Starting /dee2/code/volunteer_pipeline.sh SRR1799545 current disk space = 3088441069568 free memory = 1432163292 SRR1799545 SRAfilesize a629f092a266fc41b41811fc3d2a02c2 SRR1799545.sra SRR1799545.sra file validated SRR1799545 is paired end SRR1799545 is conventional basespace SRR1799545 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799545_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3465 34.0 34.0 34.0 31.0 34.0 2 33.4645 34.0 34.0 34.0 31.0 34.0 3 33.575 34.0 34.0 34.0 31.0 34.0 4 36.76675 37.0 37.0 37.0 37.0 37.0 5 36.7115 37.0 37.0 37.0 37.0 37.0 6 36.716 37.0 37.0 37.0 36.0 37.0 7 36.7095 37.0 37.0 37.0 36.0 37.0 8 36.59525 37.0 37.0 37.0 35.0 37.0 9 38.62575 39.0 39.0 39.0 38.0 39.0 10-14 38.965999999999994 39.4 39.2 39.4 38.2 39.4 15-19 40.2958 41.0 40.0 41.0 39.0 41.0 20-24 40.25645 41.0 40.0 41.0 39.0 41.0 25-29 40.12755 41.0 40.0 41.0 38.2 41.0 30-34 39.98425 41.0 40.0 41.0 38.0 41.0 35-39 39.8467 41.0 40.0 41.0 38.0 41.0 40-44 39.867549999999994 41.0 40.0 41.0 38.0 41.0 45-49 39.9868 41.0 40.0 41.0 38.0 41.0 50-54 39.84394999999999 41.0 40.0 41.0 37.4 41.0 55-59 39.51595 41.0 39.2 41.0 36.4 41.0 60-64 39.01705 40.4 38.2 41.0 35.0 41.0 65-69 38.19029999999999 39.2 36.6 41.0 35.0 41.0 70-74 37.243700000000004 37.6 35.4 39.4 34.8 41.0 75-79 35.81935 36.0 34.8 37.4 33.4 39.4 80-84 35.36225 35.2 35.0 36.6 34.0 37.8 85-89 34.7979 35.0 35.0 35.8 34.0 36.6 90-94 34.47545000000001 35.0 35.0 35.0 34.0 36.0 95-99 34.28035 35.0 35.0 35.0 33.2 35.2 100-104 34.179649999999995 35.0 35.0 35.0 33.0 35.0 105-109 34.16095 35.0 35.0 35.0 33.0 35.0 110-114 34.0018 35.0 34.6 35.0 32.8 35.0 115-119 33.85504999999999 35.0 34.0 35.0 32.0 35.0 120-124 33.7415 35.0 34.0 35.0 32.0 35.0 125-129 33.548199999999994 35.0 34.0 35.0 31.2 35.0 130-134 33.2885 35.0 34.0 35.0 31.0 35.0 135-139 33.084950000000006 35.0 34.0 35.0 30.4 35.0 140-144 32.9101 35.0 33.6 35.0 30.2 35.0 145-149 32.203799999999994 35.0 33.0 35.0 29.0 35.0 150 25.9345 32.0 20.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 2.0 13 4.0 14 1.0 15 3.0 16 3.0 17 1.0 18 0.0 19 4.0 20 1.0 21 3.0 22 3.0 23 7.0 24 4.0 25 13.0 26 8.0 27 12.0 28 9.0 29 18.0 30 26.0 31 42.0 32 45.0 33 75.0 34 134.0 35 270.0 36 1117.0 37 2171.0 38 22.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05843992977176 11.336844745422624 7.098068723350891 40.506646601454726 2 21.725 13.175 36.35 28.749999999999996 3 20.9 16.525000000000002 25.3 37.275000000000006 4 23.474999999999998 26.05 21.575 28.9 5 24.0 31.225 23.7 21.075 6 18.925 35.775 24.6 20.7 7 14.274999999999999 28.199999999999996 40.5 17.025000000000002 8 17.625 26.424999999999997 31.874999999999996 24.075 9 19.1 24.15 33.825 22.925 10-14 19.61 30.220000000000002 27.439999999999998 22.73 15-19 19.54 29.15 27.42 23.89 20-24 19.48 29.29 27.76 23.47 25-29 19.755 29.060000000000002 27.72 23.465 30-34 20.015 28.88 27.589999999999996 23.515 35-39 19.925 29.5 27.145000000000003 23.43 40-44 19.66 29.4 27.24 23.7 45-49 20.150000000000002 29.38 26.93 23.54 50-54 20.025000000000002 29.825000000000003 27.175 22.975 55-59 19.75 29.625 27.24 23.385 60-64 19.55 28.92 27.644999999999996 23.885 65-69 20.36 28.605000000000004 27.255000000000003 23.78 70-74 20.395 29.595 27.125 22.884999999999998 75-79 19.509999999999998 28.98 27.465 24.044999999999998 80-84 20.330000000000002 29.13 27.400000000000002 23.14 85-89 19.985 28.560000000000002 27.950000000000003 23.505000000000003 90-94 20.29507376844211 28.927231807951987 27.206801700425103 23.570892723180794 95-99 20.850212553138284 29.00725181295324 26.87171792948237 23.270817704426104 100-104 20.615153788447113 28.902225556389098 26.936734183545884 23.545886471617905 105-109 21.406421926577973 28.243473041912576 27.233169950985296 23.116935080524158 110-114 21.404983488441907 29.175422795957168 26.273391373961775 23.146202341639146 115-119 21.1666416529091 29.456200910500772 25.729151033068188 23.648006403521936 120-124 20.901045052252613 29.34646732336617 25.90129506475324 23.851192559627982 125-129 20.925 28.854999999999997 25.885 24.335 130-134 21.297129712971298 28.922892289228923 25.73757375737574 24.04240424042404 135-139 21.552931759055433 29.437662597558536 25.310186111667 23.69921953171903 140-144 21.332133213321335 28.962896289628965 25.06250625062506 24.64246424642464 145-149 20.965 29.849999999999998 24.925 24.26 150 17.525 30.349999999999998 25.900000000000002 26.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.5 24 0.5 25 1.0 26 3.0 27 5.0 28 10.0 29 15.0 30 15.0 31 23.5 32 43.5 33 57.0 34 54.5 35 68.0 36 97.5 37 119.0 38 126.5 39 150.5 40 191.0 41 235.0 42 257.5 43 260.5 44 266.0 45 266.5 46 274.5 47 257.0 48 216.0 49 191.5 50 167.0 51 136.0 52 123.0 53 98.5 54 73.5 55 55.5 56 35.0 57 28.0 58 20.0 59 13.0 60 10.5 61 5.0 62 4.5 63 4.5 64 3.5 65 3.5 66 2.5 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.03 110-114 0.06999999999999999 115-119 0.055 120-124 0.005 125-129 0.0 130-134 0.01 135-139 0.06 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.525 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.6875 0.0 0.0 0.0 0.0 102-103 3.2625 0.0 0.0 0.0 0.0 104-105 3.8875 0.0 0.0 0.0 0.0 106-107 4.5625 0.0 0.0 0.0 0.0 108-109 5.6 0.0 0.0 0.0 0.0 110-111 6.2875 0.0 0.0 0.0 0.0 112-113 6.825 0.0 0.0 0.0 0.0 114-115 7.574999999999999 0.0 0.0 0.0 0.0 116-117 8.7 0.0 0.0 0.0 0.0 118-119 9.4625 0.0 0.0 0.0 0.0 120-121 10.3625 0.0 0.0 0.0 0.0 122-123 11.3375 0.0 0.0 0.0 0.0 124-125 12.7375 0.0 0.0 0.0 0.0 126-127 13.662500000000001 0.0 0.0 0.0 0.0 128-129 14.8 0.0 0.0 0.0 0.0 130-131 16.262500000000003 0.0 0.0 0.0 0.0 132-133 17.9125 0.0 0.0 0.0 0.0 134-135 19.2 0.0 0.0 0.0 0.0 136-137 20.475 0.0 0.0 0.0 0.0 138 21.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007966741 18.0 125-129 >>END_MODULE SRR1799545 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799545_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.899 34.0 33.0 34.0 31.0 34.0 2 33.032 34.0 33.0 34.0 31.0 34.0 3 33.10575 34.0 34.0 34.0 31.0 34.0 4 36.3705 37.0 37.0 37.0 35.0 37.0 5 36.342 37.0 37.0 37.0 35.0 37.0 6 36.401 37.0 37.0 37.0 35.0 37.0 7 36.3735 37.0 37.0 37.0 35.0 37.0 8 36.32625 37.0 37.0 37.0 35.0 37.0 9 38.26175 39.0 39.0 39.0 38.0 39.0 10-14 38.59185 39.4 39.2 39.4 37.6 39.4 15-19 39.9137 41.0 40.0 41.0 38.2 41.0 20-24 39.88915 41.0 40.0 41.0 38.6 41.0 25-29 39.79375 41.0 40.0 41.0 38.0 41.0 30-34 39.6371 41.0 40.0 41.0 38.0 41.0 35-39 39.495 41.0 40.0 41.0 38.0 41.0 40-44 39.40259999999999 41.0 40.0 41.0 37.6 41.0 45-49 39.32415 41.0 40.0 41.0 37.4 41.0 50-54 38.4306 39.8 38.6 40.6 35.6 40.6 55-59 38.7467 40.0 38.8 41.0 35.6 41.0 60-64 38.146699999999996 39.8 37.4 41.0 34.8 41.0 65-69 37.71445 39.0 36.4 41.0 35.0 41.0 70-74 36.680400000000006 37.4 35.2 39.4 34.4 41.0 75-79 35.581100000000006 36.2 35.0 37.8 34.0 39.2 80-84 34.75455 35.0 35.0 36.4 33.4 37.8 85-89 34.166250000000005 35.0 35.0 35.6 33.0 36.4 90-94 33.843 35.0 35.0 35.0 33.0 36.0 95-99 33.69815 35.0 34.8 35.0 32.4 35.4 100-104 33.5507 35.0 34.4 35.0 32.0 35.0 105-109 33.3817 35.0 34.0 35.0 31.0 35.0 110-114 33.2558 35.0 34.0 35.0 31.0 35.0 115-119 33.067449999999994 35.0 34.0 35.0 30.2 35.0 120-124 32.884699999999995 35.0 34.0 35.0 30.0 35.0 125-129 32.6389 35.0 33.6 35.0 29.4 35.0 130-134 32.227 35.0 33.0 35.0 28.2 35.0 135-139 31.8975 34.8 32.8 35.0 26.2 35.0 140-144 31.376150000000003 34.0 32.2 35.0 24.8 35.0 145-149 30.6375 34.0 31.4 35.0 21.2 35.0 150 26.80675 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 3.0 4 1.0 5 5.0 6 1.0 7 1.0 8 3.0 9 3.0 10 3.0 11 2.0 12 5.0 13 4.0 14 3.0 15 0.0 16 4.0 17 3.0 18 3.0 19 2.0 20 2.0 21 4.0 22 4.0 23 9.0 24 13.0 25 5.0 26 8.0 27 13.0 28 23.0 29 27.0 30 34.0 31 45.0 32 65.0 33 95.0 34 173.0 35 366.0 36 1241.0 37 1753.0 38 45.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.275 18.15 12.2 30.375000000000004 2 24.85 26.224999999999998 33.6 15.325 3 21.55 27.325 30.45 20.674999999999997 4 24.525 32.95 23.3 19.225 5 24.75 34.35 24.875 16.025 6 21.55 37.3 23.925 17.224999999999998 7 20.40510127531883 19.929982495623904 39.8849712428107 19.779944986246562 8 19.85 25.724999999999998 29.325000000000003 25.1 9 22.0360180090045 24.262131065532767 31.190595297648827 22.511255627813906 10-14 23.83119155957798 28.466423321166058 26.906345317265863 20.796039801990098 15-19 23.315 28.205000000000002 28.305000000000003 20.175 20-24 23.200000000000003 28.12 27.865000000000002 20.815 25-29 23.674999999999997 28.24 27.625 20.46 30-34 23.331999599879964 27.81834550365109 28.513554066219864 20.336100830249073 35-39 22.775000000000002 28.199999999999996 28.405 20.62 40-44 23.27232723272327 27.667766776677666 28.437843784378437 20.622062206220622 45-49 22.911455727863935 27.963981990995496 29.034517258629318 20.090045022511255 50-54 23.16310708748062 28.039813934877206 28.569999499824938 20.227079477817238 55-59 23.038455768365253 27.77916687503125 28.454268140221036 20.728109216382457 60-64 23.199639927985597 27.515503100620126 29.45589117823565 19.82896579315863 65-69 22.876863058917678 27.858357507252173 28.858657597279187 20.406121836550966 70-74 23.685658546345856 27.002150967935574 29.128107648441798 20.184082837276772 75-79 23.151157557877895 27.241362068103403 29.181459072953647 20.426021301065052 80-84 24.126206310315514 27.29136456822841 28.86144307215361 19.720986049302468 85-89 23.735933983495876 27.161790447611907 28.872218054513628 20.230057514378593 90-94 23.765 27.060000000000002 29.065 20.11 95-99 23.855 27.279999999999998 28.88 19.985 100-104 24.55 27.845 28.23 19.375 105-109 24.57 27.855 27.455000000000002 20.119999999999997 110-114 25.025 27.51 27.834999999999997 19.63 115-119 25.555 27.845 27.045 19.555 120-124 25.49892462361827 27.51463012054219 27.579652878507478 19.406792377332067 125-129 26.23393509026354 28.189228384257635 26.38895834375156 19.187878181727257 130-134 26.76401460219033 27.799169875481322 26.543981597239586 18.892833925088766 135-139 27.102710271027103 28.302830283028303 25.57255725572557 19.021902190219024 140-144 27.219970984041225 28.19550752914103 26.004302366301467 18.580219120516283 145-149 27.77694348500776 28.202432797717375 25.904790509085444 18.115833208189418 150 29.694541812719077 28.16725087631447 25.43815723585378 16.700050075112667 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 0.5 24 2.5 25 4.0 26 5.5 27 8.0 28 7.5 29 8.5 30 13.5 31 21.5 32 28.0 33 36.0 34 53.5 35 68.0 36 89.5 37 110.5 38 132.5 39 177.0 40 221.0 41 242.0 42 266.0 43 274.5 44 281.5 45 285.5 46 266.5 47 257.0 48 235.5 49 198.5 50 161.0 51 124.5 52 99.5 53 83.0 54 58.0 55 41.0 56 33.0 57 26.5 58 18.0 59 13.5 60 12.5 61 6.5 62 3.5 63 3.5 64 3.0 65 3.5 66 2.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.05 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.03 35-39 0.0 40-44 0.01 45-49 0.05 50-54 0.034999999999999996 55-59 0.015 60-64 0.02 65-69 0.03 70-74 0.045 75-79 0.005 80-84 0.005 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.015 130-134 0.015 135-139 0.01 140-144 0.055 145-149 0.11499999999999999 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2875 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 3.2625 0.0 0.0 0.0 0.0 104-105 3.8875 0.0 0.0 0.0 0.0 106-107 4.5875 0.0 0.0 0.0 0.0 108-109 5.625 0.0 0.0 0.0 0.0 110-111 6.3125 0.0 0.0 0.0 0.0 112-113 6.875 0.0 0.0 0.0 0.0 114-115 7.6625 0.0 0.0 0.0 0.0 116-117 8.8375 0.0 0.0 0.0 0.0 118-119 9.625 0.0 0.0 0.0 0.0 120-121 10.5375 0.0 0.0 0.0 0.0 122-123 11.524999999999999 0.0 0.0 0.0 0.0 124-125 12.9375 0.0 0.0 0.0 0.0 126-127 13.85 0.0 0.0 0.0 0.0 128-129 14.9625 0.0 0.0 0.0 0.0 130-131 16.425 0.0 0.0 0.0 0.0 132-133 18.0375 0.0 0.0 0.0 0.0 134-135 19.325 0.0 0.0 0.0 0.0 136-137 20.6 0.0 0.0 0.0 0.0 138 21.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCCA 10 0.006973645 144.0 9 GTGAAGT 10 0.006973645 144.0 1 >>END_MODULE Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129483 spots for SRR1799545.sra Written 1129483 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra Read 1129469 spots for SRR1799545.sra Written 1129469 spots for SRR1799545.sra SRR ids: ['SRR1799545.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fg8kksbz SRR1799545.sra spots: 22589394 blocks: [[1, 1129469], [1129470, 2258938], [2258939, 3388407], [3388408, 4517876], [4517877, 5647345], [5647346, 6776814], [6776815, 7906283], [7906284, 9035752], [9035753, 10165221], [10165222, 11294690], [11294691, 12424159], [12424160, 13553628], [13553629, 14683097], [14683098, 15812566], [15812567, 16942035], [16942036, 18071504], [18071505, 19200973], [19200974, 20330442], [20330443, 21459911], [21459912, 22589394]] SRR1799545 file size 7588984 SRR1799545 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799545 SRR1799545_1.fastq SRR1799545_2.fastq Input file: SRR1799545_1.fastq Paired file: SRR1799545_2.fastq trimmed: SRR1799545-trimmed-pair1.fastq, SRR1799545-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:55:10 2025 >> started Thu Feb 13 21:55:35 2025 >> done (25.200s) 22589394 read pairs processed; of these: 56197 ( 0.25%) short read pairs filtered out after trimming by size control 145969 ( 0.65%) empty read pairs filtered out after trimming by size control 22387228 (99.11%) read pairs available; of these: 9916165 (44.29%) trimmed read pairs available after processing 12471063 (55.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 8 0.00% 21 13 0.00% 22 26 0.00% 23 23 0.00% 24 16 0.00% 25 36 0.00% 26 59 0.00% 27 57 0.00% 28 62 0.00% 29 81 0.00% 30 113 0.00% 31 104 0.00% 32 132 0.00% 33 178 0.00% 34 222 0.00% 35 257 0.00% 36 263 0.00% 37 316 0.00% 38 344 0.00% 39 376 0.00% 40 412 0.00% 41 469 0.00% 42 495 0.00% 43 582 0.00% 44 601 0.00% 45 641 0.00% 46 768 0.00% 47 816 0.00% 48 944 0.00% 49 975 0.00% 50 1159 0.01% 51 1184 0.01% 52 1286 0.01% 53 1324 0.01% 54 1449 0.01% 55 1588 0.01% 56 1701 0.01% 57 2152 0.01% 58 2949 0.01% 59 3524 0.02% 60 2535 0.01% 61 2811 0.01% 62 3129 0.01% 63 3512 0.02% 64 3922 0.02% 65 4548 0.02% 66 6272 0.03% 67 6922 0.03% 68 5845 0.03% 69 6341 0.03% 70 7201 0.03% 71 7927 0.04% 72 8961 0.04% 73 10315 0.05% 74 11204 0.05% 75 12278 0.05% 76 12124 0.05% 77 11929 0.05% 78 11554 0.05% 79 10815 0.05% 80 9298 0.04% 81 8673 0.04% 82 8257 0.04% 83 8276 0.04% 84 12398 0.06% 85 13921 0.06% 86 17699 0.08% 87 26247 0.12% 88 48877 0.22% 89 56018 0.25% 90 38881 0.17% 91 23024 0.10% 92 21091 0.09% 93 26258 0.12% 94 46399 0.21% 95 38694 0.17% 96 33251 0.15% 97 31608 0.14% 98 29563 0.13% 99 34218 0.15% 100 48742 0.22% 101 71152 0.32% 102 57253 0.26% 103 61073 0.27% 104 71667 0.32% 105 103208 0.46% 106 112550 0.50% 107 132898 0.59% 108 108886 0.49% 109 99697 0.45% 110 60309 0.27% 111 53227 0.24% 112 72162 0.32% 113 84907 0.38% 114 133920 0.60% 115 157217 0.70% 116 136663 0.61% 117 126209 0.56% 118 103328 0.46% 119 107215 0.48% 120 124292 0.56% 121 137960 0.62% 122 138195 0.62% 123 136757 0.61% 124 148324 0.66% 125 135379 0.60% 126 119075 0.53% 127 141905 0.63% 128 135446 0.61% 129 158772 0.71% 130 170724 0.76% 131 180713 0.81% 132 177527 0.79% 133 171624 0.77% 134 177113 0.79% 135 181317 0.81% 136 185419 0.83% 137 188203 0.84% 138 192514 0.86% 139 196087 0.88% 140 199606 0.89% 141 205387 0.92% 142 211222 0.94% 143 221911 0.99% 144 239417 1.07% 145 257196 1.15% 146 301415 1.35% 147 359106 1.60% 148 503719 2.25% 149 1607052 7.18% 150 12471063 55.71% 22387228 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=38 prefix-density=0.19 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=228.28 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.8 sequence=GTTGACTTCTTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=46 fanout-score=76.82 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.5 sequence=CTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGG SRR1799545 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:56:15 Started mapping on | Feb 13 21:56:15 Finished on | Feb 13 21:57:45 Mapping speed, Million of reads per hour | 895.49 Number of input reads | 22387228 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 21804638 Uniquely mapped reads % | 97.40% Average mapped length | 281.73 Number of splices: Total | 18538113 Number of splices: Annotated (sjdb) | 18214602 Number of splices: GT/AG | 18264003 Number of splices: GC/AG | 215006 Number of splices: AT/AC | 15754 Number of splices: Non-canonical | 43350 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395161 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 23531 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 205020 205020 205020 N_multimapping 395161 395161 395161 N_noFeature 626945 21531510 774219 N_ambiguous 209857 1143 83144 UnstrandedReadsAssigned:20967836 PositiveStrandReadsAssigned:271985 NegativeStrandReadsAssigned:20947275 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR1799545 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799545-trimmed-pair1.fastq SRR1799545-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,387,228 reads, 20,880,219 reads pseudoaligned [quant] estimated average fragment length: 184.66 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR1799545.ke.tsv 34699 SRR1799545.se.tsv 87100 total ==> SRR1799545.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1834.34 506 15.2189 Potri.005G024800.1.v4.1 1035 851.34 61 3.95311 Potri.004G059700.1.v4.1 961 777.34 15 1.06461 Potri.007G009000.2.v4.1 1416 1232.34 0 0 Potri.003G141000.2.v4.1 2943 2759.34 359.143 7.18083 Potri.016G087400.1.v4.1 270 106.204 2253 1170.4 Potri.015G069301.1.v4.1 564 381.067 0 0 Potri.010G195200.1.v4.1 1773 1589.34 32 1.11082 Potri.012G127500.1.v4.1 977 793.34 6211 431.931 ==> SRR1799545.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2078 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1799545 completed mapping pipeline successfully