Starting /dee2/code/volunteer_pipeline.sh SRR1799551 current disk space = 3088589750272 free memory = 1476795364 SRR1799551 SRAfilesize 40ed551a4483d5accc60095051a6800f SRR1799551.sra SRR1799551.sra file validated SRR1799551 is paired end SRR1799551 is conventional basespace SRR1799551 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799551_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.122 34.0 33.0 34.0 31.0 34.0 2 33.3145 34.0 34.0 34.0 31.0 34.0 3 33.40525 34.0 34.0 34.0 31.0 34.0 4 36.69125 37.0 37.0 37.0 35.0 37.0 5 36.67 37.0 37.0 37.0 35.0 37.0 6 36.6345 37.0 37.0 37.0 35.0 37.0 7 36.598 37.0 37.0 37.0 35.0 37.0 8 36.61025 37.0 37.0 37.0 35.0 37.0 9 38.481 39.0 39.0 39.0 37.0 39.0 10-14 38.7789 39.4 39.2 39.4 37.2 39.4 15-19 40.1271 41.0 40.0 41.0 38.0 41.0 20-24 40.0737 41.0 40.0 41.0 38.0 41.0 25-29 39.904250000000005 41.0 40.0 41.0 38.0 41.0 30-34 39.79085 41.0 40.0 41.0 38.0 41.0 35-39 39.64725 41.0 40.0 41.0 37.6 41.0 40-44 39.4634 41.0 39.6 41.0 37.0 41.0 45-49 39.10215 40.2 39.0 41.0 35.8 41.0 50-54 39.18305 40.6 39.0 41.0 35.8 41.0 55-59 38.959500000000006 40.6 38.6 41.0 35.4 41.0 60-64 38.5271 40.0 37.2 41.0 35.0 41.0 65-69 37.670100000000005 38.8 36.2 40.6 34.0 41.0 70-74 36.666250000000005 37.2 35.0 39.4 33.6 40.8 75-79 35.277150000000006 35.6 34.4 37.4 32.2 39.2 80-84 34.92545 35.0 35.0 36.4 33.0 37.6 85-89 34.28495 35.0 34.8 35.6 32.4 36.4 90-94 33.85509999999999 35.0 34.0 35.0 31.8 36.0 95-99 33.79975 35.0 34.0 35.0 31.8 35.0 100-104 33.525400000000005 35.0 34.0 35.0 30.8 35.0 105-109 33.39055 35.0 34.0 35.0 31.0 35.0 110-114 33.282500000000006 35.0 34.0 35.0 30.6 35.0 115-119 33.09495 35.0 34.0 35.0 30.0 35.0 120-124 32.46809999999999 34.6 32.8 35.0 28.0 35.0 125-129 32.2404 34.0 32.8 35.0 27.8 35.0 130-134 31.93165 34.0 32.0 35.0 26.6 35.0 135-139 31.52545 34.0 31.6 35.0 25.4 35.0 140-144 30.936650000000004 34.0 31.0 35.0 24.6 35.0 145-149 29.79065 34.0 30.4 35.0 13.8 35.0 150 22.18025 29.0 2.0 33.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 3.0 11 1.0 12 1.0 13 6.0 14 2.0 15 3.0 16 1.0 17 4.0 18 6.0 19 5.0 20 7.0 21 10.0 22 6.0 23 8.0 24 10.0 25 14.0 26 11.0 27 20.0 28 28.0 29 28.0 30 44.0 31 73.0 32 103.0 33 138.0 34 231.0 35 471.0 36 1349.0 37 1395.0 38 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.34909456740443 10.56338028169014 8.677062374245473 43.410462776659955 2 21.275 14.224999999999998 36.225 28.275 3 20.65 17.05 25.025 37.275000000000006 4 23.1 24.55 22.0 30.349999999999998 5 22.825 31.900000000000002 23.35 21.925 6 19.575 35.075 23.775 21.575 7 13.700000000000001 27.375 40.775 18.15 8 16.825000000000003 26.974999999999998 32.85 23.35 9 17.525 25.025 34.849999999999994 22.6 10-14 18.895 30.445 27.505000000000003 23.155 15-19 19.145 28.815 27.884999999999998 24.154999999999998 20-24 19.75 28.355000000000004 28.389999999999997 23.505000000000003 25-29 19.715 29.5 27.055 23.73 30-34 19.725 28.485 27.425 24.365000000000002 35-39 19.994999999999997 28.849999999999998 27.810000000000002 23.345 40-44 19.505 29.154999999999998 27.694999999999997 23.645 45-49 19.57 29.154999999999998 27.275 24.0 50-54 20.195 29.125 27.465 23.215 55-59 20.015 28.775000000000002 27.555000000000003 23.655 60-64 19.99 28.915000000000003 27.495000000000005 23.599999999999998 65-69 19.36 28.87 27.365000000000002 24.404999999999998 70-74 19.77 28.535 27.85 23.845 75-79 19.905 28.71 27.544999999999998 23.84 80-84 20.265 28.645 27.42 23.669999999999998 85-89 19.950000000000003 28.255000000000003 27.76 24.035 90-94 20.155 28.46 27.62 23.765 95-99 19.79 27.744999999999997 28.02 24.445 100-104 19.775000000000002 28.71 27.49 24.025 105-109 20.330000000000002 28.694999999999997 27.165 23.810000000000002 110-114 21.035 28.32 27.534999999999997 23.11 115-119 20.59 29.075 26.979999999999997 23.355 120-124 20.78 28.715000000000003 26.83 23.674999999999997 125-129 20.78 28.449999999999996 26.695 24.075 130-134 20.28 27.57 27.615000000000002 24.535 135-139 21.325 28.27 26.474999999999998 23.93 140-144 22.225 29.494999999999997 25.495 22.785 145-149 22.915 29.64 24.36 23.085 150 16.625 33.275 24.45 25.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 2.0 24 4.0 25 6.0 26 4.5 27 2.5 28 9.0 29 12.5 30 14.5 31 21.0 32 33.0 33 48.5 34 59.5 35 82.0 36 100.5 37 109.5 38 133.0 39 154.0 40 171.5 41 210.5 42 248.0 43 266.5 44 270.5 45 265.5 46 265.0 47 251.0 48 226.0 49 206.5 50 177.0 51 150.5 52 123.5 53 87.5 54 69.0 55 59.0 56 44.5 57 30.0 58 21.5 59 17.5 60 10.5 61 8.0 62 7.5 63 4.5 64 2.0 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 4.1375 0.0 0.0 0.0 0.0 114-115 4.5625 0.0 0.0 0.0 0.0 116-117 5.55 0.0 0.0 0.0 0.0 118-119 5.949999999999999 0.0 0.0 0.0 0.0 120-121 6.0875 0.0 0.0 0.0 0.0 122-123 6.2 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 6.675000000000001 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.3875 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 11.1125 0.0 0.0 0.0 0.0 138 12.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 5.186094E-4 28.7975 135-139 GATCGGA 70 7.7440904E-4 14.39875 140-144 >>END_MODULE SRR1799551 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799551_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71825 34.0 33.0 34.0 31.0 34.0 2 32.892 34.0 33.0 34.0 31.0 34.0 3 32.96925 34.0 34.0 34.0 31.0 34.0 4 36.2515 37.0 37.0 37.0 35.0 37.0 5 36.1975 37.0 37.0 37.0 35.0 37.0 6 36.139 37.0 37.0 37.0 35.0 37.0 7 36.2085 37.0 37.0 37.0 35.0 37.0 8 36.23575 37.0 37.0 37.0 35.0 37.0 9 38.13125 39.0 39.0 39.0 37.0 39.0 10-14 38.40725 39.4 39.2 39.4 37.2 39.4 15-19 39.631150000000005 41.0 40.0 41.0 38.0 41.0 20-24 39.60575 41.0 40.0 41.0 38.0 41.0 25-29 39.4697 41.0 40.0 41.0 38.0 41.0 30-34 39.30505 41.0 40.0 41.0 37.4 41.0 35-39 38.9639 40.6 39.2 41.0 36.0 41.0 40-44 39.026450000000004 40.4 39.0 41.0 36.4 41.0 45-49 39.0062 41.0 39.2 41.0 36.2 41.0 50-54 37.924749999999996 39.4 38.0 40.6 34.4 40.6 55-59 38.339600000000004 40.0 38.0 41.0 35.0 41.0 60-64 37.800650000000005 39.6 36.8 41.0 34.0 41.0 65-69 36.94250000000001 38.4 35.6 40.2 33.4 41.0 70-74 36.275400000000005 37.0 35.0 39.2 33.6 40.8 75-79 35.300850000000004 35.8 35.0 37.4 33.0 39.2 80-84 34.42735 35.0 35.0 36.2 32.6 37.4 85-89 33.880250000000004 35.0 34.6 35.4 31.6 36.2 90-94 33.490300000000005 35.0 34.0 35.0 31.4 36.0 95-99 33.1978 35.0 34.0 35.0 30.4 35.0 100-104 33.078950000000006 35.0 34.0 35.0 30.0 35.0 105-109 33.03150000000001 35.0 34.0 35.0 30.4 35.0 110-114 32.8296 35.0 34.0 35.0 29.8 35.0 115-119 32.36735 35.0 33.2 35.0 28.0 35.0 120-124 32.34455 35.0 33.0 35.0 28.6 35.0 125-129 32.0192 35.0 33.0 35.0 27.0 35.0 130-134 31.54355 34.0 32.2 35.0 25.6 35.0 135-139 30.703250000000004 34.0 31.2 35.0 20.6 35.0 140-144 30.591049999999996 34.0 31.0 35.0 22.0 35.0 145-149 29.73095 34.0 30.6 35.0 9.0 35.0 150 25.638 30.0 24.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 3.0 4 2.0 5 2.0 6 1.0 7 1.0 8 2.0 9 4.0 10 0.0 11 3.0 12 2.0 13 1.0 14 5.0 15 1.0 16 3.0 17 2.0 18 4.0 19 12.0 20 6.0 21 10.0 22 3.0 23 9.0 24 9.0 25 17.0 26 17.0 27 22.0 28 32.0 29 46.0 30 48.0 31 59.0 32 92.0 33 132.0 34 238.0 35 478.0 36 1318.0 37 1354.0 38 25.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.099999999999994 19.275000000000002 14.35 31.275 2 25.25 26.5 32.475 15.775 3 20.549999999999997 27.125 32.074999999999996 20.25 4 24.375 31.05 25.4 19.175 5 26.25 34.2 24.15 15.4 6 20.7 37.275000000000006 25.124999999999996 16.900000000000002 7 21.224999999999998 21.3 39.125 18.35 8 22.3 24.825 29.4 23.474999999999998 9 22.2 25.3 29.325000000000003 23.175 10-14 23.494999999999997 28.915000000000003 26.82 20.77 15-19 23.669999999999998 27.994999999999997 27.625 20.71 20-24 23.599999999999998 27.855 27.96 20.585 25-29 23.669999999999998 28.185 27.51 20.635 30-34 23.57 28.225 27.944999999999997 20.26 35-39 23.49 28.625 27.85 20.035 40-44 24.154999999999998 27.889999999999997 27.755000000000003 20.200000000000003 45-49 23.59 27.555000000000003 28.105000000000004 20.75 50-54 23.794999999999998 28.735 27.525 19.945 55-59 23.895 27.855 28.4 19.85 60-64 23.575 27.54 28.325 20.560000000000002 65-69 23.91 28.035 28.134999999999998 19.919999999999998 70-74 24.29 27.62 27.82 20.27 75-79 23.615 28.194999999999997 28.24 19.950000000000003 80-84 23.525 27.98 28.065 20.43 85-89 24.29 27.994999999999997 27.765 19.950000000000003 90-94 23.674999999999997 28.16 28.26 19.905 95-99 24.025 27.685 28.525 19.765 100-104 24.29 27.944999999999997 28.050000000000004 19.715 105-109 24.18 27.589999999999996 27.825 20.405 110-114 24.065 27.855 28.18 19.900000000000002 115-119 24.725 28.27 27.345000000000002 19.66 120-124 24.185000000000002 27.38 28.575 19.86 125-129 24.675 27.700000000000003 28.405 19.220000000000002 130-134 25.515 28.705000000000002 26.884999999999998 18.895 135-139 26.005 28.945 26.6 18.45 140-144 25.585 29.89 25.874999999999996 18.65 145-149 27.375 27.72 25.8 19.105 150 26.875 27.175 26.375 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 3.5 25 4.0 26 4.0 27 4.5 28 6.5 29 12.5 30 16.5 31 22.5 32 36.5 33 35.5 34 38.0 35 60.5 36 82.5 37 110.0 38 132.5 39 154.0 40 197.5 41 232.0 42 262.0 43 279.0 44 268.0 45 279.0 46 286.0 47 260.0 48 236.5 49 208.0 50 168.5 51 140.5 52 121.5 53 86.5 54 57.0 55 47.0 56 34.0 57 24.5 58 21.5 59 18.5 60 10.0 61 8.0 62 7.0 63 2.5 64 1.5 65 2.5 66 2.0 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.45 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.512499999999999 0.0 0.0 0.0 0.0 116-117 5.5375 0.0 0.0 0.0 0.0 118-119 5.949999999999999 0.0 0.0 0.0 0.0 120-121 6.0875 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 6.675000000000001 0.0 0.0 0.0 0.0 130-131 6.887499999999999 0.0 0.0 0.0 0.0 132-133 7.449999999999999 0.0 0.0 0.0 0.0 134-135 9.4 0.0 0.0 0.0 0.0 136-137 11.2375 0.0 0.0 0.0 0.0 138 12.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTTC 10 0.006973645 144.0 8 TTAATTT 10 0.006973645 144.0 2 GATCGGA 70 7.738999E-4 14.4 140-144 >>END_MODULE Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908026 spots for SRR1799551.sra Written 908026 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra Read 908015 spots for SRR1799551.sra Written 908015 spots for SRR1799551.sra SRR ids: ['SRR1799551.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1yt97ix6 SRR1799551.sra spots: 18160311 blocks: [[1, 908015], [908016, 1816030], [1816031, 2724045], [2724046, 3632060], [3632061, 4540075], [4540076, 5448090], [5448091, 6356105], [6356106, 7264120], [7264121, 8172135], [8172136, 9080150], [9080151, 9988165], [9988166, 10896180], [10896181, 11804195], [11804196, 12712210], [12712211, 13620225], [13620226, 14528240], [14528241, 15436255], [15436256, 16344270], [16344271, 17252285], [17252286, 18160311]] SRR1799551 file size 6096763 SRR1799551 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799551 SRR1799551_1.fastq SRR1799551_2.fastq Input file: SRR1799551_1.fastq Paired file: SRR1799551_2.fastq trimmed: SRR1799551-trimmed-pair1.fastq, SRR1799551-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:08:53 2025 >> started Thu Feb 13 22:09:16 2025 >> done (22.362s) 18160311 read pairs processed; of these: 39248 ( 0.22%) short read pairs filtered out after trimming by size control 91362 ( 0.50%) empty read pairs filtered out after trimming by size control 18029701 (99.28%) read pairs available; of these: 8017388 (44.47%) trimmed read pairs available after processing 10012313 (55.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 10 0.00% 23 14 0.00% 24 13 0.00% 25 20 0.00% 26 30 0.00% 27 28 0.00% 28 51 0.00% 29 40 0.00% 30 62 0.00% 31 61 0.00% 32 120 0.00% 33 125 0.00% 34 148 0.00% 35 111 0.00% 36 191 0.00% 37 177 0.00% 38 210 0.00% 39 240 0.00% 40 301 0.00% 41 295 0.00% 42 356 0.00% 43 345 0.00% 44 400 0.00% 45 445 0.00% 46 487 0.00% 47 523 0.00% 48 599 0.00% 49 718 0.00% 50 743 0.00% 51 826 0.00% 52 903 0.01% 53 1010 0.01% 54 1066 0.01% 55 1195 0.01% 56 1305 0.01% 57 1392 0.01% 58 1565 0.01% 59 1782 0.01% 60 1931 0.01% 61 2166 0.01% 62 2384 0.01% 63 2745 0.02% 64 2993 0.02% 65 3339 0.02% 66 3769 0.02% 67 4177 0.02% 68 4754 0.03% 69 5110 0.03% 70 5755 0.03% 71 6463 0.04% 72 7316 0.04% 73 8271 0.05% 74 8901 0.05% 75 9051 0.05% 76 8438 0.05% 77 7589 0.04% 78 6198 0.03% 79 5152 0.03% 80 4323 0.02% 81 4098 0.02% 82 4207 0.02% 83 4535 0.03% 84 7226 0.04% 85 7480 0.04% 86 8122 0.05% 87 9337 0.05% 88 9582 0.05% 89 11522 0.06% 90 14654 0.08% 91 11787 0.07% 92 12035 0.07% 93 13731 0.08% 94 15502 0.09% 95 16706 0.09% 96 13764 0.08% 97 14442 0.08% 98 15583 0.09% 99 18908 0.10% 100 16743 0.09% 101 18550 0.10% 102 26637 0.15% 103 26356 0.15% 104 72639 0.40% 105 46406 0.26% 106 30050 0.17% 107 35477 0.20% 108 101058 0.56% 109 44369 0.25% 110 54036 0.30% 111 23100 0.13% 112 47605 0.26% 113 25866 0.14% 114 24482 0.14% 115 180027 1.00% 116 35574 0.20% 117 87705 0.49% 118 23451 0.13% 119 31730 0.18% 120 28835 0.16% 121 33125 0.18% 122 26936 0.15% 123 25489 0.14% 124 37627 0.21% 125 26111 0.14% 126 38028 0.21% 127 27548 0.15% 128 25741 0.14% 129 24408 0.14% 130 25232 0.14% 131 35320 0.20% 132 159536 0.88% 133 182985 1.01% 134 143225 0.79% 135 173795 0.96% 136 194845 1.08% 137 200238 1.11% 138 191952 1.06% 139 213973 1.19% 140 215623 1.20% 141 225684 1.25% 142 236668 1.31% 143 243716 1.35% 144 263148 1.46% 145 283053 1.57% 146 329256 1.83% 147 418250 2.32% 148 612896 3.40% 149 2080320 11.54% 150 10012313 55.53% 18029701 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=3.3 sequence=CTTGTCAGCATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=213.56 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=25.3 sequence=TCATCATCATCA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=12.91 fanout-score-rank=9 prefix-density=0.33 prefix-fanout=7.5 sequence=AGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTCGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTACTGGTACTTATGAATAATTCGGTTTGTCTTGCTGGTGGTCTATAATCGTTAGCTATCCTCAATGGTCTAATCTCATACATTAAGATACCCTATTCATTTTAAGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=50.19 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=9.3 sequence=ATGGTGATGCTGG SRR1799551 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:10:02 Started mapping on | Feb 13 22:10:02 Finished on | Feb 13 22:12:27 Mapping speed, Million of reads per hour | 447.63 Number of input reads | 18029701 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16916408 Uniquely mapped reads % | 93.83% Average mapped length | 286.01 Number of splices: Total | 13728542 Number of splices: Annotated (sjdb) | 13370246 Number of splices: GT/AG | 13470659 Number of splices: GC/AG | 162465 Number of splices: AT/AC | 13502 Number of splices: Non-canonical | 81916 Mismatch rate per base, % | 1.14% Deletion rate per base | 0.10% Deletion average length | 3.00 Insertion rate per base | 0.07% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621318 % of reads mapped to multiple loci | 3.45% Number of reads mapped to too many loci | 34528 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 509355 509355 509355 N_multimapping 621318 621318 621318 N_noFeature 537618 16678286 647067 N_ambiguous 225301 929 96223 UnstrandedReadsAssigned:16153489 PositiveStrandReadsAssigned:237193 NegativeStrandReadsAssigned:16173118 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR1799551 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799551-trimmed-pair1.fastq SRR1799551-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,029,701 reads, 15,653,650 reads pseudoaligned [quant] estimated average fragment length: 189.88 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR1799551.ke.tsv 34699 SRR1799551.se.tsv 87100 total ==> SRR1799551.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1829.12 1030 41.8565 Potri.005G024800.1.v4.1 1035 846.12 591 51.9186 Potri.004G059700.1.v4.1 961 772.139 18 1.73279 Potri.007G009000.2.v4.1 1416 1227.12 0 0 Potri.003G141000.2.v4.1 2943 2754.12 269.262 7.26708 Potri.016G087400.1.v4.1 270 99.1727 1471 1102.52 Potri.015G069301.1.v4.1 564 375.778 0 0 Potri.010G195200.1.v4.1 1773 1584.12 22.19 1.04121 Potri.012G127500.1.v4.1 977 788.13 2700 254.644 ==> SRR1799551.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1521 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR1799551 completed mapping pipeline successfully