Starting /dee2/code/volunteer_pipeline.sh SRR1799546 current disk space = 3088686080000 free memory = 1495897736 SRR1799546 SRAfilesize 6a15ab46a6677470c00b518b9866df51 SRR1799546.sra SRR1799546.sra file validated SRR1799546 is paired end SRR1799546 is conventional basespace SRR1799546 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799546_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2905 34.0 34.0 34.0 31.0 34.0 2 33.42975 34.0 34.0 34.0 31.0 34.0 3 33.45975 34.0 34.0 34.0 31.0 34.0 4 36.71725 37.0 37.0 37.0 35.0 37.0 5 36.678 37.0 37.0 37.0 35.0 37.0 6 36.67475 37.0 37.0 37.0 35.0 37.0 7 36.6405 37.0 37.0 37.0 35.0 37.0 8 36.62825 37.0 37.0 37.0 35.0 37.0 9 38.5525 39.0 39.0 39.0 37.0 39.0 10-14 38.8609 39.4 39.2 39.4 37.6 39.4 15-19 40.20215 41.0 40.0 41.0 38.2 41.0 20-24 40.13385 41.0 40.0 41.0 38.2 41.0 25-29 39.9889 41.0 40.0 41.0 38.0 41.0 30-34 39.85545 41.0 40.0 41.0 38.0 41.0 35-39 39.643899999999995 41.0 40.0 41.0 37.6 41.0 40-44 39.53855 41.0 40.0 41.0 37.4 41.0 45-49 39.1713 40.8 39.0 41.0 36.2 41.0 50-54 39.2816 40.6 39.0 41.0 35.8 41.0 55-59 39.0457 40.6 38.6 41.0 35.4 41.0 60-64 38.56415 40.0 37.2 41.0 35.0 41.0 65-69 37.71745 38.8 36.2 40.8 34.6 41.0 70-74 36.7062 37.2 35.0 39.4 33.8 41.0 75-79 35.324 35.8 34.4 37.4 32.2 39.2 80-84 34.982099999999996 35.0 35.0 36.4 33.2 37.8 85-89 34.33050000000001 35.0 34.8 35.6 32.6 36.4 90-94 33.915949999999995 35.0 34.0 35.0 32.0 36.0 95-99 33.86045 35.0 34.0 35.0 32.0 35.0 100-104 33.56975 35.0 34.0 35.0 31.2 35.0 105-109 33.401799999999994 35.0 34.0 35.0 30.8 35.0 110-114 33.27755 35.0 34.0 35.0 30.8 35.0 115-119 33.120799999999996 35.0 34.0 35.0 30.2 35.0 120-124 32.586149999999996 35.0 33.2 35.0 29.0 35.0 125-129 32.3391 34.0 33.0 35.0 28.6 35.0 130-134 31.96845 34.0 32.0 35.0 27.0 35.0 135-139 31.720100000000002 34.0 32.0 35.0 26.2 35.0 140-144 31.222500000000004 34.0 31.2 35.0 25.0 35.0 145-149 30.059950000000004 34.0 30.8 35.0 18.0 35.0 150 22.34425 29.0 2.0 33.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 1.0 8 4.0 9 0.0 10 1.0 11 4.0 12 2.0 13 1.0 14 3.0 15 1.0 16 3.0 17 7.0 18 2.0 19 4.0 20 6.0 21 7.0 22 2.0 23 12.0 24 7.0 25 10.0 26 16.0 27 23.0 28 25.0 29 29.0 30 41.0 31 56.0 32 104.0 33 125.0 34 206.0 35 466.0 36 1368.0 37 1448.0 38 13.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.09734069242348 11.239337681886603 5.945810336176619 40.7175112895133 2 22.175 14.825 33.575 29.425 3 19.6 16.525000000000002 26.1 37.775 4 23.849999999999998 25.474999999999998 22.025 28.65 5 24.5 30.45 23.95 21.099999999999998 6 19.6 33.275 25.525 21.6 7 15.525 28.375 38.95 17.150000000000002 8 17.025000000000002 28.075 32.074999999999996 22.825 9 17.25 23.625 35.025 24.099999999999998 10-14 19.335 30.7 27.47 22.495 15-19 19.925 29.115000000000002 27.675 23.285 20-24 20.04 28.994999999999997 27.175 23.79 25-29 19.91 29.360000000000003 27.029999999999998 23.7 30-34 20.16 28.925 27.634999999999998 23.28 35-39 20.155 29.565 27.169999999999998 23.11 40-44 19.759999999999998 29.15 27.54 23.549999999999997 45-49 20.285 28.775000000000002 26.83 24.11 50-54 20.04 29.445 26.815 23.7 55-59 19.925 28.675 27.495000000000005 23.905 60-64 20.25 28.925 27.605 23.22 65-69 19.695 29.099999999999998 27.42 23.785 70-74 20.080000000000002 28.970000000000002 27.500000000000004 23.45 75-79 19.835 28.799999999999997 27.295 24.07 80-84 19.96 28.88 27.96 23.200000000000003 85-89 20.385 28.494999999999997 27.915 23.205000000000002 90-94 19.97 28.754999999999995 27.11 24.165 95-99 20.895 27.915 27.634999999999998 23.555 100-104 20.14 28.605000000000004 27.595 23.66 105-109 20.68 28.655 27.189999999999998 23.474999999999998 110-114 21.044999999999998 28.425 27.400000000000002 23.13 115-119 20.86 29.01 26.685 23.445 120-124 21.845 28.194999999999997 26.16 23.799999999999997 125-129 20.77 28.685 26.605 23.94 130-134 20.44 28.59 26.87 24.099999999999998 135-139 21.11 28.71 26.224999999999998 23.955000000000002 140-144 22.43 28.884999999999998 25.275 23.41 145-149 23.615 29.470000000000002 24.2 22.715 150 16.900000000000002 33.775 24.7 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 5.5 26 4.5 27 5.0 28 9.5 29 14.5 30 20.5 31 26.5 32 37.5 33 57.0 34 67.0 35 69.5 36 87.0 37 111.5 38 141.5 39 168.0 40 184.0 41 200.0 42 222.0 43 246.5 44 249.5 45 258.5 46 267.5 47 257.0 48 237.0 49 203.5 50 180.0 51 150.0 52 114.5 53 88.5 54 77.0 55 66.0 56 45.5 57 35.5 58 25.0 59 15.0 60 12.0 61 7.0 62 3.5 63 5.0 64 6.5 65 5.5 66 4.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.7875 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 6.2125 0.0 0.0 0.0 0.0 118-119 6.8125 0.0 0.0 0.0 0.0 120-121 7.1 0.0 0.0 0.0 0.0 122-123 7.175 0.0 0.0 0.0 0.0 124-125 7.275 0.0 0.0 0.0 0.0 126-127 7.512499999999999 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 7.825 0.0 0.0 0.0 0.0 132-133 8.075 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 11.0625 0.0 0.0 0.0 0.0 138 12.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGTAA 10 0.006973645 144.0 5 >>END_MODULE SRR1799546 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799546_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64025 34.0 33.0 34.0 31.0 34.0 2 32.835 34.0 33.0 34.0 31.0 34.0 3 32.89525 34.0 34.0 34.0 31.0 34.0 4 36.1535 37.0 37.0 37.0 35.0 37.0 5 36.1195 37.0 37.0 37.0 35.0 37.0 6 36.10125 37.0 37.0 37.0 35.0 37.0 7 36.1245 37.0 37.0 37.0 35.0 37.0 8 36.126 37.0 37.0 37.0 35.0 37.0 9 38.07225 39.0 39.0 39.0 37.0 39.0 10-14 38.3614 39.4 39.2 39.4 37.2 39.4 15-19 39.5874 41.0 40.0 41.0 38.0 41.0 20-24 39.52905 41.0 40.0 41.0 38.0 41.0 25-29 39.41855 41.0 40.0 41.0 38.0 41.0 30-34 39.25385 41.0 40.0 41.0 37.6 41.0 35-39 38.93580000000001 40.6 39.4 41.0 36.4 41.0 40-44 38.962450000000004 40.8 39.2 41.0 36.6 41.0 45-49 38.8209 41.0 39.2 41.0 36.0 41.0 50-54 37.8472 39.8 38.0 40.4 34.4 40.6 55-59 38.25325 40.0 38.0 41.0 34.8 41.0 60-64 37.6771 39.6 36.8 41.0 34.0 41.0 65-69 36.771249999999995 38.4 35.4 40.4 33.0 41.0 70-74 36.2074 37.0 35.0 39.2 33.4 41.0 75-79 35.2558 35.8 35.0 37.6 33.0 39.2 80-84 34.381949999999996 35.0 35.0 36.4 32.2 37.4 85-89 33.780899999999995 35.0 34.6 35.4 32.0 36.4 90-94 33.36575 35.0 34.0 35.0 31.4 36.0 95-99 33.059450000000005 35.0 34.0 35.0 30.4 35.2 100-104 32.94325 35.0 34.0 35.0 30.0 35.0 105-109 32.86450000000001 35.0 34.0 35.0 30.0 35.0 110-114 32.7127 35.0 34.0 35.0 29.8 35.0 115-119 32.3121 35.0 33.2 35.0 28.4 35.0 120-124 32.2218 35.0 33.0 35.0 28.2 35.0 125-129 31.934700000000003 35.0 32.8 35.0 27.0 35.0 130-134 31.45735 34.2 32.0 35.0 24.6 35.0 135-139 30.683349999999997 34.0 31.2 35.0 21.2 35.0 140-144 30.543650000000003 34.0 31.0 35.0 21.2 35.0 145-149 29.734750000000002 34.0 30.6 35.0 11.2 35.0 150 25.46625 30.0 23.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 48.0 3 1.0 4 4.0 5 1.0 6 3.0 7 2.0 8 6.0 9 3.0 10 2.0 11 6.0 12 3.0 13 4.0 14 2.0 15 3.0 16 5.0 17 2.0 18 6.0 19 4.0 20 4.0 21 4.0 22 6.0 23 12.0 24 13.0 25 15.0 26 8.0 27 21.0 28 24.0 29 30.0 30 46.0 31 55.0 32 100.0 33 144.0 34 255.0 35 443.0 36 1255.0 37 1444.0 38 16.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 20.424999999999997 11.425 29.725 2 26.8 25.45 31.900000000000002 15.85 3 20.424999999999997 26.400000000000002 32.275 20.9 4 22.7 33.475 25.174999999999997 18.65 5 24.25 34.9 23.425 17.424999999999997 6 20.349999999999998 36.825 23.849999999999998 18.975 7 20.5 21.775 38.324999999999996 19.400000000000002 8 21.65 25.525 29.349999999999998 23.474999999999998 9 23.275000000000002 24.775 30.4 21.55 10-14 24.165 28.494999999999997 26.6 20.74 15-19 23.635 27.765 28.000000000000004 20.599999999999998 20-24 23.39 28.299999999999997 27.750000000000004 20.560000000000002 25-29 23.355 28.044999999999998 27.99 20.61 30-34 23.29 27.505000000000003 28.4 20.805 35-39 23.380000000000003 27.894999999999996 28.055000000000003 20.669999999999998 40-44 24.099999999999998 27.67 27.54 20.69 45-49 23.23 27.465 28.854999999999997 20.45 50-54 23.189999999999998 27.675 28.235 20.9 55-59 23.080000000000002 27.72 28.29 20.91 60-64 23.69 27.935 28.22 20.155 65-69 23.135 28.005000000000003 28.46 20.4 70-74 23.549999999999997 27.655 28.015 20.78 75-79 23.665 27.839999999999996 28.08 20.415 80-84 23.66 27.88 27.715 20.745 85-89 23.89 27.065 28.375 20.669999999999998 90-94 23.945 27.284999999999997 28.595 20.175 95-99 23.43 27.584999999999997 28.575 20.41 100-104 23.895 27.755000000000003 28.275 20.075000000000003 105-109 24.175 27.450000000000003 28.189999999999998 20.185 110-114 24.265 27.765 27.615000000000002 20.355 115-119 25.06 28.115000000000002 27.089999999999996 19.735 120-124 24.865000000000002 28.155 27.389999999999997 19.59 125-129 25.41 27.155 27.775 19.66 130-134 25.005 27.915 27.525 19.555 135-139 25.919999999999998 28.860000000000003 26.69 18.529999999999998 140-144 25.91 29.575000000000003 25.755 18.759999999999998 145-149 26.924999999999997 28.165000000000003 26.05 18.86 150 28.449999999999996 26.700000000000003 25.525 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 4.5 25 3.5 26 0.5 27 5.0 28 9.5 29 7.5 30 9.5 31 20.5 32 29.5 33 36.5 34 48.5 35 70.5 36 95.0 37 103.5 38 126.5 39 154.0 40 194.5 41 228.0 42 233.5 43 264.0 44 288.0 45 272.5 46 272.0 47 263.0 48 241.5 49 214.0 50 169.5 51 144.5 52 110.5 53 84.5 54 74.5 55 55.5 56 39.5 57 32.0 58 25.0 59 16.0 60 10.5 61 8.0 62 4.5 63 4.5 64 4.0 65 4.0 66 3.5 67 1.5 68 0.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.8375000000000004 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.9125 0.0 0.0 0.0 0.0 120-121 7.199999999999999 0.0 0.0 0.0 0.0 122-123 7.275 0.0 0.0 0.0 0.0 124-125 7.3625 0.0 0.0 0.0 0.0 126-127 7.5875 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 7.875 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 9.4375 0.0 0.0 0.0 0.0 136-137 11.125 0.0 0.0 0.0 0.0 138 12.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTTCT 10 0.006973645 144.0 9 TCGTTTC 10 0.006973645 144.0 8 GCATTGT 10 0.006973645 144.0 4 CTTCCGA 10 0.006973645 144.0 6 AGATCGG 75 0.0013041105 13.439999 140-144 >>END_MODULE Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874604 spots for SRR1799546.sra Written 874604 spots for SRR1799546.sra Read 874609 spots for SRR1799546.sra Written 874609 spots for SRR1799546.sra SRR ids: ['SRR1799546.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h0jvbjkx SRR1799546.sra spots: 17492085 blocks: [[1, 874604], [874605, 1749208], [1749209, 2623812], [2623813, 3498416], [3498417, 4373020], [4373021, 5247624], [5247625, 6122228], [6122229, 6996832], [6996833, 7871436], [7871437, 8746040], [8746041, 9620644], [9620645, 10495248], [10495249, 11369852], [11369853, 12244456], [12244457, 13119060], [13119061, 13993664], [13993665, 14868268], [14868269, 15742872], [15742873, 16617476], [16617477, 17492085]] SRR1799546 file size 5871629 SRR1799546 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799546 SRR1799546_1.fastq SRR1799546_2.fastq Input file: SRR1799546_1.fastq Paired file: SRR1799546_2.fastq trimmed: SRR1799546-trimmed-pair1.fastq, SRR1799546-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:31:12 2025 >> started Thu Feb 13 22:31:33 2025 >> done (20.407s) 17492085 read pairs processed; of these: 43813 ( 0.25%) short read pairs filtered out after trimming by size control 131474 ( 0.75%) empty read pairs filtered out after trimming by size control 17316798 (99.00%) read pairs available; of these: 7572975 (43.73%) trimmed read pairs available after processing 9743823 (56.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 11 0.00% 24 15 0.00% 25 24 0.00% 26 20 0.00% 27 36 0.00% 28 46 0.00% 29 33 0.00% 30 65 0.00% 31 56 0.00% 32 98 0.00% 33 84 0.00% 34 94 0.00% 35 126 0.00% 36 148 0.00% 37 163 0.00% 38 198 0.00% 39 206 0.00% 40 233 0.00% 41 261 0.00% 42 294 0.00% 43 316 0.00% 44 333 0.00% 45 367 0.00% 46 433 0.00% 47 443 0.00% 48 479 0.00% 49 523 0.00% 50 644 0.00% 51 674 0.00% 52 743 0.00% 53 817 0.00% 54 839 0.00% 55 866 0.01% 56 1015 0.01% 57 1129 0.01% 58 1191 0.01% 59 1334 0.01% 60 1450 0.01% 61 1693 0.01% 62 1836 0.01% 63 2141 0.01% 64 2326 0.01% 65 2600 0.02% 66 2809 0.02% 67 3139 0.02% 68 3572 0.02% 69 3906 0.02% 70 4539 0.03% 71 4951 0.03% 72 5685 0.03% 73 6450 0.04% 74 7094 0.04% 75 7272 0.04% 76 7037 0.04% 77 6387 0.04% 78 5471 0.03% 79 4542 0.03% 80 3828 0.02% 81 3716 0.02% 82 3708 0.02% 83 4113 0.02% 84 6928 0.04% 85 7501 0.04% 86 8406 0.05% 87 9651 0.06% 88 9783 0.06% 89 9801 0.06% 90 11676 0.07% 91 12452 0.07% 92 11450 0.07% 93 11814 0.07% 94 12139 0.07% 95 13278 0.08% 96 13124 0.08% 97 12340 0.07% 98 12726 0.07% 99 13460 0.08% 100 13771 0.08% 101 15500 0.09% 102 24630 0.14% 103 14991 0.09% 104 15297 0.09% 105 45649 0.26% 106 30968 0.18% 107 29269 0.17% 108 79693 0.46% 109 61128 0.35% 110 44332 0.26% 111 50208 0.29% 112 84312 0.49% 113 78770 0.45% 114 101396 0.59% 115 163914 0.95% 116 57568 0.33% 117 97481 0.56% 118 37017 0.21% 119 20653 0.12% 120 29420 0.17% 121 35583 0.21% 122 19621 0.11% 123 20460 0.12% 124 26934 0.16% 125 19083 0.11% 126 36190 0.21% 127 21853 0.13% 128 18321 0.11% 129 29426 0.17% 130 28927 0.17% 131 29428 0.17% 132 58603 0.34% 133 165004 0.95% 134 137344 0.79% 135 137556 0.79% 136 176832 1.02% 137 185774 1.07% 138 185409 1.07% 139 196181 1.13% 140 199167 1.15% 141 208536 1.20% 142 218571 1.26% 143 229267 1.32% 144 243962 1.41% 145 266182 1.54% 146 310195 1.79% 147 393035 2.27% 148 579577 3.35% 149 2008815 11.60% 150 9743823 56.27% 17316798 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.38 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=3.8 sequence=TGTCATTGAAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=64.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.1 sequence=AAAAAAAAGAACTTAAAATGAATAGGGTATCTTAATGTATGAGATTAGACCATTGAGGATAGCTAACGATTATAGACCACCAGCAAGACAAACCGAATTATTCATAAGTACCAGTAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACGACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=13.03 fanout-score-rank=8 prefix-density=0.42 prefix-fanout=7.5 sequence=AGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTCGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTACTGGTACTTATGAATAATTCGGTTTGTCTTGCTGGTGGTCTATAATCGTTAGCTATCCTCAATGGTCTAATCTCATACATTAAGATACCCTATTCATTTTAAGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=61.17 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=9.7 sequence=ATGGTGATGCTGG SRR1799546 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:32:21 Started mapping on | Feb 13 22:32:21 Finished on | Feb 13 22:35:18 Mapping speed, Million of reads per hour | 352.21 Number of input reads | 17316798 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16062386 Uniquely mapped reads % | 92.76% Average mapped length | 286.15 Number of splices: Total | 12960555 Number of splices: Annotated (sjdb) | 12647902 Number of splices: GT/AG | 12719346 Number of splices: GC/AG | 151272 Number of splices: AT/AC | 10743 Number of splices: Non-canonical | 79194 Mismatch rate per base, % | 1.14% Deletion rate per base | 0.10% Deletion average length | 2.96 Insertion rate per base | 0.07% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 589225 % of reads mapped to multiple loci | 3.40% Number of reads mapped to too many loci | 33208 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 686377 686377 686377 N_multimapping 589225 589225 589225 N_noFeature 475477 15806096 594657 N_ambiguous 225467 1054 87821 UnstrandedReadsAssigned:15361442 PositiveStrandReadsAssigned:255236 NegativeStrandReadsAssigned:15379908 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR1799546 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799546-trimmed-pair1.fastq SRR1799546-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,316,798 reads, 14,915,389 reads pseudoaligned [quant] estimated average fragment length: 191.781 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR1799546.ke.tsv 34699 SRR1799546.se.tsv 87100 total ==> SRR1799546.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.22 389 15.7262 Potri.005G024800.1.v4.1 1035 844.219 189 16.5376 Potri.004G059700.1.v4.1 961 770.219 15 1.43861 Potri.007G009000.2.v4.1 1416 1225.22 0 0 Potri.003G141000.2.v4.1 2943 2752.22 220.058 5.90635 Potri.016G087400.1.v4.1 270 98.5154 1634 1225.22 Potri.015G069301.1.v4.1 564 374.02 0 0 Potri.010G195200.1.v4.1 1773 1582.22 29 1.35393 Potri.012G127500.1.v4.1 977 786.219 3928 369.057 ==> SRR1799546.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1239 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 439 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR1799546 completed mapping pipeline successfully