Starting /dee2/code/volunteer_pipeline.sh SRR1799544 current disk space = 3088402948096 free memory = 1458951608 SRR1799544 SRAfilesize abcddb6ceb2ff0362fd36eae0dcf17f9 SRR1799544.sra SRR1799544.sra file validated SRR1799544 is paired end SRR1799544 is conventional basespace SRR1799544 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799544_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36975 34.0 34.0 34.0 31.0 34.0 2 33.45525 34.0 34.0 34.0 31.0 34.0 3 33.54225 34.0 34.0 34.0 31.0 34.0 4 36.71975 37.0 37.0 37.0 35.0 37.0 5 36.63225 37.0 37.0 37.0 35.0 37.0 6 36.6685 37.0 37.0 37.0 35.0 37.0 7 36.6865 37.0 37.0 37.0 35.0 37.0 8 36.6725 37.0 37.0 37.0 35.0 37.0 9 38.556 39.0 39.0 39.0 38.0 39.0 10-14 38.8952 39.4 39.2 39.4 38.0 39.4 15-19 40.24865 41.0 40.0 41.0 38.8 41.0 20-24 40.13875 41.0 40.0 41.0 38.4 41.0 25-29 40.023649999999996 41.0 40.0 41.0 38.0 41.0 30-34 39.895149999999994 41.0 40.0 41.0 38.0 41.0 35-39 39.71319999999999 41.0 40.0 41.0 37.8 41.0 40-44 39.73295 41.0 40.0 41.0 37.8 41.0 45-49 39.8395 41.0 40.0 41.0 37.6 41.0 50-54 39.706199999999995 41.0 40.0 41.0 37.0 41.0 55-59 39.467650000000006 41.0 39.4 41.0 36.0 41.0 60-64 38.92145 40.4 38.0 41.0 35.0 41.0 65-69 38.191449999999996 39.2 36.6 41.0 35.0 41.0 70-74 37.181850000000004 37.6 35.4 39.4 34.4 41.0 75-79 35.64135 36.0 34.8 37.4 33.0 39.4 80-84 35.2308 35.2 35.0 36.6 34.0 37.8 85-89 34.668549999999996 35.0 35.0 35.8 34.0 36.6 90-94 34.3626 35.0 35.0 35.0 33.0 36.0 95-99 34.1529 35.0 35.0 35.0 33.0 35.2 100-104 34.0278 35.0 35.0 35.0 33.0 35.0 105-109 33.94725 35.0 34.6 35.0 32.8 35.0 110-114 33.761250000000004 35.0 34.0 35.0 32.0 35.0 115-119 33.686 35.0 34.0 35.0 31.8 35.0 120-124 33.483349999999994 35.0 34.0 35.0 31.0 35.0 125-129 33.3506 35.0 34.0 35.0 30.8 35.0 130-134 33.17325 35.0 34.0 35.0 30.6 35.0 135-139 32.82684999999999 35.0 33.6 35.0 29.4 35.0 140-144 32.4326 35.0 33.2 35.0 29.2 35.0 145-149 31.6435 34.0 33.0 35.0 27.0 35.0 150 24.99175 31.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 1.0 11 1.0 12 4.0 13 2.0 14 1.0 15 2.0 16 2.0 17 1.0 18 3.0 19 2.0 20 8.0 21 2.0 22 4.0 23 5.0 24 5.0 25 15.0 26 11.0 27 19.0 28 14.0 29 29.0 30 27.0 31 40.0 32 62.0 33 85.0 34 139.0 35 294.0 36 1148.0 37 2041.0 38 30.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.04857285928894 10.540811216825238 5.85878818227341 34.55182774161242 2 22.55 12.950000000000001 35.3 29.2 3 19.0 18.65 25.174999999999997 37.175000000000004 4 25.525 25.6 21.125 27.750000000000004 5 23.275000000000002 30.65 23.724999999999998 22.35 6 20.075000000000003 35.4 23.45 21.075 7 14.45 27.775 40.175 17.599999999999998 8 15.825 26.075 34.075 24.025 9 16.775000000000002 25.3 33.575 24.349999999999998 10-14 19.49 30.115 27.525 22.869999999999997 15-19 19.335 29.160000000000004 27.71 23.794999999999998 20-24 19.64 28.610000000000003 27.865000000000002 23.885 25-29 19.885 29.525000000000002 27.36 23.23 30-34 19.82 29.565 27.045 23.57 35-39 20.27 29.160000000000004 27.029999999999998 23.54 40-44 19.900000000000002 28.92 27.405 23.775 45-49 19.8 28.939999999999998 27.18 24.08 50-54 19.555 28.89 28.110000000000003 23.445 55-59 20.075000000000003 28.925 27.305 23.695 60-64 20.04 28.749999999999996 27.49 23.72 65-69 20.03 29.425 27.08 23.465 70-74 20.23 29.085 27.51 23.175 75-79 20.01 29.235 26.729999999999997 24.025 80-84 20.315 28.575 26.950000000000003 24.16 85-89 20.155 28.544999999999998 27.779999999999998 23.52 90-94 20.1480222033305 28.039205880882136 27.57913687053058 24.233635045256786 95-99 20.028004200630097 28.399259888983348 27.584137620643094 23.98859828974346 100-104 21.112111211121114 28.05780578057806 27.16271627162716 23.667366736673667 105-109 20.728109216382457 28.559283892583885 27.384107616142423 23.328499274891236 110-114 20.881264379313794 28.863659097729315 26.557967390217062 23.697109132739822 115-119 20.66309946491974 28.559283892583885 27.229084362654397 23.54853227984198 120-124 20.59 27.939999999999998 27.275 24.195 125-129 20.41 27.975 27.015 24.6 130-134 21.02105105255263 28.8064403220161 26.286314315715785 23.886194309715485 135-139 21.388555422168867 28.84653861544618 26.19547819127651 23.569427771108444 140-144 21.461073053652683 28.8114405720286 25.326266313315664 24.401220061003052 145-149 21.94 28.64 25.040000000000003 24.38 150 18.025 29.75 26.875 25.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 4.0 25 4.0 26 2.5 27 4.5 28 11.5 29 18.5 30 22.0 31 25.5 32 35.5 33 50.0 34 54.0 35 61.0 36 84.5 37 104.0 38 127.5 39 154.0 40 186.0 41 222.5 42 254.5 43 268.5 44 271.5 45 278.5 46 251.0 47 230.0 48 236.0 49 203.5 50 168.5 51 153.5 52 122.0 53 89.5 54 74.0 55 52.5 56 39.5 57 36.0 58 24.5 59 19.5 60 12.5 61 7.5 62 7.0 63 4.0 64 2.0 65 4.5 66 4.5 67 2.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.015 100-104 0.01 105-109 0.015 110-114 0.03 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.04 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7625000000000002 0.0 0.0 0.0 0.0 104-105 2.325 0.0 0.0 0.0 0.0 106-107 2.7875 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 4.9625 0.0 0.0 0.0 0.0 120-121 5.4875 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.225 0.0 0.0 0.0 0.0 126-127 6.6875 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 9.6375 0.0 0.0 0.0 0.0 134-135 10.9 0.0 0.0 0.0 0.0 136-137 12.0875 0.0 0.0 0.0 0.0 138 12.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCCG 10 0.006973645 144.0 6 CCCCCCC 40 0.007966741 18.0 90-94 >>END_MODULE SRR1799544 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799544_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.655 34.0 33.0 34.0 31.0 34.0 2 32.76375 34.0 34.0 34.0 31.0 34.0 3 32.81875 34.0 34.0 34.0 31.0 34.0 4 35.9235 37.0 37.0 37.0 35.0 37.0 5 35.95275 37.0 37.0 37.0 35.0 37.0 6 35.9775 37.0 37.0 37.0 35.0 37.0 7 35.995 37.0 37.0 37.0 35.0 37.0 8 35.96125 37.0 37.0 37.0 35.0 37.0 9 37.811 39.0 39.0 39.0 37.0 39.0 10-14 38.114700000000006 39.4 39.2 39.4 37.2 39.4 15-19 39.4156 41.0 40.0 41.0 38.0 41.0 20-24 39.344049999999996 41.0 40.0 41.0 38.0 41.0 25-29 39.22475 41.0 40.0 41.0 38.0 41.0 30-34 39.10245 41.0 40.0 41.0 37.8 41.0 35-39 38.93554999999999 41.0 40.0 41.0 37.0 41.0 40-44 38.859950000000005 41.0 40.0 41.0 36.8 41.0 45-49 38.82625 41.0 39.6 41.0 36.6 41.0 50-54 37.9332 39.8 38.4 40.6 34.6 40.8 55-59 38.249500000000005 40.0 38.4 41.0 35.0 41.0 60-64 37.61565 39.6 37.2 41.0 34.0 41.0 65-69 37.196999999999996 39.0 36.2 41.0 34.2 41.0 70-74 36.19855 37.2 35.0 39.2 34.0 41.0 75-79 35.1623 36.0 35.0 37.6 33.6 39.2 80-84 34.2925 35.0 35.0 36.4 32.8 37.4 85-89 33.71635 35.0 35.0 35.4 32.0 36.4 90-94 33.4348 35.0 35.0 35.0 32.0 36.0 95-99 33.25895 35.0 34.2 35.0 31.4 35.2 100-104 33.11615 35.0 34.0 35.0 31.0 35.0 105-109 32.985699999999994 35.0 34.0 35.0 30.6 35.0 110-114 32.8776 35.0 34.0 35.0 30.4 35.0 115-119 32.6641 35.0 34.0 35.0 29.4 35.0 120-124 32.50945 35.0 34.0 35.0 29.0 35.0 125-129 32.310950000000005 35.0 33.6 35.0 29.0 35.0 130-134 32.0536 35.0 33.0 35.0 27.0 35.0 135-139 31.7181 35.0 33.0 35.0 26.2 35.0 140-144 31.2634 34.6 32.4 35.0 24.6 35.0 145-149 30.62085 34.0 32.0 35.0 21.0 35.0 150 26.77525 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 72.0 3 6.0 4 1.0 5 2.0 6 2.0 7 2.0 8 5.0 9 2.0 10 2.0 11 3.0 12 2.0 13 2.0 14 2.0 15 3.0 16 2.0 17 2.0 18 6.0 19 3.0 20 8.0 21 2.0 22 5.0 23 4.0 24 18.0 25 12.0 26 11.0 27 18.0 28 20.0 29 29.0 30 26.0 31 47.0 32 71.0 33 96.0 34 145.0 35 358.0 36 1212.0 37 1761.0 38 38.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.475 21.425 9.975000000000001 25.124999999999996 2 26.3 27.325 30.625000000000004 15.75 3 21.15 28.625 30.875000000000004 19.35 4 25.05 33.0 23.724999999999998 18.224999999999998 5 25.7 36.75 20.674999999999997 16.875 6 20.549999999999997 38.574999999999996 23.625 17.25 7 20.7 21.95 37.6 19.75 8 22.8 25.674999999999997 27.975 23.549999999999997 9 24.58114528632158 23.655913978494624 29.857464366091524 21.905476369092273 10-14 24.08 28.74 26.590000000000003 20.59 15-19 24.23 27.725 27.665 20.380000000000003 20-24 23.255 28.249999999999996 27.775 20.72 25-29 23.535 28.185 27.915 20.365 30-34 23.417341734173416 28.372837283728376 27.662766276627664 20.547054705470547 35-39 23.599999999999998 28.134999999999998 27.634999999999998 20.630000000000003 40-44 23.705000000000002 28.235 28.065 19.994999999999997 45-49 23.798569785467823 27.94919237885683 27.584137620643094 20.668100215032254 50-54 23.198479771965793 28.659298894834222 27.744161624243635 20.398059708956342 55-59 24.09 27.735 27.725 20.45 60-64 23.43617180859043 27.38136906845342 28.751437571878597 20.431021551077556 65-69 23.815 27.91 27.765 20.51 70-74 23.517351735173516 27.927792779277926 28.03780378037804 20.517051705170516 75-79 23.275000000000002 27.245 29.294999999999998 20.185 80-84 23.61 27.77 28.810000000000002 19.81 85-89 23.787378737873787 27.797779777977798 28.317831783178317 20.097009700970098 90-94 23.990000000000002 27.26 28.395 20.355 95-99 23.715 27.615000000000002 28.34 20.330000000000002 100-104 24.065 27.41 27.87 20.655 105-109 24.43 27.735 27.905 19.93 110-114 23.7 27.42 28.43 20.45 115-119 24.41 27.725 27.715 20.150000000000002 120-124 24.498674801220183 27.804170625593837 28.10921638245737 19.58793819072861 125-129 24.70123506175309 27.721386069303467 27.991399569978498 19.585979298964947 130-134 24.86248624862486 28.20782078207821 27.912791279127912 19.016901690169018 135-139 25.716285814290714 27.721386069303467 27.141357067853395 19.420971048552428 140-144 27.066766691672917 28.067016754188543 26.151537884471114 18.714678669667418 145-149 27.195878351340536 27.260904361744696 26.20048019207683 19.342737094837936 150 28.121090818113586 28.446334751063297 25.64423317488116 17.788341255941955 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.5 21 0.5 22 0.5 23 2.0 24 5.0 25 6.0 26 5.0 27 5.0 28 9.0 29 16.0 30 19.5 31 22.5 32 26.5 33 39.0 34 50.5 35 62.0 36 77.0 37 90.5 38 118.5 39 157.5 40 185.5 41 219.0 42 260.0 43 276.0 44 278.0 45 276.0 46 278.5 47 273.5 48 233.5 49 196.0 50 168.5 51 139.5 52 121.5 53 90.5 54 65.0 55 57.0 56 44.0 57 32.5 58 25.5 59 19.0 60 9.5 61 2.0 62 2.5 63 4.0 64 4.5 65 3.5 66 1.5 67 2.5 68 3.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.015 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.005 130-134 0.01 135-139 0.005 140-144 0.025 145-149 0.04 150 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.35 0.0 0.0 0.0 0.0 110-111 3.75 0.0 0.0 0.0 0.0 112-113 3.8 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.9 0.0 0.0 0.0 0.0 118-119 5.012499999999999 0.0 0.0 0.0 0.0 120-121 5.5625 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.3 0.0 0.0 0.0 0.0 126-127 6.7625 0.0 0.0 0.0 0.0 128-129 7.2375 0.0 0.0 0.0 0.0 130-131 8.4375 0.0 0.0 0.0 0.0 132-133 9.6875 0.0 0.0 0.0 0.0 134-135 10.975 0.0 0.0 0.0 0.0 136-137 12.1875 0.0 0.0 0.0 0.0 138 13.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205498 spots for SRR1799544.sra Written 1205498 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra Read 1205484 spots for SRR1799544.sra Written 1205484 spots for SRR1799544.sra SRR ids: ['SRR1799544.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_idnwhdqi SRR1799544.sra spots: 24109694 blocks: [[1, 1205484], [1205485, 2410968], [2410969, 3616452], [3616453, 4821936], [4821937, 6027420], [6027421, 7232904], [7232905, 8438388], [8438389, 9643872], [9643873, 10849356], [10849357, 12054840], [12054841, 13260324], [13260325, 14465808], [14465809, 15671292], [15671293, 16876776], [16876777, 18082260], [18082261, 19287744], [19287745, 20493228], [20493229, 21698712], [21698713, 22904196], [22904197, 24109694]] SRR1799544 file size 8101194 SRR1799544 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799544 SRR1799544_1.fastq SRR1799544_2.fastq Input file: SRR1799544_1.fastq Paired file: SRR1799544_2.fastq trimmed: SRR1799544-trimmed-pair1.fastq, SRR1799544-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:53:06 2025 >> started Thu Feb 13 21:53:36 2025 >> done (29.781s) 24109694 read pairs processed; of these: 87173 ( 0.36%) short read pairs filtered out after trimming by size control 331275 ( 1.37%) empty read pairs filtered out after trimming by size control 23691246 (98.26%) read pairs available; of these: 9509149 (40.14%) trimmed read pairs available after processing 14182097 (59.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 4 0.00% 21 15 0.00% 22 15 0.00% 23 26 0.00% 24 40 0.00% 25 49 0.00% 26 42 0.00% 27 76 0.00% 28 75 0.00% 29 90 0.00% 30 127 0.00% 31 151 0.00% 32 185 0.00% 33 199 0.00% 34 218 0.00% 35 265 0.00% 36 329 0.00% 37 374 0.00% 38 393 0.00% 39 460 0.00% 40 486 0.00% 41 549 0.00% 42 605 0.00% 43 622 0.00% 44 682 0.00% 45 736 0.00% 46 811 0.00% 47 894 0.00% 48 961 0.00% 49 1028 0.00% 50 1103 0.00% 51 1151 0.00% 52 1265 0.01% 53 1380 0.01% 54 1487 0.01% 55 1616 0.01% 56 1734 0.01% 57 1975 0.01% 58 2064 0.01% 59 2328 0.01% 60 2455 0.01% 61 2579 0.01% 62 2860 0.01% 63 3099 0.01% 64 3464 0.01% 65 3809 0.02% 66 4633 0.02% 67 5062 0.02% 68 4674 0.02% 69 5287 0.02% 70 5789 0.02% 71 6075 0.03% 72 6366 0.03% 73 6745 0.03% 74 6759 0.03% 75 6539 0.03% 76 6005 0.03% 77 5775 0.02% 78 5399 0.02% 79 5381 0.02% 80 5285 0.02% 81 5597 0.02% 82 5952 0.03% 83 6819 0.03% 84 12561 0.05% 85 14232 0.06% 86 17211 0.07% 87 15782 0.07% 88 17443 0.07% 89 24545 0.10% 90 56019 0.24% 91 22367 0.09% 92 20373 0.09% 93 21958 0.09% 94 21168 0.09% 95 28558 0.12% 96 68133 0.29% 97 52227 0.22% 98 27393 0.12% 99 27728 0.12% 100 37504 0.16% 101 32626 0.14% 102 41869 0.18% 103 71700 0.30% 104 80831 0.34% 105 39154 0.17% 106 68538 0.29% 107 51185 0.22% 108 109286 0.46% 109 30437 0.13% 110 29265 0.12% 111 22608 0.10% 112 21460 0.09% 113 41016 0.17% 114 34457 0.15% 115 160119 0.68% 116 48134 0.20% 117 40938 0.17% 118 36835 0.16% 119 101599 0.43% 120 119852 0.51% 121 98932 0.42% 122 44567 0.19% 123 34302 0.14% 124 86170 0.36% 125 69162 0.29% 126 73830 0.31% 127 89644 0.38% 128 145531 0.61% 129 161715 0.68% 130 150292 0.63% 131 200795 0.85% 132 190804 0.81% 133 205901 0.87% 134 206679 0.87% 135 203972 0.86% 136 212017 0.89% 137 214364 0.90% 138 220480 0.93% 139 224015 0.95% 140 229260 0.97% 141 235564 0.99% 142 243471 1.03% 143 253718 1.07% 144 274868 1.16% 145 297281 1.25% 146 341842 1.44% 147 421141 1.78% 148 591266 2.50% 149 1971420 8.32% 150 14182097 59.86% 23691246 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.5 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=322.73 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=44 prefix-density=0.19 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=6 fanout-score=53.30 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.8 sequence=TGTTGGTGGTGG SRR1799544 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:54:14 Started mapping on | Feb 13 21:54:14 Finished on | Feb 13 21:55:54 Mapping speed, Million of reads per hour | 852.88 Number of input reads | 23691246 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 22983038 Uniquely mapped reads % | 97.01% Average mapped length | 286.49 Number of splices: Total | 19663246 Number of splices: Annotated (sjdb) | 19336550 Number of splices: GT/AG | 19369960 Number of splices: GC/AG | 228770 Number of splices: AT/AC | 18427 Number of splices: Non-canonical | 46089 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412260 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 26538 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.11% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324653 324653 324653 N_multimapping 412260 412260 412260 N_noFeature 650204 22686077 800079 N_ambiguous 234691 1498 86440 UnstrandedReadsAssigned:22098143 PositiveStrandReadsAssigned:295463 NegativeStrandReadsAssigned:22096519 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR1799544 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799544-trimmed-pair1.fastq SRR1799544-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,691,246 reads, 22,000,534 reads pseudoaligned [quant] estimated average fragment length: 192.965 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR1799544.ke.tsv 34699 SRR1799544.se.tsv 87100 total ==> SRR1799544.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.03 443 11.7941 Potri.005G024800.1.v4.1 1035 843.035 87 5.01701 Potri.004G059700.1.v4.1 961 769.041 13 0.821797 Potri.007G009000.2.v4.1 1416 1224.03 0 0 Potri.003G141000.2.v4.1 2943 2751.03 329.107 5.81583 Potri.016G087400.1.v4.1 270 99.0236 2143.58 1052.38 Potri.015G069301.1.v4.1 564 373.131 0 0 Potri.010G195200.1.v4.1 1773 1581.03 57 1.75269 Potri.012G127500.1.v4.1 977 785.041 5870 363.51 ==> SRR1799544.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2402 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 339 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR1799544 completed mapping pipeline successfully