Starting /dee2/code/volunteer_pipeline.sh SRR1799547 current disk space = 3088505282560 free memory = 1420422168 SRR1799547 SRAfilesize 4b641891a3f96ba4ceb5e21941e5a876 SRR1799547.sra SRR1799547.sra file validated SRR1799547 is paired end SRR1799547 is conventional basespace SRR1799547 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799547_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.31975 34.0 33.0 34.0 31.0 34.0 2 33.5175 34.0 34.0 34.0 33.0 34.0 3 33.6515 34.0 34.0 34.0 33.0 34.0 4 36.82725 37.0 37.0 37.0 37.0 37.0 5 36.80875 37.0 37.0 37.0 37.0 37.0 6 36.819 37.0 37.0 37.0 37.0 37.0 7 36.823 37.0 37.0 37.0 37.0 37.0 8 36.8235 37.0 37.0 37.0 37.0 37.0 9 38.76025 39.0 39.0 39.0 39.0 39.0 10-14 39.10235 39.4 39.4 39.4 39.0 39.4 15-19 40.518800000000006 41.0 41.0 41.0 39.8 41.0 20-24 40.5042 41.0 41.0 41.0 39.4 41.0 25-29 40.417249999999996 41.0 40.8 41.0 39.2 41.0 30-34 40.27589999999999 41.0 40.0 41.0 39.0 41.0 35-39 40.11 41.0 40.0 41.0 38.2 41.0 40-44 40.10315 41.0 40.0 41.0 38.4 41.0 45-49 40.23565000000001 41.0 40.2 41.0 39.0 41.0 50-54 40.05955 41.0 40.0 41.0 38.0 41.0 55-59 39.8135 41.0 39.6 41.0 36.8 41.0 60-64 39.2946 40.8 38.8 41.0 35.4 41.0 65-69 38.500600000000006 39.4 36.8 41.0 35.0 41.0 70-74 37.45935000000001 37.8 35.6 39.6 35.0 41.0 75-79 36.0167 36.0 34.8 37.4 34.0 39.4 80-84 35.5296 35.4 35.0 36.6 35.0 37.8 85-89 34.9704 35.0 35.0 35.8 34.0 36.6 90-94 34.6532 35.0 35.0 35.0 34.0 36.0 95-99 34.482549999999996 35.0 35.0 35.0 34.0 35.8 100-104 34.415200000000006 35.0 35.0 35.0 34.0 35.0 105-109 34.3712 35.0 35.0 35.0 34.0 35.0 110-114 34.2813 35.0 35.0 35.0 34.0 35.0 115-119 34.180699999999995 35.0 35.0 35.0 33.2 35.0 120-124 34.05495 35.0 34.6 35.0 32.8 35.0 125-129 33.95805 35.0 34.0 35.0 33.0 35.0 130-134 33.823750000000004 35.0 34.0 35.0 32.6 35.0 135-139 33.7014 35.0 34.0 35.0 32.2 35.0 140-144 33.370999999999995 35.0 34.0 35.0 31.4 35.0 145-149 32.9036 35.0 33.8 35.0 30.8 35.0 150 26.73525 32.0 24.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 2.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 3.0 16 1.0 17 0.0 18 1.0 19 6.0 20 4.0 21 0.0 22 3.0 23 3.0 24 4.0 25 7.0 26 4.0 27 6.0 28 14.0 29 3.0 30 18.0 31 18.0 32 24.0 33 45.0 34 62.0 35 197.0 36 1098.0 37 2431.0 38 40.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.81909547738693 10.854271356783919 7.135678391959798 43.19095477386934 2 22.325 13.8 34.699999999999996 29.175 3 19.2 17.325 24.825 38.65 4 23.175 24.224999999999998 23.375 29.225 5 24.425 29.575000000000003 24.425 21.575 6 18.7 34.150000000000006 25.95 21.2 7 15.075 28.799999999999997 39.15 16.975 8 17.7 26.525 31.825 23.95 9 17.275 23.849999999999998 36.175000000000004 22.7 10-14 19.725 30.620000000000005 27.515 22.14 15-19 19.439999999999998 29.69 26.939999999999998 23.93 20-24 19.975 29.26 27.27 23.494999999999997 25-29 19.66 29.925 27.1 23.315 30-34 19.485 30.035 26.724999999999998 23.755000000000003 35-39 19.99 29.29 27.155 23.565 40-44 19.72 29.609999999999996 26.68 23.990000000000002 45-49 20.05 29.4 26.765 23.785 50-54 20.1 29.485 26.900000000000002 23.515 55-59 20.330000000000002 29.110000000000003 26.72 23.84 60-64 19.695 29.459999999999997 26.915 23.93 65-69 19.23 29.615000000000002 27.255000000000003 23.9 70-74 19.49 29.095 27.72 23.695 75-79 19.781978197819782 29.112911291129112 27.182718271827184 23.92239223922392 80-84 20.11 29.244999999999997 27.055 23.59 85-89 20.11 28.93 26.995 23.965 90-94 20.122073243946367 28.807284370622373 27.231338803281968 23.83930358214929 95-99 20.095071303477607 29.226920190142607 27.47560670502877 23.202401801351012 100-104 21.08343337334934 29.26670668267307 26.525610244097642 23.12424969987995 105-109 20.231069320796237 29.073722116634993 26.44793438031409 24.247274182254678 110-114 21.15827410151166 29.08699569526479 26.298928821703875 23.455801381519674 115-119 21.59795877526516 29.252551530918552 25.85051030618371 23.298979387632578 120-124 21.224999999999998 29.325000000000003 25.22 24.23 125-129 21.11 29.07 25.330000000000002 24.490000000000002 130-134 20.858128719307896 29.19937990698605 25.20878131719758 24.733710056508475 135-139 20.52436705693986 29.720804563194235 24.352046432502753 25.402781947363156 140-144 20.61309196379457 29.269390408561286 24.923738560784116 25.193779066860028 145-149 20.485 29.255 24.495 25.765 150 16.708354177088545 30.21510755377689 25.6128064032016 27.463731865932967 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 4.0 28 6.5 29 12.0 30 22.5 31 29.0 32 40.0 33 52.0 34 62.5 35 85.5 36 92.0 37 99.5 38 130.0 39 167.5 40 197.5 41 218.5 42 243.5 43 258.0 44 259.5 45 266.0 46 273.0 47 254.0 48 221.5 49 205.5 50 180.5 51 141.5 52 106.5 53 89.5 54 73.5 55 51.5 56 43.5 57 32.5 58 20.0 59 17.0 60 12.0 61 7.5 62 7.0 63 4.0 64 3.5 65 3.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.06 95-99 0.075 100-104 0.04 105-109 0.03 110-114 0.11 115-119 0.06 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.06999999999999999 140-144 0.015 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1625 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.3375 0.0125 0.0 0.0 0.0 78-79 0.375 0.025 0.0 0.0 0.0 80-81 0.4 0.025 0.0 0.0 0.0 82-83 0.475 0.025 0.0 0.0 0.0 84-85 0.475 0.025 0.0 0.0 0.0 86-87 0.475 0.025 0.0 0.0 0.0 88-89 0.5375 0.025 0.0 0.0 0.0 90-91 0.85 0.025 0.0 0.0 0.0 92-93 1.1375000000000002 0.025 0.0 0.0 0.0 94-95 1.5750000000000002 0.025 0.0 0.0 0.0 96-97 2.35 0.025 0.0 0.0 0.0 98-99 2.9375 0.025 0.0 0.0 0.0 100-101 3.6625 0.025 0.0 0.0 0.0 102-103 4.2 0.025 0.0 0.0 0.0 104-105 4.875 0.025 0.0 0.0 0.0 106-107 5.9625 0.025 0.0 0.0 0.0 108-109 7.1125 0.025 0.0 0.0 0.0 110-111 8.225 0.025 0.0 0.0 0.0 112-113 9.625 0.025 0.0 0.0 0.0 114-115 10.8625 0.025 0.0 0.0 0.0 116-117 12.2 0.025 0.0 0.0 0.0 118-119 13.3125 0.025 0.0 0.0 0.0 120-121 14.25 0.025 0.0 0.0 0.0 122-123 15.7 0.025 0.0 0.0 0.0 124-125 17.25 0.025 0.0 0.0 0.0 126-127 18.5375 0.025 0.0 0.0 0.0 128-129 20.1375 0.025 0.0 0.0 0.0 130-131 21.7125 0.025 0.0 0.0 0.0 132-133 23.0125 0.025 0.0 0.0 0.0 134-135 24.6 0.025 0.0 0.0 0.0 136-137 26.1125 0.025 0.0 0.0 0.0 138 27.425 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGTT 10 0.0069754543 143.9875 4 CACTTTT 10 0.0069754543 143.9875 4 TGTATAA 10 0.0069754543 143.9875 5 >>END_MODULE SRR1799547 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799547_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3895 34.0 34.0 34.0 31.0 34.0 2 33.4375 34.0 34.0 34.0 33.0 34.0 3 33.46975 34.0 34.0 34.0 33.0 34.0 4 36.604 37.0 37.0 37.0 37.0 37.0 5 36.613 37.0 37.0 37.0 37.0 37.0 6 36.62325 37.0 37.0 37.0 37.0 37.0 7 36.597 37.0 37.0 37.0 37.0 37.0 8 36.616 37.0 37.0 37.0 37.0 37.0 9 38.50175 39.0 39.0 39.0 39.0 39.0 10-14 38.86024999999999 39.4 39.4 39.4 38.8 39.4 15-19 40.28395 41.0 41.0 41.0 39.6 41.0 20-24 40.22825 41.0 41.0 41.0 39.2 41.0 25-29 40.16105 41.0 40.8 41.0 39.0 41.0 30-34 40.0659 41.0 40.2 41.0 39.0 41.0 35-39 39.995200000000004 41.0 40.0 41.0 38.6 41.0 40-44 39.892700000000005 41.0 40.0 41.0 38.2 41.0 45-49 39.84645 41.0 40.0 41.0 38.2 41.0 50-54 39.033 40.2 39.2 40.6 37.0 41.0 55-59 39.3474 41.0 39.2 41.0 36.4 41.0 60-64 38.75455 40.2 37.8 41.0 35.0 41.0 65-69 38.1493 39.2 36.6 41.0 35.0 41.0 70-74 37.122550000000004 37.4 35.4 39.6 35.0 41.0 75-79 36.044500000000006 36.2 35.0 37.8 35.0 39.6 80-84 35.205 35.2 35.0 36.4 34.2 37.8 85-89 34.64275 35.0 35.0 35.6 34.0 36.6 90-94 34.35625 35.0 35.0 35.0 34.0 36.0 95-99 34.24435 35.0 35.0 35.0 34.0 36.0 100-104 34.178200000000004 35.0 35.0 35.0 34.0 35.0 105-109 34.07515 35.0 35.0 35.0 33.0 35.0 110-114 33.976549999999996 35.0 35.0 35.0 33.0 35.0 115-119 33.8798 35.0 35.0 35.0 33.0 35.0 120-124 33.6808 35.0 34.4 35.0 32.2 35.0 125-129 33.5678 35.0 34.0 35.0 32.0 35.0 130-134 33.3805 35.0 34.0 35.0 31.6 35.0 135-139 33.101600000000005 35.0 34.0 35.0 30.8 35.0 140-144 32.85525 35.0 33.8 35.0 30.2 35.0 145-149 32.343050000000005 35.0 33.0 35.0 29.2 35.0 150 28.71025 32.0 27.0 34.0 18.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 5.0 9 3.0 10 1.0 11 0.0 12 1.0 13 2.0 14 3.0 15 1.0 16 1.0 17 1.0 18 0.0 19 1.0 20 7.0 21 4.0 22 2.0 23 4.0 24 2.0 25 7.0 26 8.0 27 9.0 28 12.0 29 12.0 30 15.0 31 26.0 32 28.0 33 60.0 34 95.0 35 236.0 36 1105.0 37 2255.0 38 72.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.925000000000004 18.95 13.675 31.45 2 26.424999999999997 25.025 32.800000000000004 15.75 3 20.474999999999998 26.05 32.975 20.5 4 24.9 31.8 24.474999999999998 18.825 5 27.075 33.975 23.65 15.299999999999999 6 20.974999999999998 38.9 22.725 17.4 7 21.425 22.900000000000002 38.574999999999996 17.1 8 22.8 24.675 29.45 23.075000000000003 9 23.48087021755439 23.755938984746187 31.43285821455364 21.330332583145786 10-14 24.263639545931888 28.579286893033956 26.684002600390063 20.473070960644097 15-19 24.224999999999998 27.284999999999997 28.1 20.39 20-24 23.765 28.67 27.505000000000003 20.06 25-29 23.78618930946547 28.07640382019101 27.651382569128458 20.48602430121506 30-34 24.087043521760883 27.823911955977987 27.648824412206103 20.440220110055026 35-39 23.655 28.265 28.04 20.04 40-44 23.669999999999998 27.845 28.194999999999997 20.29 45-49 23.350177615450043 27.46785410516836 28.723670385750737 20.45829789363086 50-54 23.93478695739148 27.545509101820365 28.29565913182637 20.224044808961793 55-59 23.710927731932983 27.206801700425103 28.937234308577143 20.145036259064767 60-64 23.648547282092313 27.49412411861779 28.564284642696403 20.29304395659349 65-69 23.86357953693054 27.959193879081862 28.379256888533277 19.797969695454317 70-74 23.8791032826261 27.186749399519616 28.557846277021614 20.37630104083267 75-79 23.572357235723572 27.707770777077705 28.62786278627863 20.092009200920092 80-84 23.94 27.389999999999997 28.775000000000002 19.895 85-89 24.477238619309656 26.388194097048522 29.229614807403703 19.90495247623812 90-94 23.015 27.529999999999998 29.580000000000002 19.875 95-99 24.099999999999998 27.805000000000003 28.305000000000003 19.79 100-104 24.385 27.565 28.365000000000002 19.685 105-109 24.557455745574558 27.22772277227723 28.052805280528055 20.162016201620162 110-114 26.26 27.35 27.095000000000002 19.295 115-119 26.064999999999998 27.98 26.945000000000004 19.009999999999998 120-124 26.582278481012654 27.93815980387252 27.052584179716817 18.42697753539801 125-129 27.75777577757776 27.527752775277527 26.2976297629763 18.416841684168418 130-134 28.017004251062765 28.152038009502377 25.87646911727932 17.95448862215554 135-139 28.366418320916047 28.31641582079104 25.841292064603234 17.475873793689683 140-144 28.83229937962778 27.636581949169504 25.730438262957772 17.800680408244947 145-149 29.64705882352941 27.078848560700873 25.286608260325405 17.987484355444305 150 29.46920380570856 27.366049073610416 25.43815723585378 17.72658988482724 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 3.0 26 4.0 27 6.0 28 8.5 29 8.0 30 10.0 31 21.0 32 30.5 33 35.5 34 58.5 35 72.5 36 79.0 37 105.0 38 138.5 39 166.0 40 193.0 41 227.5 42 263.0 43 276.0 44 282.5 45 284.5 46 248.0 47 234.0 48 237.0 49 214.0 50 177.0 51 135.5 52 113.0 53 92.5 54 67.5 55 52.5 56 40.0 57 29.0 58 23.0 59 19.5 60 12.0 61 8.0 62 9.5 63 5.5 64 1.0 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.05 35-39 0.0 40-44 0.0 45-49 0.065 50-54 0.02 55-59 0.025 60-64 0.015 65-69 0.015 70-74 0.08 75-79 0.01 80-84 0.0 85-89 0.05 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.065 125-129 0.01 130-134 0.025 135-139 0.005 140-144 0.06 145-149 0.125 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1625 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 2.4 0.0 0.0 0.0 0.0 98-99 3.0125 0.0 0.0 0.0 0.0 100-101 3.7625 0.0 0.0 0.0 0.0 102-103 4.325 0.0 0.0 0.0 0.0 104-105 5.0 0.0 0.0 0.0 0.0 106-107 6.075 0.0 0.0 0.0 0.0 108-109 7.2625 0.0 0.0 0.0 0.0 110-111 8.3875 0.0 0.0 0.0 0.0 112-113 9.7875 0.0 0.0 0.0 0.0 114-115 11.0125 0.0 0.0 0.0 0.0 116-117 12.3625 0.0 0.0 0.0 0.0 118-119 13.4625 0.0 0.0 0.0 0.0 120-121 14.45 0.0 0.0 0.0 0.0 122-123 15.8625 0.0 0.0 0.0 0.0 124-125 17.45 0.0 0.0 0.0 0.0 126-127 18.75 0.0 0.0 0.0 0.0 128-129 20.3625 0.0 0.0 0.0 0.0 130-131 21.9375 0.0 0.0 0.0 0.0 132-133 23.2375 0.0 0.0 0.0 0.0 134-135 24.875 0.0 0.0 0.0 0.0 136-137 26.4 0.0 0.0 0.0 0.0 138 27.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039522 spots for SRR1799547.sra Written 1039522 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra Read 1039508 spots for SRR1799547.sra Written 1039508 spots for SRR1799547.sra SRR ids: ['SRR1799547.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cg7zqvjj SRR1799547.sra spots: 20790174 blocks: [[1, 1039508], [1039509, 2079016], [2079017, 3118524], [3118525, 4158032], [4158033, 5197540], [5197541, 6237048], [6237049, 7276556], [7276557, 8316064], [8316065, 9355572], [9355573, 10395080], [10395081, 11434588], [11434589, 12474096], [12474097, 13513604], [13513605, 14553112], [14553113, 15592620], [15592621, 16632128], [16632129, 17671636], [17671637, 18711144], [18711145, 19750652], [19750653, 20790174]] SRR1799547 file size 6982801 SRR1799547 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799547 SRR1799547_1.fastq SRR1799547_2.fastq Input file: SRR1799547_1.fastq Paired file: SRR1799547_2.fastq trimmed: SRR1799547-trimmed-pair1.fastq, SRR1799547-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:00:37 2025 >> started Thu Feb 13 22:00:59 2025 >> done (22.181s) 20790174 read pairs processed; of these: 45334 ( 0.22%) short read pairs filtered out after trimming by size control 121932 ( 0.59%) empty read pairs filtered out after trimming by size control 20622908 (99.20%) read pairs available; of these: 9627905 (46.69%) trimmed read pairs available after processing 10995003 (53.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 8 0.00% 21 12 0.00% 22 11 0.00% 23 21 0.00% 24 16 0.00% 25 37 0.00% 26 31 0.00% 27 39 0.00% 28 45 0.00% 29 67 0.00% 30 90 0.00% 31 88 0.00% 32 131 0.00% 33 132 0.00% 34 151 0.00% 35 188 0.00% 36 221 0.00% 37 233 0.00% 38 238 0.00% 39 310 0.00% 40 343 0.00% 41 352 0.00% 42 439 0.00% 43 413 0.00% 44 482 0.00% 45 549 0.00% 46 575 0.00% 47 680 0.00% 48 685 0.00% 49 765 0.00% 50 826 0.00% 51 894 0.00% 52 975 0.00% 53 1016 0.00% 54 1059 0.01% 55 1168 0.01% 56 1324 0.01% 57 1417 0.01% 58 1623 0.01% 59 1873 0.01% 60 1928 0.01% 61 2099 0.01% 62 2476 0.01% 63 2724 0.01% 64 3083 0.01% 65 3439 0.02% 66 3687 0.02% 67 5022 0.02% 68 5366 0.03% 69 5031 0.02% 70 5794 0.03% 71 6529 0.03% 72 7420 0.04% 73 8531 0.04% 74 9555 0.05% 75 10611 0.05% 76 11524 0.06% 77 11851 0.06% 78 12314 0.06% 79 12338 0.06% 80 11327 0.05% 81 10283 0.05% 82 9707 0.05% 83 8204 0.04% 84 10838 0.05% 85 11237 0.05% 86 12341 0.06% 87 16024 0.08% 88 22801 0.11% 89 27533 0.13% 90 33599 0.16% 91 25813 0.13% 92 27096 0.13% 93 41740 0.20% 94 50716 0.25% 95 50735 0.25% 96 51243 0.25% 97 47732 0.23% 98 50780 0.25% 99 54989 0.27% 100 52992 0.26% 101 40292 0.20% 102 43600 0.21% 103 75721 0.37% 104 111601 0.54% 105 110032 0.53% 106 110314 0.53% 107 110899 0.54% 108 96308 0.47% 109 119557 0.58% 110 122148 0.59% 111 124057 0.60% 112 106819 0.52% 113 120579 0.58% 114 107652 0.52% 115 155565 0.75% 116 128522 0.62% 117 115237 0.56% 118 107526 0.52% 119 74730 0.36% 120 100779 0.49% 121 154191 0.75% 122 151126 0.73% 123 148896 0.72% 124 135595 0.66% 125 139739 0.68% 126 142449 0.69% 127 161314 0.78% 128 162266 0.79% 129 140295 0.68% 130 154966 0.75% 131 169177 0.82% 132 168396 0.82% 133 175224 0.85% 134 174487 0.85% 135 179882 0.87% 136 181772 0.88% 137 182715 0.89% 138 187690 0.91% 139 190717 0.92% 140 192553 0.93% 141 196437 0.95% 142 199755 0.97% 143 204319 0.99% 144 214557 1.04% 145 231713 1.12% 146 265441 1.29% 147 305716 1.48% 148 419401 2.03% 149 1436596 6.97% 150 10995003 53.31% 20622908 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=31 prefix-density=0.15 prefix-fanout=2.9 sequence=GATAAATCACTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=6 fanout-score=84.06 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=13.9 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.58 fanout-score-rank=19 prefix-density=0.26 prefix-fanout=4.0 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=38.83 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.0 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCACTTATTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAACTGGAGAAATCAGGGAAGCATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAAAGGGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT SRR1799547 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:01:45 Started mapping on | Feb 13 22:01:46 Finished on | Feb 13 22:04:54 Mapping speed, Million of reads per hour | 394.91 Number of input reads | 20622908 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 19099487 Uniquely mapped reads % | 92.61% Average mapped length | 278.13 Number of splices: Total | 15495489 Number of splices: Annotated (sjdb) | 15127161 Number of splices: GT/AG | 15208279 Number of splices: GC/AG | 187839 Number of splices: AT/AC | 12993 Number of splices: Non-canonical | 86378 Mismatch rate per base, % | 1.14% Deletion rate per base | 0.10% Deletion average length | 2.94 Insertion rate per base | 0.07% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 681470 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 35137 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 862784 862784 862784 N_multimapping 681470 681470 681470 N_noFeature 539903 18805943 692152 N_ambiguous 234169 1097 92322 UnstrandedReadsAssigned:18325415 PositiveStrandReadsAssigned:292447 NegativeStrandReadsAssigned:18315013 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=130 echo kmer=125 SRR1799547 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799547-trimmed-pair1.fastq SRR1799547-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,622,908 reads, 17,842,466 reads pseudoaligned [quant] estimated average fragment length: 170.901 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR1799547.ke.tsv 34699 SRR1799547.se.tsv 87100 total ==> SRR1799547.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1848.1 339 11.7596 Potri.005G024800.1.v4.1 1035 865.099 212 15.7105 Potri.004G059700.1.v4.1 961 791.104 27 2.18802 Potri.007G009000.2.v4.1 1416 1246.1 0 0 Potri.003G141000.2.v4.1 2943 2773.1 241.04 5.57242 Potri.016G087400.1.v4.1 270 111.826 1708 979.187 Potri.015G069301.1.v4.1 564 394.361 0 0 Potri.010G195200.1.v4.1 1773 1603.1 23 0.919787 Potri.012G127500.1.v4.1 977 807.099 4381 347.99 ==> SRR1799547.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1034 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 326 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1799547 completed mapping pipeline successfully