Starting /dee2/code/volunteer_pipeline.sh SRR1799549 current disk space = 3088654315520 free memory = 1580120480 SRR1799549 SRAfilesize 8f519c360264cc60a3e99a631236b53b SRR1799549.sra SRR1799549.sra file validated SRR1799549 is paired end SRR1799549 is conventional basespace SRR1799549 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799549_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.004 34.0 34.0 34.0 31.0 34.0 2 32.7285 34.0 34.0 34.0 31.0 34.0 3 33.30475 34.0 34.0 34.0 31.0 34.0 4 36.58725 37.0 37.0 37.0 35.0 37.0 5 36.61125 37.0 37.0 37.0 35.0 37.0 6 36.657 37.0 37.0 37.0 35.0 37.0 7 36.68275 37.0 37.0 37.0 35.0 37.0 8 36.6945 37.0 37.0 37.0 36.0 37.0 9 38.5745 39.0 39.0 39.0 38.0 39.0 10-14 38.93045 39.4 39.2 39.4 38.2 39.4 15-19 40.2673 41.0 40.0 41.0 38.6 41.0 20-24 40.24925 41.0 40.0 41.0 39.0 41.0 25-29 40.066500000000005 41.0 40.0 41.0 38.0 41.0 30-34 40.0481 41.0 40.0 41.0 38.0 41.0 35-39 39.915350000000004 41.0 40.0 41.0 38.0 41.0 40-44 39.745200000000004 41.0 40.0 41.0 37.8 41.0 45-49 39.58795 41.0 40.0 41.0 37.2 41.0 50-54 39.2594 41.0 39.0 41.0 36.2 41.0 55-59 39.039199999999994 40.4 39.0 41.0 35.4 41.0 60-64 38.775999999999996 40.2 38.0 41.0 35.0 41.0 65-69 38.1838 39.2 36.6 41.0 35.0 41.0 70-74 37.14525 37.6 35.4 39.6 34.4 41.0 75-79 35.7513 36.2 34.8 37.8 33.4 39.4 80-84 35.16905 35.2 35.0 36.6 34.0 37.8 85-89 34.55775 35.0 35.0 35.8 33.6 36.6 90-94 34.13595 35.0 35.0 35.0 33.0 36.0 95-99 33.902750000000005 35.0 35.0 35.0 32.4 35.4 100-104 33.98035 35.0 35.0 35.0 33.0 35.0 105-109 33.86255 35.0 35.0 35.0 32.8 35.0 110-114 33.795849999999994 35.0 35.0 35.0 32.2 35.0 115-119 33.6019 35.0 34.0 35.0 31.8 35.0 120-124 33.56205 35.0 34.0 35.0 31.8 35.0 125-129 33.4868 35.0 34.0 35.0 31.2 35.0 130-134 33.21554999999999 35.0 34.0 35.0 30.8 35.0 135-139 32.923950000000005 35.0 34.0 35.0 30.4 35.0 140-144 32.75485 35.0 34.0 35.0 30.0 35.0 145-149 32.21425 35.0 33.4 35.0 28.8 35.0 150 26.83925 33.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 5.0 10 3.0 11 1.0 12 2.0 13 3.0 14 1.0 15 4.0 16 3.0 17 3.0 18 6.0 19 2.0 20 5.0 21 5.0 22 6.0 23 10.0 24 6.0 25 8.0 26 15.0 27 22.0 28 17.0 29 29.0 30 34.0 31 38.0 32 42.0 33 83.0 34 105.0 35 247.0 36 1054.0 37 2177.0 38 62.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.73361300471946 11.798636601992659 6.31882538017829 38.1489250131096 2 22.283425137706562 13.920881321982975 33.29994992488733 30.49574361542313 3 20.025000000000002 16.85 25.324999999999996 37.8 4 23.822645290581164 25.776553106212425 22.21943887775551 28.181362725450903 5 22.400000000000002 30.425 24.5 22.675 6 18.0 34.875 25.124999999999996 22.0 7 14.6 27.075 40.300000000000004 18.025 8 16.35 27.375 32.175 24.099999999999998 9 16.875 25.85 33.675 23.599999999999998 10-14 19.155 30.84 27.61 22.395 15-19 20.035 29.025000000000002 27.925 23.015 20-24 19.82 29.404999999999998 27.134999999999998 23.64 25-29 20.45 29.48 27.02 23.05 30-34 19.755 29.235 27.1 23.91 35-39 19.935 29.4 27.305 23.36 40-44 19.465 29.125 27.700000000000003 23.71 45-49 20.22 28.43 27.615000000000002 23.735 50-54 19.2 29.735 27.575 23.49 55-59 19.96 28.92 27.450000000000003 23.669999999999998 60-64 19.545 29.285 27.689999999999998 23.48 65-69 19.91 28.675 27.55 23.865 70-74 19.665 29.160000000000004 27.375 23.799999999999997 75-79 19.805 29.4 26.935 23.86 80-84 20.115 28.615000000000002 27.68 23.59 85-89 20.46 28.63 27.33 23.580000000000002 90-94 19.830000000000002 29.28 26.534999999999997 24.355 95-99 20.4 28.285 27.800000000000004 23.515 100-104 19.805 28.910000000000004 27.215 24.07 105-109 19.93 29.07 27.255000000000003 23.745 110-114 20.34 29.134999999999998 26.640000000000004 23.885 115-119 21.065 29.01 26.445 23.48 120-124 21.044999999999998 29.580000000000002 25.955000000000002 23.419999999999998 125-129 21.22 28.970000000000002 26.165 23.645 130-134 21.36 28.775000000000002 25.55 24.315 135-139 20.95 29.49 25.09 24.47 140-144 21.060000000000002 29.15 24.625 25.165 145-149 20.745 29.435 24.97 24.85 150 16.444556198139303 30.450088006034697 26.10007543374403 27.005280362081972 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.5 25 3.0 26 2.5 27 5.0 28 10.5 29 16.0 30 21.0 31 29.0 32 39.5 33 47.0 34 60.5 35 75.0 36 86.5 37 113.5 38 148.0 39 164.0 40 191.5 41 218.5 42 224.0 43 247.5 44 284.5 45 279.5 46 262.5 47 257.0 48 235.0 49 208.5 50 175.5 51 137.0 52 99.0 53 80.0 54 67.5 55 46.0 56 34.0 57 33.5 58 23.5 59 13.0 60 12.0 61 12.5 62 9.5 63 6.0 64 6.5 65 3.5 66 0.5 67 1.0 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.65 2 0.15 3 0.0 4 0.2 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.9874999999999999 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.2750000000000004 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.3625 0.0 0.0 0.0 0.0 106-107 3.9625000000000004 0.0 0.0 0.0 0.0 108-109 4.9375 0.0 0.0 0.0 0.0 110-111 5.762499999999999 0.0 0.0 0.0 0.0 112-113 6.699999999999999 0.0 0.0 0.0 0.0 114-115 7.75 0.0 0.0 0.0 0.0 116-117 8.55 0.0 0.0 0.0 0.0 118-119 9.3 0.0 0.0 0.0 0.0 120-121 10.1625 0.0 0.0 0.0 0.0 122-123 11.125 0.0 0.0 0.0 0.0 124-125 12.2 0.0 0.0 0.0 0.0 126-127 13.425 0.0 0.0 0.0 0.0 128-129 14.675 0.0 0.0 0.0 0.0 130-131 16.1875 0.0 0.0 0.0 0.0 132-133 17.6625 0.0 0.0 0.0 0.0 134-135 19.15 0.0 0.0 0.0 0.0 136-137 20.4875 0.0 0.0 0.0 0.0 138 21.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTTT 10 0.0069808904 143.95 2 TCTGAAC 40 0.007982711 17.99375 140-144 >>END_MODULE SRR1799549 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799549_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.589 34.0 33.0 34.0 31.0 34.0 2 32.70975 34.0 33.0 34.0 31.0 34.0 3 32.8015 34.0 34.0 34.0 31.0 34.0 4 35.95225 37.0 37.0 37.0 35.0 37.0 5 36.033 37.0 37.0 37.0 35.0 37.0 6 36.06475 37.0 37.0 37.0 35.0 37.0 7 36.0085 37.0 37.0 37.0 35.0 37.0 8 35.96225 37.0 37.0 37.0 35.0 37.0 9 37.9095 39.0 39.0 39.0 37.0 39.0 10-14 38.232549999999996 39.4 39.2 39.4 37.2 39.4 15-19 39.50939999999999 41.0 40.0 41.0 38.0 41.0 20-24 39.459700000000005 41.0 40.0 41.0 38.0 41.0 25-29 39.3909 41.0 40.0 41.0 38.0 41.0 30-34 39.2655 41.0 40.0 41.0 37.8 41.0 35-39 38.9941 41.0 40.0 41.0 37.0 41.0 40-44 38.841499999999996 41.0 39.8 41.0 36.6 41.0 45-49 38.53175 40.6 39.0 41.0 35.0 41.0 50-54 37.858349999999994 39.6 38.0 40.6 34.4 40.8 55-59 37.932050000000004 40.0 38.0 41.0 34.2 41.0 60-64 37.840650000000004 40.0 37.4 41.0 34.6 41.0 65-69 37.171800000000005 39.0 36.0 41.0 34.0 41.0 70-74 36.2288 37.2 35.0 39.4 33.8 41.0 75-79 35.0893 36.0 35.0 37.8 33.0 39.2 80-84 34.20524999999999 35.0 35.0 36.4 32.4 37.8 85-89 33.58345 35.0 35.0 35.6 31.4 36.4 90-94 33.3027 35.0 34.8 35.0 31.4 36.0 95-99 33.116499999999995 35.0 34.4 35.0 31.0 35.4 100-104 33.020050000000005 35.0 34.0 35.0 30.8 35.0 105-109 32.88655 35.0 34.0 35.0 30.4 35.0 110-114 32.6177 35.0 34.0 35.0 29.2 35.0 115-119 32.5438 35.0 34.0 35.0 29.0 35.0 120-124 32.397999999999996 35.0 34.0 35.0 29.0 35.0 125-129 32.3335 35.0 34.0 35.0 29.0 35.0 130-134 32.011700000000005 35.0 33.2 35.0 27.0 35.0 135-139 31.5383 35.0 33.0 35.0 24.6 35.0 140-144 31.164299999999997 35.0 32.4 35.0 23.8 35.0 145-149 30.694 35.0 32.0 35.0 19.8 35.0 150 28.49875 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 56.0 3 5.0 4 4.0 5 2.0 6 2.0 7 5.0 8 6.0 9 5.0 10 5.0 11 0.0 12 6.0 13 5.0 14 10.0 15 2.0 16 3.0 17 5.0 18 4.0 19 5.0 20 2.0 21 3.0 22 10.0 23 13.0 24 11.0 25 10.0 26 12.0 27 22.0 28 22.0 29 37.0 30 40.0 31 42.0 32 61.0 33 101.0 34 144.0 35 298.0 36 1201.0 37 1793.0 38 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.57810145655449 20.567553992968357 12.20492214967353 27.649422400803616 2 26.289434151226843 27.99198798197296 29.694541812719077 16.024036054081122 3 21.382073109664496 27.466199298948425 31.622433650475713 19.529293940911366 4 24.236354531797698 32.02303455182774 24.13620430645969 19.604406609914875 5 25.81372058087131 35.202804206309466 23.485227841762644 15.498247371056584 6 20.674999999999997 39.300000000000004 23.0 17.025000000000002 7 20.849999999999998 22.25 37.974999999999994 18.925 8 22.525000000000002 25.650000000000002 29.049999999999997 22.775000000000002 9 21.3 25.974999999999998 31.05 21.675 10-14 23.812381238123812 29.072907290729074 26.737673767376734 20.377037703770377 15-19 23.726186309315466 28.16640832041602 27.94139706985349 20.16600830041502 20-24 23.461173058652932 28.10140507025351 28.546427321366068 19.890994549727488 25-29 23.580000000000002 27.73 28.325 20.365 30-34 23.655 27.6 28.544999999999998 20.200000000000003 35-39 23.23 27.700000000000003 28.33 20.74 40-44 23.645 27.785 28.134999999999998 20.435 45-49 23.65 27.22 29.15 19.98 50-54 23.555 28.15 28.74 19.555 55-59 24.305 27.3 28.410000000000004 19.985 60-64 23.575 27.634999999999998 28.395 20.395 65-69 23.674999999999997 27.765 28.43 20.13 70-74 23.915 26.950000000000003 28.77 20.365 75-79 24.0 27.500000000000004 28.945 19.555 80-84 23.985 27.584999999999997 28.505000000000003 19.925 85-89 23.84 27.46 28.51 20.19 90-94 23.95 27.250000000000004 28.835 19.965 95-99 24.325 28.07 28.134999999999998 19.470000000000002 100-104 24.834999999999997 27.04 28.494999999999997 19.63 105-109 24.445 27.73 28.050000000000004 19.775000000000002 110-114 24.415 27.939999999999998 27.685 19.96 115-119 25.5812790639532 28.006400320016 26.896344817240863 19.51597579878994 120-124 25.505 28.285 26.66 19.55 125-129 25.97 27.405 27.450000000000003 19.175 130-134 26.645000000000003 28.82 26.105 18.43 135-139 26.674999999999997 28.49 26.265 18.57 140-144 27.589999999999996 27.97 26.179999999999996 18.26 145-149 28.46 28.275 25.495 17.77 150 28.333753466095285 28.485001260398285 24.754222334257626 18.4270229392488 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 1.0 26 5.5 27 7.0 28 8.0 29 13.5 30 14.5 31 23.0 32 31.0 33 36.0 34 57.0 35 80.0 36 101.0 37 128.0 38 147.5 39 160.0 40 178.5 41 214.0 42 247.0 43 267.5 44 273.0 45 274.0 46 270.5 47 251.0 48 221.0 49 196.5 50 181.0 51 145.5 52 108.5 53 84.5 54 68.5 55 49.5 56 32.5 57 22.0 58 17.0 59 15.0 60 9.0 61 8.0 62 8.5 63 8.0 64 7.5 65 6.5 66 4.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.15 3 0.15 4 0.15 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.005 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.5375 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 0.9874999999999999 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.2625000000000002 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.875 0.0 0.0 0.0 0.0 100-101 2.2750000000000004 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.3625 0.0 0.0 0.0 0.0 106-107 3.9625000000000004 0.0 0.0 0.0 0.0 108-109 4.9125 0.0 0.0 0.0 0.0 110-111 5.762499999999999 0.0 0.0 0.0 0.0 112-113 6.699999999999999 0.0 0.0 0.0 0.0 114-115 7.75 0.0 0.0 0.0 0.0 116-117 8.525 0.0 0.0 0.0 0.0 118-119 9.274999999999999 0.0 0.0 0.0 0.0 120-121 10.1375 0.0 0.0 0.0 0.0 122-123 11.037500000000001 0.0 0.0 0.0 0.0 124-125 12.1 0.0 0.0 0.0 0.0 126-127 13.275 0.0 0.0 0.0 0.0 128-129 14.5125 0.0 0.0 0.0 0.0 130-131 15.987499999999999 0.0 0.0 0.0 0.0 132-133 17.450000000000003 0.0 0.0 0.0 0.0 134-135 18.9375 0.0 0.0 0.0 0.0 136-137 20.225 0.0 0.0 0.0 0.0 138 21.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCTCT 10 0.0069754543 143.9875 3 GGAAGCT 10 0.0069754543 143.9875 7 >>END_MODULE Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414982 spots for SRR1799549.sra Written 1414982 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra Read 1414970 spots for SRR1799549.sra Written 1414970 spots for SRR1799549.sra SRR ids: ['SRR1799549.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t_8h5k3o SRR1799549.sra spots: 28299412 blocks: [[1, 1414970], [1414971, 2829940], [2829941, 4244910], [4244911, 5659880], [5659881, 7074850], [7074851, 8489820], [8489821, 9904790], [9904791, 11319760], [11319761, 12734730], [12734731, 14149700], [14149701, 15564670], [15564671, 16979640], [16979641, 18394610], [18394611, 19809580], [19809581, 21224550], [21224551, 22639520], [22639521, 24054490], [24054491, 25469460], [25469461, 26884430], [26884431, 28299412]] SRR1799549 file size 9512769 SRR1799549 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799549 SRR1799549_1.fastq SRR1799549_2.fastq Input file: SRR1799549_1.fastq Paired file: SRR1799549_2.fastq trimmed: SRR1799549-trimmed-pair1.fastq, SRR1799549-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:27:47 2025 >> started Thu Feb 13 22:28:18 2025 >> done (31.131s) 28299412 read pairs processed; of these: 98126 ( 0.35%) short read pairs filtered out after trimming by size control 303265 ( 1.07%) empty read pairs filtered out after trimming by size control 27898021 (98.58%) read pairs available; of these: 12987470 (46.55%) trimmed read pairs available after processing 14910551 (53.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 8 0.00% 21 7 0.00% 22 21 0.00% 23 27 0.00% 24 56 0.00% 25 63 0.00% 26 57 0.00% 27 89 0.00% 28 102 0.00% 29 134 0.00% 30 160 0.00% 31 191 0.00% 32 226 0.00% 33 234 0.00% 34 297 0.00% 35 328 0.00% 36 392 0.00% 37 428 0.00% 38 492 0.00% 39 498 0.00% 40 556 0.00% 41 642 0.00% 42 677 0.00% 43 716 0.00% 44 799 0.00% 45 853 0.00% 46 981 0.00% 47 988 0.00% 48 1068 0.00% 49 1163 0.00% 50 1265 0.00% 51 1422 0.01% 52 1513 0.01% 53 1601 0.01% 54 1717 0.01% 55 1872 0.01% 56 2010 0.01% 57 2197 0.01% 58 2493 0.01% 59 2675 0.01% 60 3029 0.01% 61 3302 0.01% 62 3803 0.01% 63 4119 0.01% 64 4743 0.02% 65 5140 0.02% 66 5638 0.02% 67 5954 0.02% 68 6870 0.02% 69 7485 0.03% 70 8447 0.03% 71 9588 0.03% 72 10663 0.04% 73 12211 0.04% 74 13580 0.05% 75 15369 0.06% 76 16985 0.06% 77 17756 0.06% 78 19225 0.07% 79 20893 0.07% 80 22019 0.08% 81 24088 0.09% 82 26218 0.09% 83 26545 0.10% 84 34168 0.12% 85 36314 0.13% 86 40426 0.14% 87 42276 0.15% 88 29243 0.10% 89 32541 0.12% 90 31284 0.11% 91 34281 0.12% 92 34648 0.12% 93 33994 0.12% 94 41696 0.15% 95 42108 0.15% 96 38399 0.14% 97 54565 0.20% 98 64851 0.23% 99 43295 0.16% 100 49766 0.18% 101 110873 0.40% 102 80598 0.29% 103 68234 0.24% 104 96572 0.35% 105 143892 0.52% 106 81960 0.29% 107 156214 0.56% 108 129185 0.46% 109 140186 0.50% 110 153877 0.55% 111 171071 0.61% 112 183561 0.66% 113 191453 0.69% 114 133350 0.48% 115 207722 0.74% 116 123706 0.44% 117 88341 0.32% 118 152478 0.55% 119 123880 0.44% 120 130310 0.47% 121 154132 0.55% 122 200775 0.72% 123 156090 0.56% 124 131382 0.47% 125 211131 0.76% 126 181096 0.65% 127 187319 0.67% 128 214849 0.77% 129 220127 0.79% 130 233226 0.84% 131 198741 0.71% 132 234413 0.84% 133 233140 0.84% 134 226468 0.81% 135 239469 0.86% 136 243387 0.87% 137 251433 0.90% 138 246755 0.88% 139 250090 0.90% 140 251529 0.90% 141 255119 0.91% 142 261710 0.94% 143 268177 0.96% 144 281789 1.01% 145 302891 1.09% 146 332694 1.19% 147 403168 1.45% 148 557639 2.00% 149 2382716 8.54% 150 14910551 53.45% 27898021 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.3 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=103.58 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=14.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=3.0 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=49.24 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=11.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTT SRR1799549 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:29:07 Started mapping on | Feb 13 22:29:07 Finished on | Feb 13 22:33:02 Mapping speed, Million of reads per hour | 427.37 Number of input reads | 27898021 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 26076718 Uniquely mapped reads % | 93.47% Average mapped length | 278.79 Number of splices: Total | 20634807 Number of splices: Annotated (sjdb) | 20087072 Number of splices: GT/AG | 20232276 Number of splices: GC/AG | 245873 Number of splices: AT/AC | 19839 Number of splices: Non-canonical | 136819 Mismatch rate per base, % | 1.14% Deletion rate per base | 0.10% Deletion average length | 2.97 Insertion rate per base | 0.07% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 967683 % of reads mapped to multiple loci | 3.47% Number of reads mapped to too many loci | 48553 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892885 892885 892885 N_multimapping 967683 967683 967683 N_noFeature 895474 25707866 1083142 N_ambiguous 323608 1436 141683 UnstrandedReadsAssigned:24857636 PositiveStrandReadsAssigned:367416 NegativeStrandReadsAssigned:24851893 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=132 echo kmer=127 SRR1799549 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799549-trimmed-pair1.fastq SRR1799549-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,898,021 reads, 24,166,027 reads pseudoaligned [quant] estimated average fragment length: 180.93 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR1799549.ke.tsv 34699 SRR1799549.se.tsv 87100 total ==> SRR1799549.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.07 856 22.5284 Potri.005G024800.1.v4.1 1035 855.07 1035 58.5541 Potri.004G059700.1.v4.1 961 781.07 68 4.21151 Potri.007G009000.2.v4.1 1416 1236.07 0 0 Potri.003G141000.2.v4.1 2943 2763.07 264 4.62201 Potri.016G087400.1.v4.1 270 107.796 1927 864.765 Potri.015G069301.1.v4.1 564 384.726 0 0 Potri.010G195200.1.v4.1 1773 1593.07 27 0.819875 Potri.012G127500.1.v4.1 977 797.07 9165 556.231 ==> SRR1799549.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1689 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 483 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR1799549 completed mapping pipeline successfully