61525 37.0 37.0 37.0 35.0 37.0 8 36.6215 37.0 37.0 37.0 35.0 37.0 9 38.5065 39.0 39.0 39.0 37.0 39.0 10-14 38.82245 39.4 39.2 39.4 37.2 39.4 15-19 40.1233 41.0 40.0 41.0 38.0 41.0 20-24 40.1034 41.0 40.0 41.0 38.0 41.0 25-29 39.950900000000004 41.0 40.0 41.0 38.0 41.0 30-34 39.786449999999995 41.0 40.0 41.0 38.0 41.0 35-39 39.58575 41.0 40.0 41.0 37.2 41.0 40-44 39.53625 40.8 39.6 41.0 37.2 41.0 45-49 39.782599999999995 41.0 40.0 41.0 37.8 41.0 50-54 39.62519999999999 41.0 39.8 41.0 37.0 41.0 55-59 39.27475 41.0 39.0 41.0 35.6 41.0 60-64 38.8212 40.2 37.6 41.0 35.0 41.0 65-69 37.99025 39.2 36.4 41.0 34.8 41.0 70-74 36.99145 37.4 35.2 39.4 34.0 41.0 75-79 35.511900000000004 36.0 34.6 37.4 32.8 39.2 80-84 35.0878 35.2 35.0 36.6 33.6 37.8 85-89 34.54690000000001 35.0 35.0 35.6 33.0 36.6 90-94 34.15219999999999 35.0 35.0 35.0 33.0 36.0 95-99 33.95785 35.0 35.0 35.0 33.0 35.2 100-104 33.84075 35.0 34.2 35.0 32.4 35.0 105-109 33.729499999999994 35.0 34.0 35.0 31.6 35.0 110-114 33.7423 35.0 34.0 35.0 32.0 35.0 115-119 33.51195 35.0 34.0 35.0 31.2 35.0 120-124 33.3652 35.0 34.0 35.0 31.0 35.0 125-129 33.31745 35.0 34.0 35.0 31.0 35.0 130-134 32.91585 35.0 33.6 35.0 29.6 35.0 135-139 32.708299999999994 35.0 33.0 35.0 29.4 35.0 140-144 32.13595 34.8 33.0 35.0 27.4 35.0 145-149 31.696799999999996 34.6 32.8 35.0 26.6 35.0 150 25.9 32.0 20.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 2.0 10 1.0 11 2.0 12 2.0 13 3.0 14 4.0 15 7.0 16 5.0 17 0.0 18 4.0 19 1.0 20 4.0 21 4.0 22 0.0 23 5.0 24 11.0 25 12.0 26 14.0 27 17.0 28 16.0 29 34.0 30 28.0 31 38.0 32 70.0 33 89.0 34 156.0 35 320.0 36 1148.0 37 1975.0 38 25.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.88413098236776 11.939546599496222 5.591939546599496 34.584382871536526 2 23.599999999999998 12.55 34.75 29.099999999999998 3 19.900000000000002 17.625 25.324999999999996 37.15 4 23.825 25.55 23.225 27.400000000000002 5 24.675 30.475 22.900000000000002 21.95 6 19.1 34.9 24.725 21.275 7 14.6 27.575 40.849999999999994 16.975 8 15.85 25.4 33.35 25.4 9 16.5 25.124999999999996 34.325 24.05 10-14 19.805 30.37 27.21 22.615 15-19 19.54 29.03 27.785 23.645 20-24 20.06 28.655 27.46 23.825 25-29 19.57 29.73 27.389999999999997 23.31 30-34 20.06 29.01 27.6 23.330000000000002 35-39 20.044999999999998 29.134999999999998 26.884999999999998 23.935000000000002 40-44 19.705000000000002 28.860000000000003 28.09 23.345 45-49 20.064999999999998 29.04 27.145000000000003 23.75 50-54 19.77 29.18 27.265 23.785 55-59 19.88 29.38 27.055 23.685000000000002 60-64 20.07 29.134999999999998 27.495000000000005 23.3 65-69 19.575 29.375 28.02 23.03 70-74 19.97 29.04 27.425 23.565 75-79 20.630000000000003 28.51 27.18 23.68 80-84 20.24 28.475 27.334999999999997 23.95 85-89 20.54 28.64 27.32 23.5 90-94 20.53910782156431 28.575715143028606 27.225445089017803 23.65973194638928 95-99 20.262026202620262 28.862886288628864 27.177717771777175 23.697369736973698 100-104 20.611030551527577 28.38641932096605 27.50637531876594 23.496174808740435 105-109 19.700985049252463 28.366418320916047 27.2013600680034 24.73123656182809 110-114 21.10738758565498 28.22487870754764 26.934427049467313 23.73330665733007 115-119 20.555 29.29 26.69 23.465 120-124 21.279999999999998 28.499999999999996 26.27 23.95 125-129 20.815 27.525 27.534999999999997 24.125 130-134 20.215 28.615000000000002 26.625 24.545 135-139 20.646193858157446 28.533560068020407 26.427928378513556 24.392317695308595 140-144 21.959999999999997 28.410000000000004 26.27 23.36 145-149 21.805 30.235 24.54 23.419999999999998 150 16.5 33.025 24.775 25.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 3.5 25 4.0 26 4.0 27 10.0 28 14.5 29 15.5 30 17.5 31 25.5 32 33.0 33 47.5 34 66.0 35 75.5 36 85.5 37 98.5 38 117.0 39 159.0 40 197.0 41 212.5 42 228.0 43 246.5 44 264.5 45 266.0 46 262.0 47 266.0 48 242.0 49 210.0 50 182.5 51 156.5 52 130.5 53 94.5 54 71.5 55 49.5 56 36.5 57 27.5 58 23.5 59 19.0 60 9.5 61 9.0 62 5.5 63 2.5 64 4.0 65 2.0 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.01 100-104 0.005 105-109 0.005 110-114 0.034999999999999996 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0125 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.037500000000000006 0.025 0.0 0.0 0.0 66-67 0.0875 0.025 0.0 0.0 0.0 68-69 0.1375 0.025 0.0 0.0 0.0 70-71 0.1875 0.025 0.0 0.0 0.0 72-73 0.25 0.025 0.0 0.0 0.0 74-75 0.32499999999999996 0.025 0.0 0.0 0.0 76-77 0.3625 0.025 0.0 0.0 0.0 78-79 0.42500000000000004 0.025 0.0 0.0 0.0 80-81 0.6125 0.025 0.0 0.0 0.0 82-83 0.65 0.025 0.0 0.0 0.0 84-85 0.65 0.025 0.0 0.0 0.0 86-87 0.65 0.025 0.0 0.0 0.0 88-89 0.6875 0.025 0.0 0.0 0.0 90-91 0.7375 0.025 0.0 0.0 0.0 92-93 0.8375 0.025 0.0 0.0 0.0 94-95 0.95 0.025 0.0 0.0 0.0 96-97 1.0750000000000002 0.025 0.0 0.0 0.0 98-99 1.25 0.025 0.0 0.0 0.0 100-101 1.4 0.025 0.0 0.0 0.0 102-103 1.4500000000000002 0.025 0.0 0.0 0.0 104-105 1.6749999999999998 0.025 0.0 0.0 0.0 106-107 2.425 0.025 0.0 0.0 0.0 108-109 2.8375 0.025 0.0 0.0 0.0 110-111 3.7125000000000004 0.025 0.0 0.0 0.0 112-113 4.05 0.025 0.0 0.0 0.0 114-115 4.199999999999999 0.025 0.0 0.0 0.0 116-117 5.5 0.025 0.0 0.0 0.0 118-119 5.9625 0.025 0.0 0.0 0.0 120-121 5.9875 0.025 0.0 0.0 0.0 122-123 6.65 0.025 0.0 0.0 0.0 124-125 7.199999999999999 0.025 0.0 0.0 0.0 126-127 7.325 0.025 0.0 0.0 0.0 128-129 7.7625 0.025 0.0 0.0 0.0 130-131 8.025 0.025 0.0 0.0 0.0 132-133 9.25 0.025 0.0 0.0 0.0 134-135 10.8 0.025 0.0 0.0 0.0 136-137 12.3625 0.025 0.0 0.0 0.0 138 13.75 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACCGA 10 0.0069754543 143.9875 5 CGGAAGA 60 0.004705986 14.39875 140-144 >>END_MODULE SRR1799542 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799542_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.492 34.0 31.0 34.0 31.0 34.0 2 32.545 34.0 33.0 34.0 31.0 34.0 3 32.65325 34.0 34.0 34.0 31.0 34.0 4 35.91775 37.0 37.0 37.0 35.0 37.0 5 35.91225 37.0 37.0 37.0 35.0 37.0 6 35.9255 37.0 37.0 37.0 35.0 37.0 7 35.92025 37.0 37.0 37.0 35.0 37.0 8 35.81025 37.0 37.0 37.0 35.0 37.0 9 37.6935 39.0 39.0 39.0 37.0 39.0 10-14 38.054700000000004 39.4 39.2 39.4 37.2 39.4 15-19 39.29185 41.0 40.0 41.0 38.0 41.0 20-24 39.254900000000006 41.0 40.0 41.0 37.8 41.0 25-29 39.139050000000005 41.0 40.0 41.0 37.2 41.0 30-34 39.028800000000004 41.0 40.0 41.0 37.0 41.0 35-39 38.86635 41.0 40.0 41.0 36.4 41.0 40-44 38.71525 41.0 39.4 41.0 35.6 41.0 45-49 38.6625 41.0 39.0 41.0 35.8 41.0 50-54 37.8159 39.8 38.0 40.6 34.4 40.8 55-59 38.0942 40.0 38.2 41.0 34.6 41.0 60-64 37.61005 39.8 37.2 41.0 34.0 41.0 65-69 37.09065 39.0 36.2 41.0 34.0 41.0 70-74 36.08505 37.2 35.0 39.2 33.4 41.0 75-79 35.069100000000006 35.8 35.0 37.6 33.0 39.2 80-84 34.2017 35.0 35.0 36.4 32.2 37.4 85-89 33.7108 35.0 35.0 35.4 32.0 36.4 90-94 33.46585 35.0 34.6 35.0 32.0 36.0 95-99 33.16805000000001 35.0 34.0 35.0 31.0 35.0 100-104 33.1024 35.0 34.0 35.0 31.0 35.0 105-109 32.925349999999995 35.0 34.0 35.0 30.6 35.0 110-114 32.823150000000005 35.0 34.0 35.0 30.0 35.0 115-119 32.75665 35.0 34.0 35.0 29.8 35.0 120-124 32.53185 35.0 34.0 35.0 29.2 35.0 125-129 32.38865 35.0 34.0 35.0 29.0 35.0 130-134 32.0635 35.0 33.0 35.0 27.4 35.0 135-139 31.852750000000004 35.0 33.0 35.0 27.0 35.0 140-144 31.4106 34.8 32.8 35.0 24.8 35.0 145-149 30.53265 34.0 32.0 35.0 19.6 35.0 150 27.1155 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 69.0 3 2.0 4 1.0 5 3.0 6 1.0 7 4.0 8 4.0 9 1.0 10 3.0 11 5.0 12 2.0 13 3.0 14 4.0 15 1.0 16 3.0 17 3.0 18 5.0 19 7.0 20 11.0 21 5.0 22 5.0 23 8.0 24 16.0 25 19.0 26 10.0 27 11.0 28 19.0 29 26.0 30 38.0 31 47.0 32 73.0 33 100.0 34 162.0 35 345.0 36 1206.0 37 1752.0 38 26.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.075 22.1 10.7 25.124999999999996 2 26.825 26.150000000000002 31.7 15.325 3 22.175 26.924999999999997 31.574999999999996 19.325 4 24.425 33.525 23.474999999999998 18.575 5 25.35 37.824999999999996 22.5 14.325 6 21.3 39.375 22.45 16.875 7 20.9 21.7 38.775 18.625 8 22.025 25.55 29.2 23.225 9 22.375 24.15 30.95 22.525000000000002 10-14 24.415 28.79 25.974999999999998 20.82 15-19 23.69 27.765 27.615000000000002 20.93 20-24 23.595 28.415000000000003 27.525 20.465 25-29 23.79 27.955000000000002 27.779999999999998 20.474999999999998 30-34 23.40468093618724 27.765553110622125 28.515703140628123 20.31406281256251 35-39 23.465 27.6 28.29 20.645 40-44 23.75 27.74 28.01 20.5 45-49 23.205442449102094 28.252713721174526 27.837526887099195 20.70431694262418 50-54 23.51117555877794 27.946397319865994 28.136406820341016 20.40602030101505 55-59 23.637363736373636 27.927792779277926 27.522752275227525 20.912091209120913 60-64 22.676133806690334 27.69638481924096 29.021451072553628 20.606030301515077 65-69 23.330000000000002 28.294999999999998 28.255000000000003 20.119999999999997 70-74 23.760940235058765 27.686921730432605 28.257064266066518 20.29507376844211 75-79 23.57 28.325 27.57 20.535 80-84 23.64 27.92 28.305000000000003 20.135 85-89 23.50117505875294 27.961398069903492 28.651432571628582 19.885994299714984 90-94 24.285 27.3 28.439999999999998 19.975 95-99 23.825 27.405 28.194999999999997 20.575 100-104 24.26 27.625 27.96 20.155 105-109 24.005000000000003 27.35 28.435 20.21 110-114 23.755000000000003 27.26 28.575 20.41 115-119 24.535 27.87 27.295 20.3 120-124 25.180000000000003 27.435 27.894999999999996 19.49 125-129 24.884999999999998 27.42 27.944999999999997 19.75 130-134 25.641282064103205 28.39641982099105 26.596329816490826 19.36596829841492 135-139 26.165 27.889999999999997 26.895000000000003 19.05 140-144 26.382914874462337 29.523857157147145 25.72271681504451 18.370511153346 145-149 27.05894125888122 27.769438607024917 25.943160212148502 19.228459921945362 150 29.261576971214016 27.2090112640801 23.9549436795995 19.574468085106382 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 2.0 21 2.5 22 2.5 23 1.5 24 1.5 25 3.5 26 2.5 27 5.0 28 11.0 29 11.0 30 14.0 31 18.5 32 24.0 33 35.5 34 45.0 35 69.0 36 94.5 37 112.0 38 125.0 39 157.5 40 203.0 41 211.0 42 229.5 43 262.0 44 266.0 45 269.0 46 283.5 47 274.0 48 242.0 49 207.0 50 177.5 51 153.0 52 122.5 53 91.0 54 65.0 55 45.0 56 35.0 57 33.0 58 24.0 59 12.5 60 9.0 61 10.0 62 6.5 63 4.5 64 4.5 65 3.0 66 2.0 67 1.5 68 1.0 69 1.0 70 1.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.0 40-44 0.0 45-49 0.045 50-54 0.005 55-59 0.01 60-64 0.005 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.03 145-149 0.06999999999999999 150 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0750000000000002 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.6625 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.1375 0.0 0.0 0.0 0.0 116-117 5.4125 0.0 0.0 0.0 0.0 118-119 5.8625 0.0 0.0 0.0 0.0 120-121 5.8875 0.0 0.0 0.0 0.0 122-123 6.5625 0.0 0.0 0.0 0.0 124-125 7.125 0.0 0.0 0.0 0.0 126-127 7.262499999999999 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.0125 0.0 0.0 0.0 0.0 132-133 9.225 0.0 0.0 0.0 0.0 134-135 10.787500000000001 0.0 0.0 0.0 0.0 136-137 12.337499999999999 0.0 0.0 0.0 0.0 138 13.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAAC 10 0.006973645 144.0 8 GATGAGA 10 0.006973645 144.0 2 CGGAAGA 55 0.0026350126 15.709091 140-144 TCGGAAG 60 0.0047032754 14.4 140-144 >>END_MODULE Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001995 spots for SRR1799542.sra Written 1001995 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra Read 1001976 spots for SRR1799542.sra Written 1001976 spots for SRR1799542.sra SRR ids: ['SRR1799542.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yvrolxx4 SRR1799542.sra spots: 20039539 blocks: [[1, 1001976], [1001977, 2003952], [2003953, 3005928], [3005929, 4007904], [4007905, 5009880], [5009881, 6011856], [6011857, 7013832], [7013833, 8015808], [8015809, 9017784], [9017785, 10019760], [10019761, 11021736], [11021737, 12023712], [12023713, 13025688], [13025689, 14027664], [14027665, 15029640], [15029641, 16031616], [16031617, 17033592], [17033593, 18035568], [18035569, 19037544], [19037545, 20039539]] SRR1799542 file size 6729902 SRR1799542 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799542 SRR1799542_1.fastq SRR1799542_2.fastq Input file: SRR1799542_1.fastq Paired file: SRR1799542_2.fastq trimmed: SRR1799542-trimmed-pair1.fastq, SRR1799542-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:34:09 2025 >> started Thu Feb 13 21:34:31 2025 >> done (22.016s) 20039539 read pairs processed; of these: 70428 ( 0.35%) short read pairs filtered out after trimming by size control 270631 ( 1.35%) empty read pairs filtered out after trimming by size control 19698480 (98.30%) read pairs available; of these: 7587864 (38.52%) trimmed read pairs available after processing 12110616 (61.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 13 0.00% 23 14 0.00% 24 29 0.00% 25 27 0.00% 26 37 0.00% 27 46 0.00% 28 56 0.00% 29 78 0.00% 30 73 0.00% 31 104 0.00% 32 122 0.00% 33 140 0.00% 34 165 0.00% 35 174 0.00% 36 202 0.00% 37 230 0.00% 38 263 0.00% 39 292 0.00% 40 351 0.00% 41 367 0.00% 42 383 0.00% 43 440 0.00% 44 464 0.00% 45 535 0.00% 46 572 0.00% 47 600 0.00% 48 727 0.00% 49 749 0.00% 50 839 0.00% 51 886 0.00% 52 939 0.00% 53 977 0.00% 54 1114 0.01% 55 1225 0.01% 56 1332 0.01% 57 1553 0.01% 58 1697 0.01% 59 2160 0.01% 60 1992 0.01% 61 2042 0.01% 62 2344 0.01% 63 2687 0.01% 64 3010 0.02% 65 3169 0.02% 66 3703 0.02% 67 4844 0.02% 68 4986 0.03% 69 5026 0.03% 70 5522 0.03% 71 6171 0.03% 72 7296 0.04% 73 7984 0.04% 74 8983 0.05% 75 10088 0.05% 76 11075 0.06% 77 11437 0.06% 78 10559 0.05% 79 9339 0.05% 80 7362 0.04% 81 5646 0.03% 82 4702 0.02% 83 4949 0.03% 84 9479 0.05% 85 9925 0.05% 86 10863 0.06% 87 13022 0.07% 88 20182 0.10% 89 16929 0.09% 90 15742 0.08% 91 19600 0.10% 92 33089 0.17% 93 25597 0.13% 94 17132 0.09% 95 18177 0.09% 96 20640 0.10% 97 22447 0.11% 98 46274 0.23% 99 46289 0.23% 100 20478 0.10% 101 15840 0.08% 102 28865 0.15% 103 52395 0.27% 104 24157 0.12% 105 79068 0.40% 106 100950 0.51% 107 55547 0.28% 108 47674 0.24% 109 92963 0.47% 110 88070 0.45% 111 18902 0.10% 112 17180 0.09% 113 20472 0.10% 114 65535 0.33% 115 158677 0.81% 116 108926 0.55% 117 33860 0.17% 118 32502 0.16% 119 21255 0.11% 120 27182 0.14% 121 101597 0.52% 122 154456 0.78% 123 81376 0.41% 124 32929 0.17% 125 26911 0.14% 126 66000 0.34% 127 101502 0.52% 128 29780 0.15% 129 39098 0.20% 130 76350 0.39% 131 161266 0.82% 132 131746 0.67% 133 162194 0.82% 134 187795 0.95% 135 171018 0.87% 136 173630 0.88% 137 186976 0.95% 138 191691 0.97% 139 200514 1.02% 140 202956 1.03% 141 209933 1.07% 142 216412 1.10% 143 224098 1.14% 144 237193 1.20% 145 255173 1.30% 146 291012 1.48% 147 343683 1.74% 148 461744 2.34% 149 1248041 6.34% 150 12110616 61.48% 19698480 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.10 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=4.3 sequence=TGTCATTGAAGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=165.63 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=22.4 sequence=TCATCATCATCA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=10.43 fanout-score-rank=9 prefix-density=0.41 prefix-fanout=6.6 sequence=AGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTCGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTACTGGTACTTATGAATAATTCGGTTTGTCTTGCTGGTGGTCTATAATCGTTAGCTATCCTCAATGGTCTAATCTCATACATTAAGATACCCTATTCATTTTAAGTTCTTTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=29.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.8 sequence=TCCACTTCCAACAAATTAAGCTCACACAAGCTCTTCGACACGTACGTACAGGCATAGCCAAGATGGAGGCCAAATGGTGTTTTCTTGTGACAATGGCGTTGTTAGTAATGTTAGTGGTAGTGGTAAATGGAGATGAATCATCTCAAGTAAAGACAGTAGTGAAGATAGTGAAGGGAAAGAAGGTGTGCGACAAGGGGTGGGAATGCAAAGGCTTGTCTGCCTATTGCTGCAACCAAACCATTTCTGATTTTTTCCAGACCTACCAGTTCGAAAACTTGTTTTCGAAACGTAACACTCCTGTGGCTCATGCTTCGGGATTTTGGGATTACCATTCTTTTATTACTGCAGCTGCAGAATACCAGCCTCATGGATTTGGTACCACCGGAGGGAAACTTACAGGGCAGAAGGAAGTTGCTGCTTTCCTTGGGCATGTTGGAAGCAAAACCTCATGTGGTTATGGAGTGGCCACTGGAGGACCATTGGCATGGGGTTTGTGCTACAACAAGGAAAT SRR1799542 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:35:37 Started mapping on | Feb 13 21:35:37 Finished on | Feb 13 21:37:56 Mapping speed, Million of reads per hour | 510.18 Number of input reads | 19698480 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 16105176 Uniquely mapped reads % | 81.76% Average mapped length | 275.07 Number of splices: Total | 12905413 Number of splices: Annotated (sjdb) | 12561647 Number of splices: GT/AG | 12653546 Number of splices: GC/AG | 151228 Number of splices: AT/AC | 10651 Number of splices: Non-canonical | 89988 Mismatch rate per base, % | 1.17% Deletion rate per base | 0.09% Deletion average length | 2.92 Insertion rate per base | 0.06% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 579999 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 28268 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.11% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3032305 3032305 3032305 N_multimapping 579999 579999 579999 N_noFeature 484634 15879594 576725 N_ambiguous 337989 2001 203530 UnstrandedReadsAssigned:15282553 PositiveStrandReadsAssigned:223581 NegativeStrandReadsAssigned:15324921 Dataset is classified negative stranded MeadianReadLen=142 20thPercentileLength=135 echo kmer=131 SRR1799542 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799542-trimmed-pair1.fastq SRR1799542-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,698,480 reads, 17,223,055 reads pseudoaligned [quant] estimated average fragment length: 181.923 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR1799542.ke.tsv 34699 SRR1799542.se.tsv 87100 total ==> SRR1799542.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1837.08 425 15.896 Potri.005G024800.1.v4.1 1035 854.077 156 12.5503 Potri.004G059700.1.v4.1 961 780.081 12 1.05698 Potri.007G009000.2.v4.1 1416 1235.08 0 0 Potri.003G141000.2.v4.1 2943 2762.08 307.213 7.6424 Potri.016G087400.1.v4.1 270 106.103 1645 1065.29 Potri.015G069301.1.v4.1 564 383.666 0 0 Potri.010G195200.1.v4.1 1773 1592.08 28 1.20843 Potri.012G127500.1.v4.1 977 796.081 1656 142.932 ==> SRR1799542.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 436 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799542 completed mapping pipeline successfully