Starting /dee2/code/volunteer_pipeline.sh SRR1799543 current disk space = 3088225599488 free memory = 1412566736 SRR1799543 SRAfilesize f035a896c09f0ace762d74ca60887e9f SRR1799543.sra SRR1799543.sra file validated SRR1799543 is paired end SRR1799543 is conventional basespace SRR1799543 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799543_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14975 34.0 34.0 34.0 31.0 34.0 2 33.36 34.0 34.0 34.0 31.0 34.0 3 33.4995 34.0 34.0 34.0 31.0 34.0 4 36.7105 37.0 37.0 37.0 35.0 37.0 5 36.68125 37.0 37.0 37.0 35.0 37.0 6 36.68875 37.0 37.0 37.0 35.0 37.0 7 36.68525 37.0 37.0 37.0 35.0 37.0 8 36.685 37.0 37.0 37.0 35.0 37.0 9 38.592 39.0 39.0 39.0 38.0 39.0 10-14 38.8883 39.4 39.2 39.4 38.0 39.4 15-19 40.1964 41.0 40.0 41.0 38.4 41.0 20-24 40.1389 41.0 40.0 41.0 38.2 41.0 25-29 40.02905 41.0 40.0 41.0 38.0 41.0 30-34 39.821000000000005 41.0 40.0 41.0 38.0 41.0 35-39 39.72605 41.0 40.0 41.0 38.0 41.0 40-44 39.5784 41.0 40.0 41.0 37.4 41.0 45-49 39.382600000000004 41.0 39.6 41.0 36.6 41.0 50-54 38.9816 40.0 38.8 41.0 35.2 41.0 55-59 38.78489999999999 40.0 38.2 41.0 35.0 41.0 60-64 38.66055 40.0 37.4 41.0 35.0 41.0 65-69 37.9757 39.2 36.4 41.0 35.0 41.0 70-74 36.846050000000005 37.4 35.2 39.4 34.0 41.0 75-79 35.5966 36.2 34.8 37.6 33.4 39.4 80-84 35.0336 35.2 35.0 36.6 33.6 37.8 85-89 34.41375 35.0 35.0 35.6 33.0 36.6 90-94 34.0312 35.0 35.0 35.0 33.0 36.0 95-99 33.67785 35.0 34.6 35.0 31.8 35.2 100-104 33.691199999999995 35.0 34.8 35.0 32.0 35.0 105-109 33.58475 35.0 34.0 35.0 32.0 35.0 110-114 33.406549999999996 35.0 34.0 35.0 31.4 35.0 115-119 33.23345 35.0 34.0 35.0 31.0 35.0 120-124 33.1101 35.0 34.0 35.0 30.8 35.0 125-129 32.84575 35.0 34.0 35.0 29.8 35.0 130-134 32.6592 35.0 34.0 35.0 29.2 35.0 135-139 32.33565 35.0 33.0 35.0 29.0 35.0 140-144 32.0469 35.0 33.0 35.0 27.4 35.0 145-149 30.749800000000004 34.4 32.0 35.0 18.8 35.0 150 25.51525 32.0 19.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 2.0 10 4.0 11 2.0 12 4.0 13 2.0 14 8.0 15 4.0 16 2.0 17 5.0 18 11.0 19 6.0 20 8.0 21 11.0 22 9.0 23 6.0 24 10.0 25 14.0 26 12.0 27 14.0 28 7.0 29 17.0 30 41.0 31 43.0 32 66.0 33 107.0 34 170.0 35 335.0 36 1161.0 37 1873.0 38 42.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.33761652809272 10.430839002267573 7.583774250440917 41.64777021919879 2 20.349999999999998 13.600000000000001 36.6 29.45 3 20.775 17.075000000000003 24.725 37.425000000000004 4 23.974999999999998 24.075 22.05 29.9 5 23.599999999999998 30.15 23.849999999999998 22.400000000000002 6 17.974999999999998 35.025 25.6 21.4 7 14.2 28.175 39.7 17.925 8 15.725 27.825 31.674999999999997 24.775 9 18.879719929982496 24.58114528632158 33.908477119279816 22.630657664416105 10-14 19.06 30.17 27.38 23.39 15-19 19.57 29.23 27.305 23.895 20-24 19.325 29.830000000000002 27.08 23.765 25-29 19.382907436115417 29.664449667450114 27.604140621093165 23.3485022753413 30-34 19.85393427042169 28.908008603871743 27.647441348606872 23.590615777099693 35-39 19.85 29.7 27.339999999999996 23.11 40-44 19.830000000000002 29.285 27.16 23.724999999999998 45-49 19.965 28.845 27.3 23.89 50-54 20.25 28.875 27.060000000000002 23.815 55-59 20.005 29.265 27.02 23.71 60-64 19.835 28.505000000000003 27.800000000000004 23.86 65-69 19.814999999999998 28.945 27.395000000000003 23.845 70-74 20.19 28.610000000000003 27.655 23.544999999999998 75-79 19.744999999999997 29.054999999999996 27.465 23.735 80-84 20.47 29.409999999999997 26.72 23.400000000000002 85-89 20.52 28.565 27.450000000000003 23.465 90-94 20.56719851948182 29.600360126044116 26.134146951433003 23.698294403041064 95-99 19.85194818186365 29.46031110888811 26.664332516380735 24.023408192867503 100-104 19.805 29.37 26.87 23.955000000000002 105-109 20.265 29.049999999999997 27.125 23.56 110-114 21.04631389416825 29.593878163449034 26.077823347004102 23.281984595378614 115-119 20.863129469420414 29.144371655748362 26.123918587788168 23.868580287043056 120-124 21.165 28.660000000000004 26.3 23.875 125-129 21.26 28.105000000000004 25.895000000000003 24.740000000000002 130-134 21.145 28.68 26.179999999999996 23.995 135-139 20.84708470847085 29.447944794479447 24.967496749674968 24.73747374737474 140-144 21.475 28.785 25.34 24.4 145-149 20.835 29.825000000000003 25.145 24.195 150 15.5 29.075 26.450000000000003 28.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 4.0 25 5.5 26 5.5 27 10.5 28 12.0 29 11.5 30 19.5 31 29.0 32 38.5 33 51.5 34 70.0 35 75.5 36 86.5 37 104.5 38 128.0 39 167.5 40 182.0 41 210.0 42 240.5 43 248.0 44 256.0 45 249.0 46 250.5 47 256.5 48 244.5 49 208.5 50 167.0 51 141.0 52 132.5 53 111.5 54 72.0 55 49.0 56 35.0 57 25.5 58 21.5 59 18.0 60 16.0 61 11.5 62 8.0 63 7.5 64 4.0 65 2.5 66 2.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.045 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.034999999999999996 95-99 0.034999999999999996 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.40221216691804923 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025138260432378077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 0.975 0.0 0.0 0.0 0.0 84-85 1.0499999999999998 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.4125 0.0 0.0 0.0 0.0 90-91 1.55 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 1.8875 0.0 0.0 0.0 0.0 96-97 2.0 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 3.0125 0.0 0.0 0.0 0.0 104-105 3.675 0.0 0.0 0.0 0.0 106-107 4.699999999999999 0.0 0.0 0.0 0.0 108-109 5.45 0.0 0.0 0.0 0.0 110-111 6.2125 0.0 0.0 0.0 0.0 112-113 6.9625 0.0 0.0 0.0 0.0 114-115 7.7125 0.0 0.0 0.0 0.0 116-117 8.75 0.0 0.0 0.0 0.0 118-119 9.0875 0.0 0.0 0.0 0.0 120-121 9.675 0.0 0.0 0.0 0.0 122-123 10.6125 0.0 0.0 0.0 0.0 124-125 11.8125 0.0 0.0 0.0 0.0 126-127 12.35 0.0 0.0 0.0 0.0 128-129 13.3 0.0 0.0 0.0 0.0 130-131 14.6875 0.0 0.0 0.0 0.0 132-133 15.9375 0.0 0.0 0.0 0.0 134-135 17.1375 0.0 0.0 0.0 0.0 136-137 18.424999999999997 0.0 0.0 0.0 0.0 138 19.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1799543 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799543_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4775 34.0 33.0 34.0 31.0 34.0 2 32.729 34.0 33.0 34.0 31.0 34.0 3 32.842 34.0 34.0 34.0 31.0 34.0 4 36.17075 37.0 37.0 37.0 35.0 37.0 5 36.16075 37.0 37.0 37.0 35.0 37.0 6 36.127 37.0 37.0 37.0 35.0 37.0 7 36.14875 37.0 37.0 37.0 35.0 37.0 8 36.1365 37.0 37.0 37.0 35.0 37.0 9 37.98175 39.0 39.0 39.0 37.0 39.0 10-14 38.307 39.4 39.2 39.4 37.2 39.4 15-19 39.479499999999994 41.0 40.0 41.0 37.8 41.0 20-24 39.48100000000001 41.0 40.0 41.0 38.0 41.0 25-29 39.361000000000004 41.0 40.0 41.0 38.0 41.0 30-34 39.18145 41.0 40.0 41.0 37.0 41.0 35-39 38.94924999999999 41.0 39.6 41.0 36.6 41.0 40-44 38.852999999999994 41.0 39.4 41.0 36.0 41.0 45-49 38.54025 40.2 39.0 41.0 35.0 41.0 50-54 37.8186 39.6 38.0 40.6 34.0 40.8 55-59 37.7611 40.0 37.6 41.0 34.0 41.0 60-64 37.7779 39.8 37.0 41.0 34.0 41.0 65-69 37.19635 39.0 36.0 40.8 34.0 41.0 70-74 36.20245 37.2 35.0 39.4 33.4 41.0 75-79 35.114050000000006 35.8 35.0 37.8 32.8 39.2 80-84 34.21335 35.0 35.0 36.4 32.0 37.6 85-89 33.633750000000006 35.0 34.8 35.4 31.6 36.4 90-94 33.2694 35.0 34.0 35.0 31.0 36.0 95-99 32.99515 35.0 34.0 35.0 30.8 35.2 100-104 32.69325 35.0 34.0 35.0 29.6 35.0 105-109 32.3975 35.0 34.0 35.0 28.2 35.0 110-114 32.3553 35.0 34.0 35.0 29.0 35.0 115-119 32.2812 35.0 33.8 35.0 28.6 35.0 120-124 31.954949999999997 35.0 33.0 35.0 27.0 35.0 125-129 31.797450000000005 35.0 33.0 35.0 26.2 35.0 130-134 31.58495 35.0 33.0 35.0 25.0 35.0 135-139 31.1466 34.8 32.0 35.0 23.2 35.0 140-144 30.6375 34.0 31.2 35.0 21.0 35.0 145-149 29.888799999999996 34.0 31.0 35.0 8.6 35.0 150 27.8415 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 48.0 3 3.0 4 1.0 5 0.0 6 3.0 7 2.0 8 3.0 9 6.0 10 5.0 11 3.0 12 5.0 13 5.0 14 7.0 15 7.0 16 12.0 17 5.0 18 9.0 19 9.0 20 8.0 21 5.0 22 16.0 23 8.0 24 12.0 25 13.0 26 13.0 27 20.0 28 29.0 29 31.0 30 38.0 31 52.0 32 73.0 33 119.0 34 199.0 35 418.0 36 1228.0 37 1547.0 38 38.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.02623612512613 19.39959636730575 11.528758829465186 30.045408678102923 2 26.6 25.474999999999998 32.475 15.45 3 21.475 27.150000000000002 31.900000000000002 19.475 4 24.975 32.800000000000004 23.825 18.4 5 25.474999999999998 35.4 22.675 16.45 6 19.6 38.9 23.875 17.625 7 21.55 22.0 38.1 18.35 8 21.5 24.375 30.55 23.575 9 22.125 24.525 30.075000000000003 23.275000000000002 10-14 24.13 28.675 26.435 20.76 15-19 23.305 27.91 28.38 20.405 20-24 23.724999999999998 27.85 28.134999999999998 20.29 25-29 23.46 27.810000000000002 28.294999999999998 20.435 30-34 23.745 28.050000000000004 28.09 20.115 35-39 23.11 27.825 28.365000000000002 20.7 40-44 23.615 27.72 28.48 20.185 45-49 23.52 27.22 28.754999999999995 20.505000000000003 50-54 23.080000000000002 28.249999999999996 27.855 20.815 55-59 23.849999999999998 27.43 28.439999999999998 20.28 60-64 23.189999999999998 27.675 28.595 20.54 65-69 23.72 27.345000000000002 28.73 20.205000000000002 70-74 23.674999999999997 27.055 28.9 20.369999999999997 75-79 23.724999999999998 28.38 27.91 19.985 80-84 23.555 27.755000000000003 28.794999999999998 19.895 85-89 24.044999999999998 27.595 28.32 20.04 90-94 24.18 27.915 28.125 19.78 95-99 23.86 27.625 28.7 19.814999999999998 100-104 24.779999999999998 27.37 27.76 20.09 105-109 24.48 28.18 27.700000000000003 19.64 110-114 24.925 27.675 27.889999999999997 19.509999999999998 115-119 25.314999999999998 27.560000000000002 27.779999999999998 19.345000000000002 120-124 25.705 27.12 27.955000000000002 19.220000000000002 125-129 26.484999999999996 27.37 26.985 19.16 130-134 26.474999999999998 28.54 26.46 18.525 135-139 26.625 28.389999999999997 26.215 18.77 140-144 26.955000000000002 28.93 26.345000000000002 17.77 145-149 27.615000000000002 28.525 25.47 18.39 150 28.549999999999997 26.474999999999998 27.55 17.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 3.0 25 4.5 26 3.5 27 7.5 28 10.5 29 14.5 30 21.5 31 27.0 32 34.0 33 38.5 34 45.0 35 62.0 36 88.0 37 104.5 38 116.5 39 166.5 40 217.0 41 232.0 42 252.5 43 273.5 44 274.5 45 261.5 46 251.5 47 235.0 48 232.0 49 210.0 50 162.0 51 144.5 52 128.0 53 91.0 54 66.5 55 54.0 56 42.5 57 35.0 58 23.0 59 20.0 60 14.0 61 4.5 62 3.5 63 4.0 64 2.5 65 2.0 66 2.0 67 1.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.0750000000000002 0.0 0.0 0.0 0.0 86-87 1.2 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.6 0.0 0.0 0.0 0.0 92-93 1.7125 0.0 0.0 0.0 0.0 94-95 1.9375 0.0 0.0 0.0 0.0 96-97 2.05 0.0 0.0 0.0 0.0 98-99 2.3 0.0 0.0 0.0 0.0 100-101 2.75 0.0 0.0 0.0 0.0 102-103 3.0999999999999996 0.0 0.0 0.0 0.0 104-105 3.8 0.0 0.0 0.0 0.0 106-107 4.875 0.0 0.0 0.0 0.0 108-109 5.65 0.0 0.0 0.0 0.0 110-111 6.4125 0.0 0.0 0.0 0.0 112-113 7.1625 0.0 0.0 0.0 0.0 114-115 7.887499999999999 0.0 0.0 0.0 0.0 116-117 8.95 0.0 0.0 0.0 0.0 118-119 9.2875 0.0 0.0 0.0 0.0 120-121 9.875 0.0 0.0 0.0 0.0 122-123 10.8 0.0 0.0 0.0 0.0 124-125 11.9875 0.0 0.0 0.0 0.0 126-127 12.537500000000001 0.0 0.0 0.0 0.0 128-129 13.475000000000001 0.0 0.0 0.0 0.0 130-131 14.925 0.0 0.0 0.0 0.0 132-133 16.1875 0.0 0.0 0.0 0.0 134-135 17.3875 0.0 0.0 0.0 0.0 136-137 18.75 0.0 0.0 0.0 0.0 138 19.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCTC 10 0.006973645 144.0 6 >>END_MODULE Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159818 spots for SRR1799543.sra Written 1159818 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra Read 1159813 spots for SRR1799543.sra Written 1159813 spots for SRR1799543.sra SRR ids: ['SRR1799543.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dkfgr4xo SRR1799543.sra spots: 23196265 blocks: [[1, 1159813], [1159814, 2319626], [2319627, 3479439], [3479440, 4639252], [4639253, 5799065], [5799066, 6958878], [6958879, 8118691], [8118692, 9278504], [9278505, 10438317], [10438318, 11598130], [11598131, 12757943], [12757944, 13917756], [13917757, 15077569], [15077570, 16237382], [16237383, 17397195], [17397196, 18557008], [18557009, 19716821], [19716822, 20876634], [20876635, 22036447], [22036448, 23196265]] SRR1799543 file size 7793447 SRR1799543 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799543 SRR1799543_1.fastq SRR1799543_2.fastq Input file: SRR1799543_1.fastq Paired file: SRR1799543_2.fastq trimmed: SRR1799543-trimmed-pair1.fastq, SRR1799543-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:24:16 2025 >> started Thu Feb 13 21:24:43 2025 >> done (27.140s) 23196265 read pairs processed; of these: 67582 ( 0.29%) short read pairs filtered out after trimming by size control 235541 ( 1.02%) empty read pairs filtered out after trimming by size control 22893142 (98.69%) read pairs available; of these: 9698219 (42.36%) trimmed read pairs available after processing 13194923 (57.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 4 0.00% 21 8 0.00% 22 18 0.00% 23 27 0.00% 24 26 0.00% 25 36 0.00% 26 32 0.00% 27 58 0.00% 28 67 0.00% 29 89 0.00% 30 129 0.00% 31 126 0.00% 32 165 0.00% 33 204 0.00% 34 218 0.00% 35 234 0.00% 36 276 0.00% 37 350 0.00% 38 356 0.00% 39 401 0.00% 40 490 0.00% 41 510 0.00% 42 516 0.00% 43 621 0.00% 44 637 0.00% 45 653 0.00% 46 748 0.00% 47 829 0.00% 48 838 0.00% 49 970 0.00% 50 989 0.00% 51 1199 0.01% 52 1284 0.01% 53 1456 0.01% 54 1534 0.01% 55 1721 0.01% 56 1911 0.01% 57 1985 0.01% 58 2215 0.01% 59 2472 0.01% 60 2836 0.01% 61 3112 0.01% 62 3585 0.02% 63 3936 0.02% 64 4437 0.02% 65 4860 0.02% 66 5248 0.02% 67 5823 0.03% 68 6458 0.03% 69 7281 0.03% 70 8137 0.04% 71 9117 0.04% 72 10502 0.05% 73 11863 0.05% 74 13381 0.06% 75 14990 0.07% 76 16254 0.07% 77 17584 0.08% 78 18824 0.08% 79 20102 0.09% 80 20515 0.09% 81 20839 0.09% 82 16679 0.07% 83 15980 0.07% 84 20877 0.09% 85 22865 0.10% 86 29306 0.13% 87 41892 0.18% 88 42548 0.19% 89 19386 0.08% 90 19814 0.09% 91 21184 0.09% 92 41586 0.18% 93 29305 0.13% 94 20694 0.09% 95 23775 0.10% 96 27825 0.12% 97 25540 0.11% 98 69020 0.30% 99 93997 0.41% 100 24075 0.11% 101 23869 0.10% 102 108342 0.47% 103 69145 0.30% 104 104233 0.46% 105 110300 0.48% 106 133170 0.58% 107 33791 0.15% 108 73908 0.32% 109 61310 0.27% 110 110786 0.48% 111 113669 0.50% 112 38869 0.17% 113 89150 0.39% 114 146988 0.64% 115 181355 0.79% 116 132534 0.58% 117 27998 0.12% 118 24328 0.11% 119 109890 0.48% 120 40058 0.17% 121 156942 0.69% 122 188556 0.82% 123 155648 0.68% 124 31277 0.14% 125 30887 0.13% 126 114663 0.50% 127 72069 0.31% 128 138686 0.61% 129 169086 0.74% 130 202942 0.89% 131 148259 0.65% 132 78603 0.34% 133 189301 0.83% 134 204231 0.89% 135 163663 0.71% 136 203065 0.89% 137 200085 0.87% 138 210168 0.92% 139 216498 0.95% 140 219495 0.96% 141 221635 0.97% 142 228408 1.00% 143 233616 1.02% 144 243578 1.06% 145 268594 1.17% 146 294519 1.29% 147 346311 1.51% 148 460922 2.01% 149 1710378 7.47% 150 13194923 57.64% 22893142 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=11.16 fanout-score-rank=13 prefix-density=0.22 prefix-fanout=6.0 sequence=ACCACCTTGGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=170.07 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=27.5 sequence=CATCATCATCACC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=13.07 fanout-score-rank=12 prefix-density=0.29 prefix-fanout=6.2 sequence=TGCCAAGGTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=135.11 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.3 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTTCTTCTGTTTATTACAGCAGTCATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGCAAAATGGAAGGTGTGGAATCATA SRR1799543 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:25:29 Started mapping on | Feb 13 21:25:29 Finished on | Feb 13 21:28:44 Mapping speed, Million of reads per hour | 422.64 Number of input reads | 22893142 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 21461705 Uniquely mapped reads % | 93.75% Average mapped length | 280.96 Number of splices: Total | 18600191 Number of splices: Annotated (sjdb) | 18160899 Number of splices: GT/AG | 18258647 Number of splices: GC/AG | 227142 Number of splices: AT/AC | 15745 Number of splices: Non-canonical | 98657 Mismatch rate per base, % | 1.12% Deletion rate per base | 0.10% Deletion average length | 2.95 Insertion rate per base | 0.07% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 770082 % of reads mapped to multiple loci | 3.36% Number of reads mapped to too many loci | 47504 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 689208 689208 689208 N_multimapping 770082 770082 770082 N_noFeature 625498 21182647 768973 N_ambiguous 237689 1170 101585 UnstrandedReadsAssigned:20598518 PositiveStrandReadsAssigned:277888 NegativeStrandReadsAssigned:20591147 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR1799543 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799543-trimmed-pair1.fastq SRR1799543-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,893,142 reads, 19,916,268 reads pseudoaligned [quant] estimated average fragment length: 185.845 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR1799543.ke.tsv 34699 SRR1799543.se.tsv 87100 total ==> SRR1799543.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1833.15 398 11.898 Potri.005G024800.1.v4.1 1035 850.155 280 18.0489 Potri.004G059700.1.v4.1 961 776.159 27 1.90636 Potri.007G009000.2.v4.1 1416 1231.15 0 0 Potri.003G141000.2.v4.1 2943 2758.15 391.071 7.77013 Potri.016G087400.1.v4.1 270 104.813 2412 1261.11 Potri.015G069301.1.v4.1 564 379.94 0 0 Potri.010G195200.1.v4.1 1773 1588.15 43 1.48377 Potri.012G127500.1.v4.1 977 792.155 6088 421.168 ==> SRR1799543.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2261 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799543 completed mapping pipeline successfully