Starting /dee2/code/volunteer_pipeline.sh SRR1799548 current disk space = 3088645574656 free memory = 1496595352 SRR1799548 SRAfilesize 7efaf4880ca3337e62d85996fd765ee0 SRR1799548.sra SRR1799548.sra file validated SRR1799548 is paired end SRR1799548 is conventional basespace SRR1799548 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799548_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24425 34.0 34.0 34.0 31.0 34.0 2 33.34675 34.0 34.0 34.0 31.0 34.0 3 33.44325 34.0 34.0 34.0 31.0 34.0 4 36.6745 37.0 37.0 37.0 35.0 37.0 5 36.623 37.0 37.0 37.0 35.0 37.0 6 36.424 37.0 37.0 37.0 35.0 37.0 7 36.5385 37.0 37.0 37.0 35.0 37.0 8 36.58125 37.0 37.0 37.0 35.0 37.0 9 38.5 39.0 39.0 39.0 37.0 39.0 10-14 38.84675 39.4 39.2 39.4 37.2 39.4 15-19 40.07925 41.0 40.0 41.0 38.0 41.0 20-24 39.84085 41.0 40.0 41.0 37.8 41.0 25-29 39.86395 41.0 40.0 41.0 38.0 41.0 30-34 39.76819999999999 41.0 40.0 41.0 37.6 41.0 35-39 39.78185 41.0 40.0 41.0 38.0 41.0 40-44 39.65689999999999 41.0 40.0 41.0 37.2 41.0 45-49 39.499449999999996 41.0 39.6 41.0 37.0 41.0 50-54 39.3297 41.0 39.0 41.0 36.0 41.0 55-59 39.145849999999996 40.6 38.8 41.0 35.6 41.0 60-64 38.614349999999995 40.0 37.6 41.0 35.0 41.0 65-69 37.87225000000001 39.0 36.4 40.8 34.4 41.0 70-74 36.73855 37.2 35.0 39.4 33.6 41.0 75-79 35.3695 35.6 34.4 37.4 32.2 39.2 80-84 34.9272 35.0 35.0 36.6 32.8 37.8 85-89 34.25305 35.0 34.4 35.6 32.0 36.4 90-94 33.99979999999999 35.0 34.0 35.0 32.0 36.0 95-99 33.77745 35.0 34.0 35.0 32.0 35.2 100-104 33.37675 35.0 34.0 35.0 30.4 35.0 105-109 33.28935 35.0 34.0 35.0 30.4 35.0 110-114 33.14155 35.0 33.8 35.0 30.0 35.0 115-119 32.769149999999996 35.0 33.0 35.0 29.2 35.0 120-124 32.40515 35.0 33.0 35.0 28.6 35.0 125-129 32.1026 34.0 32.2 35.0 27.0 35.0 130-134 31.492200000000004 34.0 31.6 35.0 24.8 35.0 135-139 30.92215 34.0 31.0 35.0 24.0 35.0 140-144 29.883249999999997 34.0 30.4 35.0 16.6 35.0 145-149 27.476799999999997 33.2 27.4 34.6 2.0 35.0 150 19.676 24.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 1.0 13 4.0 14 4.0 15 7.0 16 1.0 17 1.0 18 4.0 19 3.0 20 5.0 21 5.0 22 4.0 23 9.0 24 11.0 25 16.0 26 17.0 27 27.0 28 36.0 29 37.0 30 51.0 31 79.0 32 122.0 33 163.0 34 297.0 35 530.0 36 1290.0 37 1261.0 38 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.81644934804413 11.183550651955867 7.4473420260782355 42.55265797392177 2 22.125 14.224999999999998 34.375 29.275000000000002 3 19.45 16.6 24.75 39.2 4 22.875 26.150000000000002 22.35 28.625 5 22.8 30.95 24.275 21.975 6 19.42699170645891 35.56169891932646 24.151796933902993 20.859512440311637 7 14.475 27.700000000000003 39.900000000000006 17.925 8 15.5 26.325 33.800000000000004 24.375 9 17.474999999999998 25.05 33.95 23.525 10-14 18.775 31.430000000000003 27.145000000000003 22.650000000000002 15-19 19.035 29.82 27.565 23.580000000000002 20-24 19.255 29.715000000000003 27.825 23.205000000000002 25-29 19.215 29.904999999999998 27.029999999999998 23.849999999999998 30-34 19.72 29.285 27.07 23.925 35-39 19.400000000000002 29.435 27.54 23.625 40-44 19.439999999999998 29.315 27.529999999999998 23.715 45-49 19.470000000000002 29.37 27.455000000000002 23.705000000000002 50-54 19.84 28.985 27.639999999999997 23.535 55-59 19.650000000000002 29.21 27.525 23.615 60-64 19.695 29.4 27.29 23.615 65-69 19.564999999999998 29.215000000000003 27.54 23.68 70-74 19.43 29.265 27.725 23.580000000000002 75-79 20.265 28.77 27.529999999999998 23.435 80-84 20.419999999999998 28.725 27.36 23.494999999999997 85-89 20.03 29.020000000000003 27.62 23.330000000000002 90-94 20.755000000000003 28.935 26.965 23.345 95-99 20.84 28.865000000000002 27.060000000000002 23.235 100-104 19.775000000000002 29.294999999999998 27.310000000000002 23.62 105-109 20.25 29.104999999999997 27.474999999999998 23.169999999999998 110-114 21.115000000000002 28.854999999999997 26.375 23.655 115-119 20.580000000000002 29.060000000000002 26.505000000000003 23.855 120-124 20.669999999999998 29.18 25.900000000000002 24.25 125-129 21.355 28.655 26.290000000000003 23.7 130-134 21.035 29.175 26.025 23.765 135-139 20.9 29.265 25.585 24.25 140-144 21.385 29.099999999999998 25.44 24.075 145-149 21.55 29.9 24.529999999999998 24.02 150 8.125 38.875 24.975 28.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 3.0 24 4.0 25 2.5 26 3.5 27 5.5 28 7.0 29 12.0 30 20.5 31 31.0 32 51.0 33 59.5 34 72.5 35 85.0 36 96.5 37 127.0 38 148.5 39 168.5 40 197.5 41 206.0 42 220.0 43 253.5 44 253.0 45 260.5 46 260.5 47 243.5 48 235.5 49 204.0 50 162.0 51 132.5 52 108.0 53 83.5 54 68.5 55 53.0 56 42.5 57 32.0 58 23.0 59 16.0 60 8.0 61 6.5 62 4.5 63 5.0 64 5.5 65 4.5 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.525 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7124999999999999 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6375 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 3.1500000000000004 0.0 0.0 0.0 0.0 108-109 4.175 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.625 0.0 0.0 0.0 0.0 114-115 6.1 0.0 0.0 0.0 0.0 116-117 7.1 0.0 0.0 0.0 0.0 118-119 7.525 0.0 0.0 0.0 0.0 120-121 7.9375 0.0 0.0 0.0 0.0 122-123 9.0 0.0 0.0 0.0 0.0 124-125 9.875 0.0 0.0 0.0 0.0 126-127 10.274999999999999 0.0 0.0 0.0 0.0 128-129 10.85 0.0 0.0 0.0 0.0 130-131 11.537500000000001 0.0 0.0 0.0 0.0 132-133 12.649999999999999 0.0 0.0 0.0 0.0 134-135 13.9 0.0 0.0 0.0 0.0 136-137 15.35 0.0 0.0 0.0 0.0 138 16.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1799548 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799548_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89275 34.0 33.0 34.0 31.0 34.0 2 32.98825 34.0 33.0 34.0 31.0 34.0 3 33.04825 34.0 34.0 34.0 31.0 34.0 4 36.31025 37.0 37.0 37.0 35.0 37.0 5 36.2745 37.0 37.0 37.0 35.0 37.0 6 36.3615 37.0 37.0 37.0 35.0 37.0 7 36.3405 37.0 37.0 37.0 35.0 37.0 8 36.33825 37.0 37.0 37.0 35.0 37.0 9 38.1905 39.0 39.0 39.0 37.0 39.0 10-14 38.524950000000004 39.4 39.2 39.4 37.2 39.4 15-19 39.73685 41.0 40.0 41.0 38.0 41.0 20-24 39.6445 41.0 40.0 41.0 38.0 41.0 25-29 39.480000000000004 41.0 40.0 41.0 37.8 41.0 30-34 39.248650000000005 40.8 39.6 41.0 37.0 41.0 35-39 38.9474 40.0 38.6 41.0 36.0 41.0 40-44 38.833749999999995 40.0 38.6 41.0 36.0 41.0 45-49 38.995549999999994 40.6 39.0 41.0 36.0 41.0 50-54 38.0187 39.4 38.0 40.2 34.4 40.6 55-59 38.19689999999999 40.0 38.0 41.0 34.4 41.0 60-64 37.6853 39.4 36.8 41.0 34.0 41.0 65-69 36.789049999999996 38.2 35.4 40.2 32.6 41.0 70-74 36.1736 36.8 35.0 39.0 33.0 40.8 75-79 35.19109999999999 35.8 35.0 37.6 32.8 39.2 80-84 34.2968 35.0 34.4 36.2 31.6 37.4 85-89 33.43345000000001 35.0 34.0 35.4 30.0 36.4 90-94 33.1449 35.0 34.0 35.0 30.2 35.8 95-99 32.8649 35.0 34.0 35.0 29.8 35.0 100-104 32.515 35.0 33.0 35.0 29.0 35.0 105-109 32.2411 35.0 33.0 35.0 28.0 35.0 110-114 32.093399999999995 34.6 33.0 35.0 27.0 35.0 115-119 31.730049999999995 34.0 32.2 35.0 25.8 35.0 120-124 31.145549999999997 34.0 31.2 35.0 24.4 35.0 125-129 30.6427 34.0 31.0 35.0 22.6 35.0 130-134 29.941300000000002 34.0 29.8 35.0 19.0 35.0 135-139 29.07555 33.2 29.0 35.0 13.2 35.0 140-144 28.29375 33.0 28.2 34.8 4.0 35.0 145-149 26.32575 32.2 24.2 34.0 2.0 35.0 150 20.06175 25.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 1.0 4 2.0 5 2.0 6 1.0 7 1.0 8 3.0 9 5.0 10 4.0 11 7.0 12 4.0 13 2.0 14 6.0 15 4.0 16 10.0 17 5.0 18 5.0 19 6.0 20 9.0 21 11.0 22 11.0 23 9.0 24 19.0 25 15.0 26 25.0 27 26.0 28 42.0 29 53.0 30 74.0 31 107.0 32 136.0 33 191.0 34 339.0 35 699.0 36 1312.0 37 819.0 38 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.85 18.55 13.675 29.925 2 27.1 24.6 32.425 15.875 3 21.025 27.325 31.8 19.85 4 25.174999999999997 32.550000000000004 23.150000000000002 19.125 5 25.45 34.575 24.2 15.775 6 20.525 39.25 24.075 16.150000000000002 7 20.625 19.825 40.475 19.075 8 22.125 25.75 29.599999999999998 22.525000000000002 9 23.175 25.3 30.349999999999998 21.175 10-14 24.165 28.925 26.505000000000003 20.405 15-19 23.79 27.515 28.58 20.115 20-24 23.880000000000003 28.075 27.915 20.13 25-29 23.59 27.675 28.65 20.085 30-34 23.315 27.694999999999997 28.74 20.25 35-39 23.325000000000003 27.825 28.24 20.61 40-44 23.630000000000003 27.52 28.585 20.265 45-49 23.75 27.33 28.54 20.380000000000003 50-54 23.89 27.0 28.27 20.84 55-59 23.855 27.465 28.375 20.305 60-64 23.965 26.985 28.87 20.18 65-69 23.36 27.52 28.88 20.24 70-74 23.189999999999998 27.500000000000004 29.110000000000003 20.200000000000003 75-79 23.785 27.43 28.904999999999998 19.88 80-84 23.68 27.255000000000003 28.494999999999997 20.57 85-89 23.895 27.365000000000002 28.95 19.79 90-94 23.669999999999998 27.229999999999997 28.565 20.535 95-99 23.7 27.345000000000002 29.020000000000003 19.935 100-104 23.655 27.515 28.765 20.064999999999998 105-109 24.135 27.744999999999997 28.075 20.044999999999998 110-114 24.759999999999998 27.565 28.355000000000004 19.32 115-119 24.755 28.01 27.634999999999998 19.6 120-124 25.86 27.229999999999997 27.200000000000003 19.71 125-129 26.32 27.32 27.575 18.785 130-134 26.11 28.134999999999998 27.334999999999997 18.42 135-139 26.555 27.689999999999998 27.21 18.545 140-144 26.87 29.349999999999998 25.740000000000002 18.04 145-149 28.415000000000003 28.52 25.05 18.015 150 31.6 25.4 24.3 18.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 2.5 23 2.5 24 1.0 25 2.5 26 3.0 27 4.5 28 7.5 29 9.5 30 17.5 31 31.5 32 42.0 33 44.5 34 47.5 35 66.5 36 89.0 37 115.0 38 132.5 39 161.5 40 206.0 41 219.5 42 238.0 43 278.0 44 272.0 45 254.0 46 277.5 47 271.0 48 236.5 49 199.0 50 162.0 51 132.5 52 104.5 53 89.5 54 74.0 55 44.5 56 32.0 57 32.0 58 22.0 59 15.5 60 12.0 61 8.5 62 6.5 63 5.0 64 6.0 65 4.5 66 3.0 67 2.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.15 0.0 0.0 0.0 0.0 106-107 3.05 0.0 0.0 0.0 0.0 108-109 4.074999999999999 0.0 0.0 0.0 0.0 110-111 4.8375 0.0 0.0 0.0 0.0 112-113 5.475 0.0 0.0 0.0 0.0 114-115 5.95 0.0 0.0 0.0 0.0 116-117 6.975 0.0 0.0 0.0 0.0 118-119 7.425 0.0 0.0 0.0 0.0 120-121 7.824999999999999 0.0 0.0 0.0 0.0 122-123 8.875 0.0 0.0 0.0 0.0 124-125 9.774999999999999 0.0 0.0 0.0 0.0 126-127 10.175 0.0 0.0 0.0 0.0 128-129 10.75 0.0 0.0 0.0 0.0 130-131 11.4875 0.0 0.0 0.0 0.0 132-133 12.649999999999999 0.0 0.0 0.0 0.0 134-135 13.912500000000001 0.0 0.0 0.0 0.0 136-137 15.3875 0.0 0.0 0.0 0.0 138 16.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 55 1.2304276E-4 18.327272 35-39 >>END_MODULE Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152386 spots for SRR1799548.sra Written 1152386 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra Read 1152377 spots for SRR1799548.sra Written 1152377 spots for SRR1799548.sra SRR ids: ['SRR1799548.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fz_py5bv SRR1799548.sra spots: 23047549 blocks: [[1, 1152377], [1152378, 2304754], [2304755, 3457131], [3457132, 4609508], [4609509, 5761885], [5761886, 6914262], [6914263, 8066639], [8066640, 9219016], [9219017, 10371393], [10371394, 11523770], [11523771, 12676147], [12676148, 13828524], [13828525, 14980901], [14980902, 16133278], [16133279, 17285655], [17285656, 18438032], [18438033, 19590409], [19590410, 20742786], [20742787, 21895163], [21895164, 23047549]] SRR1799548 file size 7743342 SRR1799548 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799548 SRR1799548_1.fastq SRR1799548_2.fastq Input file: SRR1799548_1.fastq Paired file: SRR1799548_2.fastq trimmed: SRR1799548-trimmed-pair1.fastq, SRR1799548-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:24:25 2025 >> started Thu Feb 13 22:24:50 2025 >> done (25.075s) 23047549 read pairs processed; of these: 46152 ( 0.20%) short read pairs filtered out after trimming by size control 86998 ( 0.38%) empty read pairs filtered out after trimming by size control 22914399 (99.42%) read pairs available; of these: 12477613 (54.45%) trimmed read pairs available after processing 10436786 (45.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 4 0.00% 21 6 0.00% 22 8 0.00% 23 20 0.00% 24 25 0.00% 25 41 0.00% 26 31 0.00% 27 56 0.00% 28 84 0.00% 29 81 0.00% 30 88 0.00% 31 121 0.00% 32 137 0.00% 33 195 0.00% 34 190 0.00% 35 227 0.00% 36 287 0.00% 37 277 0.00% 38 326 0.00% 39 393 0.00% 40 425 0.00% 41 474 0.00% 42 500 0.00% 43 546 0.00% 44 639 0.00% 45 676 0.00% 46 716 0.00% 47 831 0.00% 48 962 0.00% 49 1029 0.00% 50 1172 0.01% 51 1182 0.01% 52 1308 0.01% 53 1381 0.01% 54 1599 0.01% 55 1624 0.01% 56 1759 0.01% 57 1934 0.01% 58 2183 0.01% 59 2405 0.01% 60 2642 0.01% 61 2965 0.01% 62 3357 0.01% 63 3688 0.02% 64 4033 0.02% 65 4406 0.02% 66 4751 0.02% 67 5330 0.02% 68 5945 0.03% 69 6453 0.03% 70 7482 0.03% 71 8459 0.04% 72 9383 0.04% 73 10631 0.05% 74 11703 0.05% 75 13077 0.06% 76 14063 0.06% 77 14250 0.06% 78 13864 0.06% 79 13093 0.06% 80 11319 0.05% 81 9975 0.04% 82 7855 0.03% 83 7789 0.03% 84 10197 0.04% 85 10878 0.05% 86 12105 0.05% 87 16040 0.07% 88 21049 0.09% 89 19006 0.08% 90 16815 0.07% 91 19392 0.08% 92 34611 0.15% 93 25824 0.11% 94 20687 0.09% 95 20862 0.09% 96 20414 0.09% 97 22817 0.10% 98 33613 0.15% 99 34725 0.15% 100 29609 0.13% 101 22813 0.10% 102 66182 0.29% 103 64515 0.28% 104 54049 0.24% 105 121313 0.53% 106 148845 0.65% 107 70498 0.31% 108 98402 0.43% 109 83875 0.37% 110 113592 0.50% 111 104796 0.46% 112 124080 0.54% 113 68771 0.30% 114 58232 0.25% 115 189298 0.83% 116 84634 0.37% 117 93566 0.41% 118 37611 0.16% 119 60058 0.26% 120 57475 0.25% 121 132230 0.58% 122 141759 0.62% 123 116173 0.51% 124 61547 0.27% 125 39766 0.17% 126 123121 0.54% 127 94092 0.41% 128 82361 0.36% 129 110717 0.48% 130 198510 0.87% 131 189490 0.83% 132 139887 0.61% 133 215445 0.94% 134 232350 1.01% 135 203937 0.89% 136 227922 0.99% 137 240217 1.05% 138 254133 1.11% 139 268515 1.17% 140 278254 1.21% 141 288187 1.26% 142 304468 1.33% 143 319808 1.40% 144 353874 1.54% 145 407595 1.78% 146 495416 2.16% 147 647932 2.83% 148 992791 4.33% 149 3003409 13.11% 150 10436786 45.55% 22914399 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.1 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=74.13 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=12.6 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=27 prefix-density=0.26 prefix-fanout=3.2 sequence=TGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAAAACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCCGTGGGCTACAAGTGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=41.01 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.1 sequence=TGCTGAGATCATTG SRR1799548 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:26:00 Started mapping on | Feb 13 22:26:00 Finished on | Feb 13 22:28:35 Mapping speed, Million of reads per hour | 532.21 Number of input reads | 22914399 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 18713092 Uniquely mapped reads % | 81.67% Average mapped length | 277.17 Number of splices: Total | 15482633 Number of splices: Annotated (sjdb) | 15089610 Number of splices: GT/AG | 15174156 Number of splices: GC/AG | 185188 Number of splices: AT/AC | 13079 Number of splices: Non-canonical | 110210 Mismatch rate per base, % | 1.20% Deletion rate per base | 0.10% Deletion average length | 2.94 Insertion rate per base | 0.07% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 711477 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 36027 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.03% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3525855 3525855 3525855 N_multimapping 711477 711477 711477 N_noFeature 526252 18459032 646319 N_ambiguous 356720 2642 220995 UnstrandedReadsAssigned:17830120 PositiveStrandReadsAssigned:251418 NegativeStrandReadsAssigned:17845778 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR1799548 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799548-trimmed-pair1.fastq SRR1799548-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,914,399 reads, 20,174,876 reads pseudoaligned [quant] estimated average fragment length: 180.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR1799548.ke.tsv 34699 SRR1799548.se.tsv 87100 total ==> SRR1799548.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.43 463.337 14.3066 Potri.005G024800.1.v4.1 1035 855.428 366 24.2875 Potri.004G059700.1.v4.1 961 781.428 23 1.6708 Potri.007G009000.2.v4.1 1416 1236.43 0 0 Potri.003G141000.2.v4.1 2943 2763.43 374.213 7.68699 Potri.016G087400.1.v4.1 270 106.283 1757 938.415 Potri.015G069301.1.v4.1 564 384.876 0 0 Potri.010G195200.1.v4.1 1773 1593.43 18 0.641248 Potri.012G127500.1.v4.1 977 797.428 4266 303.679 ==> SRR1799548.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 860 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR1799548 completed mapping pipeline successfully