Starting /dee2/code/volunteer_pipeline.sh SRR1799552 current disk space = 3088686608384 free memory = 1507887824 SRR1799552 SRAfilesize c9999b746a9ee07784fdee314de2373b SRR1799552.sra SRR1799552.sra file validated SRR1799552 is paired end SRR1799552 is conventional basespace SRR1799552 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799552_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3615 34.0 34.0 34.0 31.0 34.0 2 33.48325 34.0 34.0 34.0 31.0 34.0 3 33.5265 34.0 34.0 34.0 31.0 34.0 4 36.7295 37.0 37.0 37.0 37.0 37.0 5 36.68025 37.0 37.0 37.0 35.0 37.0 6 36.7365 37.0 37.0 37.0 37.0 37.0 7 36.70275 37.0 37.0 37.0 35.0 37.0 8 36.68275 37.0 37.0 37.0 35.0 37.0 9 38.64475 39.0 39.0 39.0 38.0 39.0 10-14 38.93065 39.4 39.2 39.4 38.0 39.4 15-19 40.26819999999999 41.0 40.0 41.0 38.8 41.0 20-24 40.174850000000006 41.0 40.0 41.0 38.6 41.0 25-29 40.08285 41.0 40.0 41.0 38.0 41.0 30-34 39.9092 41.0 40.0 41.0 38.0 41.0 35-39 39.759249999999994 41.0 40.0 41.0 38.0 41.0 40-44 39.724 41.0 40.0 41.0 38.0 41.0 45-49 39.8767 41.0 40.0 41.0 38.0 41.0 50-54 39.71365 41.0 40.0 41.0 37.4 41.0 55-59 39.426849999999995 41.0 39.0 41.0 36.4 41.0 60-64 38.9056 40.2 38.2 41.0 35.2 41.0 65-69 38.1483 39.2 36.4 41.0 35.0 41.0 70-74 37.1212 37.6 35.4 39.4 34.4 41.0 75-79 35.698449999999994 36.0 34.8 37.4 33.2 39.4 80-84 35.266999999999996 35.2 35.0 36.6 34.0 37.8 85-89 34.722950000000004 35.0 35.0 35.8 34.0 36.6 90-94 34.37904999999999 35.0 35.0 35.0 33.4 36.0 95-99 34.200849999999996 35.0 35.0 35.0 33.0 35.4 100-104 34.096 35.0 35.0 35.0 33.0 35.0 105-109 34.0379 35.0 34.8 35.0 33.0 35.0 110-114 33.86065 35.0 34.0 35.0 32.0 35.0 115-119 33.78565 35.0 34.0 35.0 32.0 35.0 120-124 33.5756 35.0 34.0 35.0 31.4 35.0 125-129 33.427800000000005 35.0 34.0 35.0 31.0 35.0 130-134 33.214800000000004 35.0 34.0 35.0 30.6 35.0 135-139 32.90325 35.0 34.0 35.0 30.0 35.0 140-144 32.527499999999996 35.0 33.2 35.0 29.4 35.0 145-149 31.83245 34.2 33.0 35.0 27.4 35.0 150 25.3155 31.0 19.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 1.0 8 1.0 9 3.0 10 1.0 11 2.0 12 2.0 13 1.0 14 1.0 15 4.0 16 1.0 17 2.0 18 2.0 19 0.0 20 3.0 21 5.0 22 3.0 23 5.0 24 6.0 25 4.0 26 11.0 27 9.0 28 20.0 29 21.0 30 24.0 31 37.0 32 57.0 33 79.0 34 145.0 35 320.0 36 1158.0 37 2042.0 38 27.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.7229882175984 10.679368262722488 6.9691652043118575 37.62847831536726 2 23.325000000000003 13.55 34.125 28.999999999999996 3 18.9 16.775000000000002 25.825 38.5 4 24.075 25.424999999999997 22.35 28.15 5 23.925 30.375000000000004 24.675 21.025 6 19.125 34.075 24.825 21.975 7 14.625 27.35 40.425 17.599999999999998 8 16.375 26.575 32.425 24.625 9 17.150000000000002 25.0 34.125 23.724999999999998 10-14 19.455 30.25 27.500000000000004 22.795 15-19 19.74 28.555000000000003 27.6 24.104999999999997 20-24 20.36 28.12 28.110000000000003 23.41 25-29 19.805 29.37 26.945000000000004 23.880000000000003 30-34 19.71 29.134999999999998 27.51 23.645 35-39 19.625 28.485 27.245 24.645 40-44 19.919999999999998 29.485 27.250000000000004 23.345 45-49 19.814999999999998 29.195 27.41 23.580000000000002 50-54 20.54 28.57 27.255000000000003 23.635 55-59 20.465 29.39 27.189999999999998 22.955000000000002 60-64 20.125 28.955 27.405 23.515 65-69 20.09 28.77 27.88 23.26 70-74 19.54 29.455 27.46 23.544999999999998 75-79 19.775000000000002 29.330000000000002 27.425 23.47 80-84 20.1 28.12 27.500000000000004 24.279999999999998 85-89 20.48 28.93 27.495000000000005 23.095 90-94 20.286014300715035 28.621431071553577 27.50637531876594 23.58617930896545 95-99 20.306015300765036 28.911445572278616 26.986349317465873 23.796189809490475 100-104 20.146007300365017 29.361468073403667 27.231361568078405 23.26116305815291 105-109 20.395 28.93 26.91 23.765 110-114 21.019203840768153 29.160832166433288 26.590318063612724 23.22964592918584 115-119 20.402040204020402 29.002900290029004 27.32773277327733 23.26732673267327 120-124 21.02 28.37 27.005000000000003 23.605 125-129 20.86 27.83 27.36 23.95 130-134 20.985 28.64 27.0 23.375 135-139 21.754350870174036 29.100820164032807 26.380276055211045 22.76455291058212 140-144 21.486074303715185 29.016450822541128 26.041302065103256 23.45617280864043 145-149 21.65 29.165000000000003 25.505 23.68 150 17.349999999999998 30.55 25.35 26.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 0.5 27 4.5 28 9.0 29 16.5 30 26.0 31 27.0 32 32.5 33 51.0 34 57.5 35 65.0 36 88.5 37 106.5 38 127.5 39 154.5 40 180.0 41 212.5 42 252.0 43 268.5 44 272.0 45 267.0 46 257.5 47 251.0 48 239.5 49 210.5 50 169.5 51 148.0 52 122.0 53 90.0 54 78.0 55 63.0 56 42.0 57 28.5 58 19.0 59 12.5 60 7.0 61 7.0 62 7.0 63 5.5 64 3.5 65 3.5 66 2.0 67 1.0 68 1.5 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.005 100-104 0.005 105-109 0.0 110-114 0.02 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 2.2874999999999996 0.0 0.0 0.0 0.0 118-119 2.525 0.0 0.0 0.0 0.0 120-121 2.7125000000000004 0.0 0.0 0.0 0.0 122-123 3.025 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.325 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 6.425000000000001 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTGAC 10 0.006973645 144.0 6 ATATCAA 10 0.006973645 144.0 6 AGATATC 10 0.006973645 144.0 4 AGATCGG 50 0.0013929702 17.279999 140-144 GATCGGA 55 0.0026350126 15.709091 140-144 >>END_MODULE SRR1799552 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799552_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7865 34.0 33.0 34.0 31.0 34.0 2 32.903 34.0 34.0 34.0 31.0 34.0 3 32.914 34.0 34.0 34.0 31.0 34.0 4 36.05925 37.0 37.0 37.0 35.0 37.0 5 36.09325 37.0 37.0 37.0 35.0 37.0 6 36.12375 37.0 37.0 37.0 35.0 37.0 7 36.13075 37.0 37.0 37.0 35.0 37.0 8 36.116 37.0 37.0 37.0 35.0 37.0 9 37.98575 39.0 39.0 39.0 37.0 39.0 10-14 38.27765 39.4 39.2 39.4 37.2 39.4 15-19 39.59145 41.0 40.0 41.0 38.0 41.0 20-24 39.55335 41.0 40.0 41.0 38.0 41.0 25-29 39.4214 41.0 40.0 41.0 38.0 41.0 30-34 39.29535 41.0 40.0 41.0 38.0 41.0 35-39 39.13675 41.0 40.0 41.0 37.0 41.0 40-44 39.074 41.0 40.0 41.0 37.0 41.0 45-49 38.998200000000004 41.0 39.8 41.0 36.6 41.0 50-54 38.1006 39.8 38.4 40.6 35.0 40.8 55-59 38.39705 40.0 38.4 41.0 35.0 41.0 60-64 37.778999999999996 39.6 37.2 41.0 34.2 41.0 65-69 37.31155 39.0 36.2 41.0 34.2 41.0 70-74 36.278600000000004 37.2 35.0 39.2 34.0 41.0 75-79 35.2146 35.8 35.0 37.6 33.8 39.2 80-84 34.3856 35.0 35.0 36.4 33.0 37.4 85-89 33.81575 35.0 35.0 35.4 32.6 36.4 90-94 33.527249999999995 35.0 35.0 35.0 32.2 36.0 95-99 33.355450000000005 35.0 35.0 35.0 31.8 35.2 100-104 33.25940000000001 35.0 34.2 35.0 31.2 35.0 105-109 33.2005 35.0 34.0 35.0 31.2 35.0 110-114 33.03509999999999 35.0 34.0 35.0 30.8 35.0 115-119 32.8678 35.0 34.0 35.0 30.4 35.0 120-124 32.73135 35.0 34.0 35.0 29.6 35.0 125-129 32.50345 35.0 34.0 35.0 29.0 35.0 130-134 32.25789999999999 35.0 33.4 35.0 29.0 35.0 135-139 32.00685 35.0 33.0 35.0 27.4 35.0 140-144 31.64285 35.0 33.0 35.0 26.2 35.0 145-149 30.898200000000003 34.0 32.0 35.0 22.2 35.0 150 27.09 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 56.0 3 4.0 4 1.0 5 5.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 4.0 12 5.0 13 2.0 14 6.0 15 4.0 16 4.0 17 7.0 18 5.0 19 4.0 20 4.0 21 5.0 22 10.0 23 3.0 24 6.0 25 8.0 26 11.0 27 16.0 28 23.0 29 18.0 30 37.0 31 50.0 32 63.0 33 86.0 34 148.0 35 319.0 36 1285.0 37 1752.0 38 44.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 21.15 12.825000000000001 27.275 2 26.625 26.375 30.875000000000004 16.125 3 20.65 27.450000000000003 32.25 19.650000000000002 4 25.25 31.674999999999997 23.474999999999998 19.6 5 25.074999999999996 36.325 23.25 15.35 6 19.975 37.25 24.75 18.025 7 19.425 20.525 40.65 19.400000000000002 8 22.075 24.375 28.075 25.474999999999998 9 22.330582645661416 24.706176544136035 30.732683170792697 22.230557639409852 10-14 23.685000000000002 28.599999999999998 26.46 21.255 15-19 23.515 28.1 27.82 20.565 20-24 23.419999999999998 27.76 27.68 21.14 25-29 23.255 28.970000000000002 27.810000000000002 19.965 30-34 23.412341234123414 28.06780678067807 28.16781678167817 20.35203520352035 35-39 23.400000000000002 28.62 27.665 20.315 40-44 23.435 27.565 28.275 20.724999999999998 45-49 23.26116305815291 27.481374068703435 28.271413570678533 20.986049302465123 50-54 22.96114805740287 28.261413070653536 27.861393069653484 20.916045802290114 55-59 23.57 27.925 27.865000000000002 20.64 60-64 23.74 27.560000000000002 28.425 20.275000000000002 65-69 23.665 27.529999999999998 28.365000000000002 20.44 70-74 23.771188559427973 27.67638381919096 28.23141157057853 20.32101605080254 75-79 22.865 27.52 28.62 20.995 80-84 23.16 27.215 28.625 21.0 85-89 23.971198559928 27.05635281764088 28.916445822291116 20.056002800140007 90-94 23.06 27.79 28.68 20.47 95-99 23.31 27.845 28.38 20.465 100-104 23.47 27.425 28.835 20.27 105-109 23.494999999999997 28.050000000000004 28.294999999999998 20.16 110-114 24.135 27.529999999999998 28.255000000000003 20.080000000000002 115-119 24.01 27.925 27.775 20.29 120-124 23.92858928839326 27.45411811771766 28.399259888983348 20.218032704905735 125-129 24.216210810540527 27.881394069703486 27.9813990699535 19.92099604980249 130-134 24.491224561228062 27.76138806940347 28.07640382019101 19.67098354917746 135-139 24.921246062303116 27.91639581979099 27.571378568928445 19.59097954897745 140-144 25.73014602920584 27.970594118823765 27.000400080016 19.29885977195439 145-149 26.36659164791198 27.451862965741437 26.461615403850963 19.719929982495625 150 25.625625625625624 27.627627627627625 26.776776776776778 19.96996996996997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 1.5 21 1.0 22 2.0 23 2.0 24 3.5 25 4.5 26 3.5 27 5.0 28 6.0 29 10.0 30 19.0 31 24.5 32 29.5 33 41.5 34 54.0 35 70.5 36 84.0 37 115.0 38 144.5 39 152.0 40 181.0 41 228.5 42 256.5 43 248.5 44 256.0 45 279.0 46 272.5 47 254.5 48 238.5 49 203.5 50 166.0 51 143.0 52 123.0 53 92.5 54 68.0 55 50.0 56 32.5 57 29.5 58 23.5 59 16.0 60 13.5 61 11.0 62 8.0 63 6.5 64 3.5 65 1.5 66 1.5 67 1.5 68 2.0 69 1.5 70 0.5 71 1.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.005 130-134 0.005 135-139 0.005 140-144 0.02 145-149 0.025 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 6.5125 0.0 0.0 0.0 0.0 136-137 7.475 0.0 0.0 0.0 0.0 138 8.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCAA 10 0.006973645 144.0 5 TATCAAT 10 0.006973645 144.0 6 AAGGAAA 10 0.006973645 144.0 1 >>END_MODULE Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162685 spots for SRR1799552.sra Written 1162685 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra Read 1162666 spots for SRR1799552.sra Written 1162666 spots for SRR1799552.sra SRR ids: ['SRR1799552.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0w6xd_sn SRR1799552.sra spots: 23253339 blocks: [[1, 1162666], [1162667, 2325332], [2325333, 3487998], [3487999, 4650664], [4650665, 5813330], [5813331, 6975996], [6975997, 8138662], [8138663, 9301328], [9301329, 10463994], [10463995, 11626660], [11626661, 12789326], [12789327, 13951992], [13951993, 15114658], [15114659, 16277324], [16277325, 17439990], [17439991, 18602656], [18602657, 19765322], [19765323, 20927988], [20927989, 22090654], [22090655, 23253339]] SRR1799552 file size 7812676 SRR1799552 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799552 SRR1799552_1.fastq SRR1799552_2.fastq Input file: SRR1799552_1.fastq Paired file: SRR1799552_2.fastq trimmed: SRR1799552-trimmed-pair1.fastq, SRR1799552-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:29:37 2025 >> started Thu Feb 13 22:30:03 2025 >> done (26.655s) 23253339 read pairs processed; of these: 71969 ( 0.31%) short read pairs filtered out after trimming by size control 261430 ( 1.12%) empty read pairs filtered out after trimming by size control 22919940 (98.57%) read pairs available; of these: 8048476 (35.12%) trimmed read pairs available after processing 14871464 (64.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 9 0.00% 21 8 0.00% 22 9 0.00% 23 15 0.00% 24 22 0.00% 25 42 0.00% 26 38 0.00% 27 52 0.00% 28 68 0.00% 29 85 0.00% 30 104 0.00% 31 119 0.00% 32 137 0.00% 33 165 0.00% 34 190 0.00% 35 233 0.00% 36 246 0.00% 37 264 0.00% 38 308 0.00% 39 330 0.00% 40 343 0.00% 41 400 0.00% 42 431 0.00% 43 451 0.00% 44 521 0.00% 45 584 0.00% 46 641 0.00% 47 723 0.00% 48 742 0.00% 49 790 0.00% 50 871 0.00% 51 932 0.00% 52 1009 0.00% 53 977 0.00% 54 1053 0.00% 55 1235 0.01% 56 1307 0.01% 57 1374 0.01% 58 1562 0.01% 59 1676 0.01% 60 1721 0.01% 61 1933 0.01% 62 2039 0.01% 63 2254 0.01% 64 2513 0.01% 65 2760 0.01% 66 3503 0.02% 67 3810 0.02% 68 3542 0.02% 69 3835 0.02% 70 4098 0.02% 71 4428 0.02% 72 4577 0.02% 73 4606 0.02% 74 4497 0.02% 75 4188 0.02% 76 4052 0.02% 77 3792 0.02% 78 3702 0.02% 79 3842 0.02% 80 4024 0.02% 81 4186 0.02% 82 4545 0.02% 83 5171 0.02% 84 10060 0.04% 85 10877 0.05% 86 14153 0.06% 87 14143 0.06% 88 13739 0.06% 89 13772 0.06% 90 18982 0.08% 91 17892 0.08% 92 15553 0.07% 93 15132 0.07% 94 15779 0.07% 95 16665 0.07% 96 21795 0.10% 97 42692 0.19% 98 20667 0.09% 99 18711 0.08% 100 22461 0.10% 101 36885 0.16% 102 27134 0.12% 103 24951 0.11% 104 61226 0.27% 105 29600 0.13% 106 23622 0.10% 107 36162 0.16% 108 39744 0.17% 109 19650 0.09% 110 17134 0.07% 111 17201 0.08% 112 22663 0.10% 113 21948 0.10% 114 47409 0.21% 115 124716 0.54% 116 49742 0.22% 117 39664 0.17% 118 24620 0.11% 119 46068 0.20% 120 116942 0.51% 121 63320 0.28% 122 25352 0.11% 123 21287 0.09% 124 28883 0.13% 125 47063 0.21% 126 28296 0.12% 127 26431 0.12% 128 35942 0.16% 129 131648 0.57% 130 88119 0.38% 131 87415 0.38% 132 159977 0.70% 133 166823 0.73% 134 157115 0.69% 135 143268 0.63% 136 174499 0.76% 137 187602 0.82% 138 191896 0.84% 139 204724 0.89% 140 208563 0.91% 141 217460 0.95% 142 225332 0.98% 143 237085 1.03% 144 258123 1.13% 145 281323 1.23% 146 318044 1.39% 147 408128 1.78% 148 589331 2.57% 149 2097581 9.15% 150 14871464 64.88% 22919940 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=126.09 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=17.7 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.3 sequence=AGTTCCAATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=6 fanout-score=48.43 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.4 sequence=TGTTGGTGGTGG SRR1799552 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:30:44 Started mapping on | Feb 13 22:30:45 Finished on | Feb 13 22:32:47 Mapping speed, Million of reads per hour | 676.33 Number of input reads | 22919940 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22204795 Uniquely mapped reads % | 96.88% Average mapped length | 290.12 Number of splices: Total | 19170926 Number of splices: Annotated (sjdb) | 18832174 Number of splices: GT/AG | 18887551 Number of splices: GC/AG | 224181 Number of splices: AT/AC | 15718 Number of splices: Non-canonical | 43476 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394103 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 29540 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.24% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 344791 344791 344791 N_multimapping 394103 394103 394103 N_noFeature 665956 21932724 813386 N_ambiguous 219398 1380 93755 UnstrandedReadsAssigned:21319441 PositiveStrandReadsAssigned:270691 NegativeStrandReadsAssigned:21297654 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR1799552 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799552-trimmed-pair1.fastq SRR1799552-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,919,940 reads, 21,210,567 reads pseudoaligned [quant] estimated average fragment length: 202.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52401 SRR1799552.ke.tsv 34699 SRR1799552.se.tsv 87100 total ==> SRR1799552.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.79 459 12.8571 Potri.005G024800.1.v4.1 1035 833.79 26 1.58691 Potri.004G059700.1.v4.1 961 759.796 9 0.602812 Potri.007G009000.2.v4.1 1416 1214.79 0 0 Potri.003G141000.2.v4.1 2943 2741.79 432.042 8.01915 Potri.016G087400.1.v4.1 270 92.124 2013.99 1112.55 Potri.015G069301.1.v4.1 564 363.811 0 0 Potri.010G195200.1.v4.1 1773 1571.79 67 2.16929 Potri.012G127500.1.v4.1 977 775.79 3807 249.733 ==> SRR1799552.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2906 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 378 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR1799552 completed mapping pipeline successfully