Starting /dee2/code/volunteer_pipeline.sh SRR1799550 current disk space = 3088668999680 free memory = 1542109128 SRR1799550 SRAfilesize 6d9a75ceedf4e1bd8cb726eac8969488 SRR1799550.sra SRR1799550.sra file validated SRR1799550 is paired end SRR1799550 is conventional basespace SRR1799550 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799550_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78425 34.0 33.0 34.0 31.0 34.0 2 33.05075 34.0 34.0 34.0 31.0 34.0 3 33.22425 34.0 34.0 34.0 31.0 34.0 4 36.56275 37.0 37.0 37.0 35.0 37.0 5 36.53525 37.0 37.0 37.0 35.0 37.0 6 36.53675 37.0 37.0 37.0 35.0 37.0 7 36.42225 37.0 37.0 37.0 35.0 37.0 8 36.5045 37.0 37.0 37.0 35.0 37.0 9 38.3945 39.0 39.0 39.0 37.0 39.0 10-14 38.6726 39.4 39.2 39.4 37.2 39.4 15-19 39.8957 41.0 40.0 41.0 38.0 41.0 20-24 39.85575 41.0 40.0 41.0 38.0 41.0 25-29 39.7812 41.0 40.0 41.0 37.8 41.0 30-34 39.62714999999999 41.0 40.0 41.0 37.2 41.0 35-39 39.44375 41.0 39.6 41.0 36.8 41.0 40-44 39.386300000000006 41.0 39.0 41.0 36.4 41.0 45-49 39.53735 41.0 40.0 41.0 37.0 41.0 50-54 39.2715 41.0 39.2 41.0 35.8 41.0 55-59 38.983050000000006 40.4 38.8 41.0 35.0 41.0 60-64 38.544050000000006 40.0 37.4 41.0 35.0 41.0 65-69 37.6836 39.0 36.2 40.8 34.2 41.0 70-74 36.77005 37.2 35.0 39.4 33.8 41.0 75-79 35.25855 35.6 34.6 37.4 32.0 39.2 80-84 34.88035 35.0 35.0 36.4 32.8 37.8 85-89 34.340149999999994 35.0 35.0 35.6 32.2 36.4 90-94 33.9616 35.0 34.0 35.0 32.0 36.0 95-99 33.86775 35.0 34.0 35.0 32.0 35.4 100-104 33.704750000000004 35.0 34.0 35.0 31.4 35.0 105-109 33.62835 35.0 34.0 35.0 31.4 35.0 110-114 33.4206 35.0 34.0 35.0 31.0 35.0 115-119 33.338100000000004 35.0 34.0 35.0 31.0 35.0 120-124 33.193149999999996 35.0 34.0 35.0 30.4 35.0 125-129 32.96510000000001 35.0 33.8 35.0 29.8 35.0 130-134 32.6981 35.0 33.0 35.0 29.2 35.0 135-139 32.3227 35.0 33.0 35.0 28.6 35.0 140-144 31.803350000000002 34.0 32.4 35.0 26.2 35.0 145-149 31.182 34.0 32.0 35.0 24.8 35.0 150 27.66875 31.0 25.0 34.0 15.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 3.0 11 4.0 12 2.0 13 1.0 14 0.0 15 1.0 16 6.0 17 6.0 18 3.0 19 8.0 20 3.0 21 6.0 22 6.0 23 14.0 24 11.0 25 21.0 26 14.0 27 12.0 28 21.0 29 36.0 30 46.0 31 59.0 32 84.0 33 129.0 34 190.0 35 351.0 36 1084.0 37 1856.0 38 22.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.0321274981027 11.611434353655453 7.361497596761953 39.99494055147989 2 21.625 15.024999999999999 34.475 28.875 3 18.45 17.625 25.650000000000002 38.275 4 25.25 23.9 21.925 28.925 5 23.1 30.675 24.525 21.7 6 19.375 35.8 23.75 21.075 7 15.024999999999999 29.025000000000002 39.574999999999996 16.375 8 16.625 27.900000000000002 31.55 23.925 9 16.85 25.45 34.150000000000006 23.549999999999997 10-14 19.040000000000003 31.35 27.43 22.18 15-19 18.935 29.48 27.87 23.715 20-24 19.005 29.78 27.37 23.845 25-29 19.54 29.830000000000002 27.365000000000002 23.265 30-34 19.35 30.0 27.334999999999997 23.315 35-39 19.245 30.195 27.425 23.135 40-44 19.72 29.39 27.400000000000002 23.49 45-49 19.939999999999998 29.609999999999996 26.740000000000002 23.71 50-54 19.950000000000003 29.34 27.24 23.47 55-59 19.66 29.675 27.07 23.595 60-64 19.189999999999998 29.515 27.365000000000002 23.93 65-69 19.505 29.609999999999996 27.375 23.51 70-74 19.85 30.095 27.034999999999997 23.02 75-79 20.415 29.115000000000002 27.18 23.29 80-84 20.424999999999997 28.96 27.52 23.095 85-89 20.79 29.060000000000002 27.034999999999997 23.115 90-94 20.153022953443017 29.19937990698605 26.969045356803523 23.678551782767414 95-99 19.882982447367105 29.26438965844877 26.999049857478624 23.853578036705507 100-104 20.195 28.945 27.0 23.86 105-109 21.32 29.110000000000003 26.365 23.205000000000002 110-114 20.901045052252613 28.691434571728585 26.18630931546577 24.221211060553028 115-119 20.880000000000003 29.28 25.8 24.04 120-124 20.74 28.67 25.765 24.825 125-129 20.72 28.355000000000004 26.105 24.82 130-134 21.435000000000002 28.435 25.569999999999997 24.560000000000002 135-139 20.77207720772077 29.162916291629166 24.477447744774476 25.587558755875587 140-144 21.475 28.03 24.935 25.56 145-149 21.15 28.349999999999998 24.445 26.055 150 19.375 28.349999999999998 24.125 28.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 3.0 25 4.5 26 5.5 27 7.0 28 7.5 29 11.0 30 22.0 31 31.5 32 44.0 33 64.5 34 80.0 35 92.5 36 105.5 37 123.0 38 132.5 39 163.5 40 207.0 41 222.5 42 230.5 43 247.5 44 260.5 45 259.0 46 263.0 47 247.5 48 212.5 49 186.5 50 154.0 51 131.0 52 114.5 53 84.5 54 67.5 55 55.5 56 37.0 57 28.5 58 24.5 59 18.5 60 11.5 61 8.0 62 7.0 63 5.0 64 4.0 65 1.0 66 2.0 67 2.0 68 0.5 69 1.0 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.9625 0.0 0.0 0.0 0.0 86-87 1.0750000000000002 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 90-91 1.5 0.0 0.0 0.0 0.0 92-93 1.9375 0.0 0.0 0.0 0.0 94-95 2.25 0.0 0.0 0.0 0.0 96-97 2.8 0.0 0.0 0.0 0.0 98-99 3.4375 0.0 0.0 0.0 0.0 100-101 4.15 0.0 0.0 0.0 0.0 102-103 4.425000000000001 0.0 0.0 0.0 0.0 104-105 5.5625 0.0 0.0 0.0 0.0 106-107 6.725 0.0 0.0 0.0 0.0 108-109 7.7375 0.025 0.0 0.0 0.0 110-111 8.9375 0.025 0.0 0.0 0.0 112-113 9.9625 0.025 0.0 0.0 0.0 114-115 10.375 0.025 0.0 0.0 0.0 116-117 11.462499999999999 0.025 0.0 0.0 0.0 118-119 11.899999999999999 0.025 0.0 0.0 0.0 120-121 12.275 0.025 0.0 0.0 0.0 122-123 13.4 0.025 0.0 0.0 0.0 124-125 15.0125 0.025 0.0 0.0 0.0 126-127 15.9 0.025 0.0 0.0 0.0 128-129 17.0875 0.025 0.0 0.0 0.0 130-131 18.175 0.025 0.0 0.0 0.0 132-133 19.6 0.025 0.0 0.0 0.0 134-135 21.225 0.025 0.0 0.0 0.0 136-137 22.5625 0.025 0.0 0.0 0.0 138 23.525 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAAA 10 0.006973645 144.0 6 GTCTGAA 60 0.0047032754 14.4 140-144 >>END_MODULE SRR1799550 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799550_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37275 34.0 31.0 34.0 31.0 34.0 2 32.444 34.0 31.0 34.0 31.0 34.0 3 32.59675 34.0 33.0 34.0 31.0 34.0 4 35.9215 37.0 37.0 37.0 35.0 37.0 5 35.963 37.0 37.0 37.0 35.0 37.0 6 35.991 37.0 37.0 37.0 35.0 37.0 7 35.9695 37.0 37.0 37.0 35.0 37.0 8 35.92875 37.0 37.0 37.0 35.0 37.0 9 37.73925 39.0 39.0 39.0 37.0 39.0 10-14 38.01605000000001 39.4 39.2 39.4 37.0 39.4 15-19 39.2395 41.0 40.0 41.0 37.2 41.0 20-24 39.15795000000001 41.0 40.0 41.0 37.0 41.0 25-29 38.97555 41.0 39.4 41.0 36.2 41.0 30-34 38.94815 41.0 40.0 41.0 36.4 41.0 35-39 38.82525 41.0 39.2 41.0 36.0 41.0 40-44 38.67045 41.0 39.0 41.0 35.0 41.0 45-49 38.534000000000006 40.6 39.0 41.0 35.0 41.0 50-54 37.5986 39.4 37.8 40.2 33.6 40.6 55-59 37.9486 40.0 37.8 41.0 34.0 41.0 60-64 37.380649999999996 39.4 36.6 41.0 33.4 41.0 65-69 36.8915 38.8 35.8 40.8 33.4 41.0 70-74 35.97425 36.8 35.0 39.2 33.0 40.8 75-79 34.92945 35.8 35.0 37.4 32.2 39.2 80-84 34.0624 35.0 35.0 36.2 31.8 37.4 85-89 33.48975 35.0 34.2 35.4 31.0 36.4 90-94 33.2116 35.0 34.0 35.0 30.8 36.0 95-99 32.9277 35.0 34.0 35.0 30.2 35.0 100-104 32.798899999999996 35.0 34.0 35.0 29.8 35.0 105-109 32.713100000000004 35.0 34.0 35.0 29.2 35.0 110-114 32.5889 35.0 34.0 35.0 29.0 35.0 115-119 32.41175 35.0 33.4 35.0 29.0 35.0 120-124 32.14975 35.0 33.0 35.0 27.4 35.0 125-129 31.935699999999997 35.0 33.0 35.0 26.6 35.0 130-134 31.5678 34.8 32.6 35.0 25.4 35.0 135-139 31.19335 34.0 32.0 35.0 24.2 35.0 140-144 30.702250000000003 34.0 31.2 35.0 22.6 35.0 145-149 29.79755 34.0 31.0 35.0 9.0 35.0 150 26.8305 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 55.0 3 2.0 4 5.0 5 0.0 6 2.0 7 2.0 8 2.0 9 6.0 10 5.0 11 1.0 12 3.0 13 5.0 14 6.0 15 3.0 16 10.0 17 5.0 18 4.0 19 7.0 20 8.0 21 9.0 22 5.0 23 12.0 24 14.0 25 16.0 26 20.0 27 23.0 28 26.0 29 28.0 30 57.0 31 75.0 32 75.0 33 119.0 34 199.0 35 446.0 36 1256.0 37 1461.0 38 28.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 18.875 11.5 29.549999999999997 2 26.075 25.674999999999997 31.7 16.55 3 20.200000000000003 27.55 32.15 20.1 4 23.375 32.875 24.275 19.475 5 25.575 35.225 23.125 16.075 6 20.65 39.15 23.0 17.2 7 21.05 22.025 36.825 20.1 8 21.224999999999998 24.474999999999998 30.125 24.175 9 22.725 23.875 31.4 22.0 10-14 24.224999999999998 28.175 26.745 20.855 15-19 22.95 28.09 28.74 20.22 20-24 23.89 27.415 28.015 20.68 25-29 24.03 27.639999999999997 27.985 20.345 30-34 23.59617980899045 28.261413070653536 28.22641132056603 19.91599579978999 35-39 23.169999999999998 28.28 28.185 20.365 40-44 23.585 27.235 28.895 20.285 45-49 23.55971194238848 27.240448089617924 28.430686137227447 20.769153830766154 50-54 23.691184559227963 27.561378068903448 28.7964398219911 19.950997549877496 55-59 23.571178558927947 27.541377068853446 28.781439071953596 20.10600530026501 60-64 23.565 27.189999999999998 28.78 20.465 65-69 23.56 27.500000000000004 28.904999999999998 20.035 70-74 23.832383238323832 27.462746274627463 28.777877787778777 19.926992699269928 75-79 23.43 27.505000000000003 29.104999999999997 19.96 80-84 23.845 27.325 28.67 20.16 85-89 23.98 27.265 29.015 19.74 90-94 24.044999999999998 27.35 28.84 19.765 95-99 23.68 27.935 28.544999999999998 19.84 100-104 24.295 27.77 28.26 19.675 105-109 24.47 27.62 28.389999999999997 19.52 110-114 25.165 28.125 27.1 19.61 115-119 25.624999999999996 28.18 27.165 19.03 120-124 26.179999999999996 27.785 26.900000000000002 19.134999999999998 125-129 26.515 26.784999999999997 27.555000000000003 19.145 130-134 27.146357317865892 28.641432071603578 26.696334816740837 17.51587579378969 135-139 27.295 27.235 26.595000000000002 18.875 140-144 27.217721772177217 27.642764276427645 27.022702270227022 18.116811681168116 145-149 28.07623049219688 27.315926370548222 25.8703481392557 18.7374949979992 150 29.61480740370185 27.463731865932967 24.73736868434217 18.18409204602301 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 2.0 23 0.5 24 1.0 25 4.0 26 5.5 27 5.5 28 7.5 29 12.0 30 19.0 31 30.0 32 37.5 33 35.5 34 40.5 35 61.0 36 83.5 37 116.5 38 146.5 39 169.0 40 193.0 41 232.0 42 256.5 43 266.0 44 276.5 45 264.5 46 265.0 47 259.5 48 240.0 49 201.5 50 157.0 51 133.5 52 113.5 53 82.5 54 62.0 55 52.0 56 39.0 57 30.0 58 19.0 59 14.5 60 12.5 61 8.0 62 6.0 63 7.0 64 6.5 65 5.0 66 2.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 1.0 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.005 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.01 145-149 0.04 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.9125 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 90-91 1.475 0.0 0.0 0.0 0.0 92-93 1.9125 0.0 0.0 0.0 0.0 94-95 2.225 0.0 0.0 0.0 0.0 96-97 2.775 0.0 0.0 0.0 0.0 98-99 3.3875 0.0 0.0 0.0 0.0 100-101 4.075 0.0 0.0 0.0 0.0 102-103 4.362500000000001 0.0 0.0 0.0 0.0 104-105 5.5375 0.0 0.0 0.0 0.0 106-107 6.7125 0.0 0.0 0.0 0.0 108-109 7.7375 0.0 0.0 0.0 0.0 110-111 8.9375 0.0 0.0 0.0 0.0 112-113 10.0125 0.0 0.0 0.0 0.0 114-115 10.375 0.0 0.0 0.0 0.0 116-117 11.475 0.0 0.0 0.0 0.0 118-119 11.9125 0.0 0.0 0.0 0.0 120-121 12.2625 0.0 0.0 0.0 0.0 122-123 13.375 0.0 0.0 0.0 0.0 124-125 14.925 0.0 0.0 0.0 0.0 126-127 15.837499999999999 0.0 0.0 0.0 0.0 128-129 17.0375 0.0 0.0 0.0 0.0 130-131 18.15 0.0 0.0 0.0 0.0 132-133 19.575000000000003 0.0 0.0 0.0 0.0 134-135 21.1875 0.0 0.0 0.0 0.0 136-137 22.5625 0.0 0.0 0.0 0.0 138 23.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 60 0.0047032754 14.4 140-144 TGTAGGG 60 0.0047032754 14.4 140-144 >>END_MODULE Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425023 spots for SRR1799550.sra Written 1425023 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra Read 1425004 spots for SRR1799550.sra Written 1425004 spots for SRR1799550.sra SRR ids: ['SRR1799550.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tehste8x SRR1799550.sra spots: 28500099 blocks: [[1, 1425004], [1425005, 2850008], [2850009, 4275012], [4275013, 5700016], [5700017, 7125020], [7125021, 8550024], [8550025, 9975028], [9975029, 11400032], [11400033, 12825036], [12825037, 14250040], [14250041, 15675044], [15675045, 17100048], [17100049, 18525052], [18525053, 19950056], [19950057, 21375060], [21375061, 22800064], [22800065, 24225068], [24225069, 25650072], [25650073, 27075076], [27075077, 28500099]] SRR1799550 file size 9580383 SRR1799550 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799550 SRR1799550_1.fastq SRR1799550_2.fastq Input file: SRR1799550_1.fastq Paired file: SRR1799550_2.fastq trimmed: SRR1799550-trimmed-pair1.fastq, SRR1799550-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:28:54 2025 >> started Thu Feb 13 22:29:26 2025 >> done (31.662s) 28500099 read pairs processed; of these: 100619 ( 0.35%) short read pairs filtered out after trimming by size control 283328 ( 0.99%) empty read pairs filtered out after trimming by size control 28116152 (98.65%) read pairs available; of these: 12948353 (46.05%) trimmed read pairs available after processing 15167799 (53.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 10 0.00% 21 11 0.00% 22 26 0.00% 23 39 0.00% 24 47 0.00% 25 78 0.00% 26 76 0.00% 27 112 0.00% 28 128 0.00% 29 157 0.00% 30 188 0.00% 31 219 0.00% 32 266 0.00% 33 301 0.00% 34 397 0.00% 35 416 0.00% 36 523 0.00% 37 582 0.00% 38 605 0.00% 39 710 0.00% 40 713 0.00% 41 860 0.00% 42 935 0.00% 43 988 0.00% 44 1201 0.00% 45 1160 0.00% 46 1315 0.00% 47 1497 0.01% 48 1619 0.01% 49 1742 0.01% 50 1852 0.01% 51 2104 0.01% 52 2161 0.01% 53 2362 0.01% 54 2526 0.01% 55 2808 0.01% 56 3095 0.01% 57 3493 0.01% 58 4168 0.01% 59 4252 0.02% 60 4723 0.02% 61 4756 0.02% 62 5354 0.02% 63 6038 0.02% 64 6657 0.02% 65 7534 0.03% 66 8131 0.03% 67 9222 0.03% 68 10156 0.04% 69 10583 0.04% 70 11751 0.04% 71 13010 0.05% 72 14789 0.05% 73 16837 0.06% 74 18580 0.07% 75 20362 0.07% 76 21443 0.08% 77 21713 0.08% 78 21931 0.08% 79 21248 0.08% 80 18009 0.06% 81 17095 0.06% 82 15710 0.06% 83 15332 0.05% 84 21263 0.08% 85 22558 0.08% 86 26228 0.09% 87 33056 0.12% 88 42104 0.15% 89 43588 0.16% 90 53994 0.19% 91 76883 0.27% 92 86109 0.31% 93 90309 0.32% 94 73537 0.26% 95 67198 0.24% 96 92741 0.33% 97 103157 0.37% 98 124987 0.44% 99 170177 0.61% 100 103024 0.37% 101 58553 0.21% 102 74178 0.26% 103 147131 0.52% 104 164730 0.59% 105 180387 0.64% 106 196979 0.70% 107 146721 0.52% 108 122738 0.44% 109 177805 0.63% 110 180487 0.64% 111 198414 0.71% 112 98363 0.35% 113 59885 0.21% 114 87047 0.31% 115 230919 0.82% 116 159910 0.57% 117 74061 0.26% 118 58904 0.21% 119 78751 0.28% 120 118751 0.42% 121 199913 0.71% 122 235714 0.84% 123 227271 0.81% 124 156516 0.56% 125 129536 0.46% 126 168206 0.60% 127 218817 0.78% 128 177386 0.63% 129 156002 0.55% 130 180393 0.64% 131 212326 0.76% 132 213847 0.76% 133 244914 0.87% 134 262820 0.93% 135 260184 0.93% 136 260785 0.93% 137 265044 0.94% 138 269266 0.96% 139 278958 0.99% 140 277773 0.99% 141 285052 1.01% 142 293148 1.04% 143 303726 1.08% 144 325148 1.16% 145 349407 1.24% 146 400113 1.42% 147 482347 1.72% 148 634535 2.26% 149 1266864 4.51% 150 15167799 53.95% 28116152 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=2.7 sequence=AAACTCCTGTGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=331.70 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=19.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACCCTTTATTCTGGACCCGGAACCCGACTCAAACCAACCCATG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=21.69 fanout-score-rank=7 prefix-density=0.33 prefix-fanout=10.4 sequence=AGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTCGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTACTGGTACTTATGAATAATTCGGTTTGTCTTGCTGGTGGTCTATAATCGTTAGCTATCCTCAATGGTCTAATCTCATACATTAAGATACCCTATTCATTTTAAGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=281.72 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.6 sequence=AGAAAGAGATCGTAGTTTAATTAGAAGATATACACAATAATGGCCACCAACGGAGAGGAACAGCAAAGTCAGGCAGGAAGGCACCAGGAAGTTGGCCACAAGAGCCTTTTGCAAAGTGACGCTCTTTACCAGTATATTCTCGAGACTAGTGTGTATCCAAGAGAGCCTGAATGCATGAAGGAGCTCAGGGAGGTGACTGCCAAGCATCCTTGGAACATCATGACCACATCTGCTGATGAAGGGCAATTCTTGAATATGCTTTTGAAGCTTGTCAATGCCAAGAACACCATGGAGATCGGTGTTTACACTGGCTATTCTCTCTTGGCCACTGCCCTGGCTATCCCTGAGGATGGCAAGATCTTGGCTATGGACATCAACAGAGAAAACTATGAATTGGGTCTCCCAGTAATTCAGAAAGCTGGTGTTGCGCACAAGATTGATTTCAAGGAAGGCCCTGCTCTACCAGTTCTTGATCAAATGATTGAAGATGGGAAGTGCCATGGAAGTTTTG SRR1799550 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:30:13 Started mapping on | Feb 13 22:30:14 Finished on | Feb 13 22:34:16 Mapping speed, Million of reads per hour | 418.26 Number of input reads | 28116152 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 26056494 Uniquely mapped reads % | 92.67% Average mapped length | 276.20 Number of splices: Total | 20473654 Number of splices: Annotated (sjdb) | 19925979 Number of splices: GT/AG | 20051621 Number of splices: GC/AG | 253800 Number of splices: AT/AC | 17131 Number of splices: Non-canonical | 151102 Mismatch rate per base, % | 1.19% Deletion rate per base | 0.11% Deletion average length | 2.90 Insertion rate per base | 0.08% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1044738 % of reads mapped to multiple loci | 3.72% Number of reads mapped to too many loci | 57986 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1055047 1055047 1055047 N_multimapping 1044738 1044738 1044738 N_noFeature 756914 25665105 942776 N_ambiguous 360709 1508 154641 UnstrandedReadsAssigned:24938871 PositiveStrandReadsAssigned:389881 NegativeStrandReadsAssigned:24959077 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=132 echo kmer=127 SRR1799550 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799550-trimmed-pair1.fastq SRR1799550-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,116,152 reads, 24,326,480 reads pseudoaligned [quant] estimated average fragment length: 177.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,321 rounds 52401 SRR1799550.ke.tsv 34699 SRR1799550.se.tsv 87100 total ==> SRR1799550.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.01 605 14.1793 Potri.005G024800.1.v4.1 1035 858.007 313 15.7401 Potri.004G059700.1.v4.1 961 784.011 59 3.24701 Potri.007G009000.2.v4.1 1416 1239.01 0 0 Potri.003G141000.2.v4.1 2943 2766.01 427.252 6.66476 Potri.016G087400.1.v4.1 270 109.367 2892 1140.95 Potri.015G069301.1.v4.1 564 387.599 0 0 Potri.010G195200.1.v4.1 1773 1596.01 39 1.05435 Potri.012G127500.1.v4.1 977 800.011 6650 358.657 ==> SRR1799550.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1754 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 515 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR1799550 completed mapping pipeline successfully