Starting /dee2/code/volunteer_pipeline.sh SRR1799553 current disk space = 3088665006080 free memory = 1580036232 SRR1799553 SRAfilesize 847099f11a338b51aced9a3499f33841 SRR1799553.sra SRR1799553.sra file validated SRR1799553 is paired end SRR1799553 is conventional basespace SRR1799553 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799553_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.347 34.0 34.0 34.0 31.0 34.0 2 33.4155 34.0 34.0 34.0 31.0 34.0 3 33.52725 34.0 34.0 34.0 31.0 34.0 4 36.71425 37.0 37.0 37.0 35.0 37.0 5 36.69175 37.0 37.0 37.0 35.0 37.0 6 36.718 37.0 37.0 37.0 35.0 37.0 7 36.71075 37.0 37.0 37.0 36.0 37.0 8 36.547 37.0 37.0 37.0 35.0 37.0 9 38.558 39.0 39.0 39.0 37.0 39.0 10-14 38.9149 39.4 39.2 39.4 38.0 39.4 15-19 40.2286 41.0 40.0 41.0 38.4 41.0 20-24 40.23945 41.0 40.0 41.0 38.8 41.0 25-29 40.11515 41.0 40.0 41.0 38.2 41.0 30-34 39.953250000000004 41.0 40.0 41.0 38.0 41.0 35-39 39.7747 41.0 40.0 41.0 38.0 41.0 40-44 39.818349999999995 41.0 40.0 41.0 38.0 41.0 45-49 39.95075 41.0 40.0 41.0 38.0 41.0 50-54 39.79475 41.0 40.0 41.0 37.4 41.0 55-59 39.4631 41.0 39.0 41.0 36.4 41.0 60-64 38.94345 40.4 38.2 41.0 35.0 41.0 65-69 38.151050000000005 39.2 36.6 41.0 35.0 41.0 70-74 37.09035 37.2 35.2 39.4 34.6 41.0 75-79 35.67915000000001 36.0 34.8 37.4 33.2 39.4 80-84 35.273399999999995 35.0 35.0 36.4 34.0 37.8 85-89 34.7076 35.0 35.0 35.6 33.8 36.6 90-94 34.3676 35.0 35.0 35.0 33.0 36.0 95-99 34.18705 35.0 35.0 35.0 33.0 35.2 100-104 34.1271 35.0 35.0 35.0 33.0 35.0 105-109 34.06895 35.0 35.0 35.0 33.0 35.0 110-114 33.914300000000004 35.0 34.6 35.0 32.6 35.0 115-119 33.7658 35.0 34.0 35.0 32.0 35.0 120-124 33.592949999999995 35.0 34.0 35.0 31.4 35.0 125-129 33.4942 35.0 34.0 35.0 31.0 35.0 130-134 33.25495 35.0 34.0 35.0 30.8 35.0 135-139 32.93845 35.0 34.0 35.0 30.0 35.0 140-144 32.80035 35.0 33.8 35.0 29.8 35.0 145-149 32.1524 35.0 33.0 35.0 29.0 35.0 150 26.2265 32.0 23.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 4.0 16 0.0 17 1.0 18 4.0 19 4.0 20 3.0 21 3.0 22 2.0 23 4.0 24 8.0 25 11.0 26 11.0 27 13.0 28 16.0 29 16.0 30 29.0 31 42.0 32 65.0 33 80.0 34 122.0 35 278.0 36 1163.0 37 2077.0 38 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.80952380952381 11.578947368421053 6.265664160401002 38.34586466165413 2 22.975 13.900000000000002 35.35 27.775 3 19.950000000000003 17.075000000000003 26.375 36.6 4 23.974999999999998 25.2 22.975 27.85 5 24.275 30.025000000000002 23.7 22.0 6 19.15 36.25 23.150000000000002 21.45 7 15.275 29.15 38.725 16.85 8 16.925 26.450000000000003 31.55 25.074999999999996 9 16.8 24.55 35.825 22.825 10-14 19.455 30.925000000000004 27.295 22.325 15-19 19.650000000000002 29.604999999999997 26.91 23.835 20-24 19.580000000000002 29.549999999999997 27.224999999999998 23.645 25-29 19.225 29.595 27.785 23.395 30-34 19.78 29.24 27.215 23.765 35-39 19.595000000000002 30.085 27.005000000000003 23.315 40-44 19.715 29.459999999999997 27.32 23.505000000000003 45-49 19.759999999999998 29.68 26.595000000000002 23.965 50-54 19.785 29.935000000000002 26.44 23.84 55-59 20.369999999999997 29.675 26.700000000000003 23.255 60-64 19.564999999999998 29.79 27.045 23.599999999999998 65-69 19.919999999999998 29.195 27.08 23.805 70-74 20.385 29.54 26.615 23.46 75-79 19.665 29.29 27.58 23.465 80-84 20.45 29.13 26.784999999999997 23.635 85-89 19.73 29.625 26.87 23.775 90-94 20.23202320232023 28.872887288728872 26.86768676867687 24.027402740274027 95-99 20.46306946041906 28.534280142021302 27.224083612541882 23.778566785017752 100-104 20.397039703970396 29.122912291229124 26.772677267726774 23.707370737073706 105-109 20.678101715257288 28.66930039505926 26.92403860579087 23.728559283892583 110-114 20.69827931172469 29.26670668267307 26.66066426570628 23.37434973989596 115-119 20.717251037863253 29.220227079477816 26.519281748612016 23.54324013404692 120-124 20.485 28.64 26.590000000000003 24.285 125-129 20.62 28.74 26.619999999999997 24.02 130-134 20.811040552027603 28.7864393219661 26.036301815090756 24.366218310915546 135-139 20.8723053068574 29.190216575801532 25.724003401190416 24.21347471615065 140-144 20.201010050502525 28.191409570478527 26.736336816840844 24.87124356217811 145-149 21.154999999999998 27.779999999999998 26.009999999999998 25.055 150 15.975 29.975 26.1 27.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.0 26 1.5 27 7.0 28 13.5 29 19.0 30 25.0 31 30.0 32 42.0 33 57.5 34 62.0 35 80.5 36 97.0 37 103.0 38 130.5 39 161.5 40 192.0 41 210.0 42 232.0 43 252.0 44 258.5 45 261.0 46 253.0 47 246.5 48 232.0 49 212.5 50 181.0 51 143.5 52 125.5 53 98.0 54 63.5 55 48.5 56 36.5 57 29.0 58 22.0 59 15.5 60 16.0 61 9.5 62 3.0 63 3.5 64 5.5 65 4.0 66 2.5 67 2.0 68 1.5 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.015 100-104 0.01 105-109 0.015 110-114 0.04 115-119 0.034999999999999996 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.034999999999999996 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.5 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.1625 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.6 0.0 0.0 0.0 0.0 104-105 3.175 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 4.1125 0.0 0.0 0.0 0.0 110-111 4.6875 0.0 0.0 0.0 0.0 112-113 4.9375 0.0 0.0 0.0 0.0 114-115 5.4625 0.0 0.0 0.0 0.0 116-117 6.0375 0.0 0.0 0.0 0.0 118-119 6.825 0.0 0.0 0.0 0.0 120-121 7.4125 0.0 0.0 0.0 0.0 122-123 8.025 0.0 0.0 0.0 0.0 124-125 8.7875 0.0 0.0 0.0 0.0 126-127 9.524999999999999 0.0 0.0 0.0 0.0 128-129 10.35 0.0 0.0 0.0 0.0 130-131 11.3 0.0 0.0 0.0 0.0 132-133 12.2875 0.0 0.0 0.0 0.0 134-135 13.0 0.0 0.0 0.0 0.0 136-137 13.7125 0.0 0.0 0.0 0.0 138 14.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGCT 10 0.006973645 144.0 1 GCTGCCT 10 0.006973645 144.0 2 CACACGT 65 0.007995365 13.292308 140-144 AAGAGCA 65 0.007995365 13.292308 135-139 >>END_MODULE SRR1799553 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799553_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.689 34.0 33.0 34.0 31.0 34.0 2 32.81275 34.0 33.0 34.0 31.0 34.0 3 32.90275 34.0 34.0 34.0 31.0 34.0 4 36.18 37.0 37.0 37.0 35.0 37.0 5 36.17475 37.0 37.0 37.0 35.0 37.0 6 36.1905 37.0 37.0 37.0 35.0 37.0 7 36.14125 37.0 37.0 37.0 35.0 37.0 8 36.04675 37.0 37.0 37.0 35.0 37.0 9 37.98075 39.0 39.0 39.0 37.0 39.0 10-14 38.28589999999999 39.4 39.2 39.4 37.2 39.4 15-19 39.58445 41.0 40.0 41.0 38.0 41.0 20-24 39.55455 41.0 40.0 41.0 38.0 41.0 25-29 39.4424 41.0 40.0 41.0 38.0 41.0 30-34 39.3132 41.0 40.0 41.0 38.0 41.0 35-39 39.1361 41.0 40.0 41.0 37.0 41.0 40-44 39.033500000000004 41.0 39.8 41.0 37.0 41.0 45-49 38.915049999999994 41.0 39.6 41.0 36.4 41.0 50-54 38.042 39.8 38.2 40.6 34.8 40.6 55-59 38.3471 40.0 38.2 41.0 35.0 41.0 60-64 37.72520000000001 39.8 37.2 41.0 34.0 41.0 65-69 37.300999999999995 39.0 36.2 41.0 34.2 41.0 70-74 36.33055 37.2 35.0 39.4 34.0 41.0 75-79 35.275150000000004 35.8 35.0 37.8 33.0 39.2 80-84 34.421200000000006 35.0 35.0 36.4 32.8 37.8 85-89 33.867900000000006 35.0 35.0 35.6 32.2 36.4 90-94 33.545249999999996 35.0 35.0 35.0 32.0 36.0 95-99 33.3317 35.0 34.4 35.0 31.6 35.4 100-104 33.19095 35.0 34.0 35.0 31.2 35.0 105-109 33.042100000000005 35.0 34.0 35.0 30.8 35.0 110-114 32.911750000000005 35.0 34.0 35.0 30.2 35.0 115-119 32.69025 35.0 34.0 35.0 29.4 35.0 120-124 32.52405 35.0 34.0 35.0 29.2 35.0 125-129 32.3067 35.0 33.4 35.0 29.0 35.0 130-134 32.005649999999996 35.0 33.0 35.0 27.0 35.0 135-139 31.56485 34.6 32.6 35.0 25.4 35.0 140-144 31.17425 34.0 32.0 35.0 24.4 35.0 145-149 30.322950000000002 34.0 31.2 35.0 16.6 35.0 150 26.55975 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 0.0 4 0.0 5 3.0 6 2.0 7 3.0 8 2.0 9 1.0 10 4.0 11 3.0 12 5.0 13 7.0 14 2.0 15 4.0 16 3.0 17 6.0 18 6.0 19 5.0 20 6.0 21 4.0 22 5.0 23 7.0 24 9.0 25 14.0 26 10.0 27 15.0 28 20.0 29 32.0 30 38.0 31 47.0 32 77.0 33 94.0 34 180.0 35 373.0 36 1261.0 37 1664.0 38 34.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 18.075 12.225 28.325 2 26.075 24.425 33.050000000000004 16.45 3 20.200000000000003 26.35 33.225 20.225 4 24.55 32.800000000000004 24.099999999999998 18.55 5 25.75 35.425000000000004 23.075000000000003 15.75 6 20.525 37.75 23.125 18.6 7 21.125 20.5 40.0 18.375 8 22.6 24.05 30.625000000000004 22.725 9 23.15578894723681 23.53088272068017 30.457614403600903 22.85571392848212 10-14 24.191209560478026 29.27646382319116 26.48632431621581 20.046002300115006 15-19 23.735 27.415 27.889999999999997 20.96 20-24 23.955000000000002 27.72 27.985 20.34 25-29 23.52 27.67 28.275 20.535 30-34 23.037303730373036 27.45274527452745 28.537853785378537 20.97209720972097 35-39 23.31 27.375 28.84 20.474999999999998 40-44 23.461173058652932 27.12635631781589 29.10145507275364 20.31101555077754 45-49 23.89836442754964 26.914420047016456 28.820087030460662 20.36712849497324 50-54 23.524704940988197 27.60552110422084 28.400680136027205 20.469093818763753 55-59 24.021201060053002 27.33136656832842 28.581429071453574 20.066003300165008 60-64 23.792379237923793 27.687768776877686 28.11781178117812 20.402040204020402 65-69 23.622362236223623 27.3977397739774 28.802880288028803 20.17701770177018 70-74 24.023408192867503 27.689691391987196 27.864752663432203 20.422147751713098 75-79 23.380000000000003 27.345000000000002 28.335 20.94 80-84 24.185000000000002 27.215 28.32 20.28 85-89 23.717371737173718 27.37273727372737 28.83788378837884 20.072007200720073 90-94 24.3 27.04 28.470000000000002 20.19 95-99 23.54 27.99 28.28 20.19 100-104 23.965 26.68 28.65 20.705000000000002 105-109 23.755000000000003 27.38 28.660000000000004 20.205000000000002 110-114 24.25 27.815 27.800000000000004 20.135 115-119 24.725 28.015 27.985 19.275000000000002 120-124 25.150030006001202 27.170434086817362 27.945589117823566 19.733946789357873 125-129 25.37626881344067 27.69638481924096 27.751387569378466 19.175958797939895 130-134 25.418812821923286 27.85417812671901 27.604140621093165 19.12286843026454 135-139 26.226311315565777 27.36136806840342 27.561378068903448 18.850942547127357 140-144 26.507952385715715 27.323196959087724 26.868060418125438 19.300790237071123 145-149 26.89151321056846 27.301841473178545 27.19175340272218 18.614891913530823 150 26.55155155155155 26.776776776776778 27.602602602602605 19.06906906906907 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 1.5 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 2.0 26 5.5 27 9.0 28 9.5 29 12.0 30 16.5 31 19.5 32 25.0 33 34.0 34 43.0 35 63.5 36 82.5 37 104.5 38 130.5 39 156.0 40 185.0 41 219.0 42 248.0 43 254.5 44 275.0 45 289.5 46 274.0 47 262.5 48 253.0 49 213.0 50 169.0 51 140.5 52 120.5 53 98.5 54 73.5 55 60.0 56 40.5 57 26.0 58 19.0 59 14.0 60 10.5 61 8.5 62 7.0 63 2.5 64 1.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 1.5 72 2.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.005 45-49 0.034999999999999996 50-54 0.02 55-59 0.005 60-64 0.01 65-69 0.01 70-74 0.034999999999999996 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.005 130-134 0.015 135-139 0.005 140-144 0.03 145-149 0.08 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.5125000000000002 0.0 0.0 0.0 0.0 96-97 1.95 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.3499999999999996 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 3.175 0.0 0.0 0.0 0.0 106-107 3.5875000000000004 0.0 0.0 0.0 0.0 108-109 4.0625 0.0 0.0 0.0 0.0 110-111 4.637499999999999 0.0 0.0 0.0 0.0 112-113 4.875 0.0 0.0 0.0 0.0 114-115 5.387499999999999 0.0 0.0 0.0 0.0 116-117 5.987500000000001 0.0 0.0 0.0 0.0 118-119 6.8 0.0 0.0 0.0 0.0 120-121 7.425 0.0 0.0 0.0 0.0 122-123 8.05 0.0 0.0 0.0 0.0 124-125 8.8125 0.0 0.0 0.0 0.0 126-127 9.5375 0.0 0.0 0.0 0.0 128-129 10.375 0.0 0.0 0.0 0.0 130-131 11.325 0.0 0.0 0.0 0.0 132-133 12.2875 0.0 0.0 0.0 0.0 134-135 13.0 0.0 0.0 0.0 0.0 136-137 13.75 0.0 0.0 0.0 0.0 138 14.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGTG 10 0.006973645 144.0 6 AGTTTGT 10 0.006973645 144.0 5 AAGTTTG 10 0.006973645 144.0 4 AAGAGCG 60 0.0047032754 14.4 135-139 CGTCGTG 60 0.0047032754 14.4 140-144 >>END_MODULE Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108234 spots for SRR1799553.sra Written 1108234 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra Read 1108225 spots for SRR1799553.sra Written 1108225 spots for SRR1799553.sra SRR ids: ['SRR1799553.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__88g3h1h SRR1799553.sra spots: 22164509 blocks: [[1, 1108225], [1108226, 2216450], [2216451, 3324675], [3324676, 4432900], [4432901, 5541125], [5541126, 6649350], [6649351, 7757575], [7757576, 8865800], [8865801, 9974025], [9974026, 11082250], [11082251, 12190475], [12190476, 13298700], [13298701, 14406925], [14406926, 15515150], [15515151, 16623375], [16623376, 17731600], [17731601, 18839825], [18839826, 19948050], [19948051, 21056275], [21056276, 22164509]] SRR1799553 file size 7445834 SRR1799553 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799553 SRR1799553_1.fastq SRR1799553_2.fastq Input file: SRR1799553_1.fastq Paired file: SRR1799553_2.fastq trimmed: SRR1799553-trimmed-pair1.fastq, SRR1799553-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:35:16 2025 >> started Thu Feb 13 22:35:41 2025 >> done (24.095s) 22164509 read pairs processed; of these: 63290 ( 0.29%) short read pairs filtered out after trimming by size control 177762 ( 0.80%) empty read pairs filtered out after trimming by size control 21923457 (98.91%) read pairs available; of these: 8540415 (38.96%) trimmed read pairs available after processing 13383042 (61.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 7 0.00% 21 12 0.00% 22 17 0.00% 23 18 0.00% 24 29 0.00% 25 48 0.00% 26 52 0.00% 27 61 0.00% 28 73 0.00% 29 104 0.00% 30 115 0.00% 31 143 0.00% 32 179 0.00% 33 237 0.00% 34 259 0.00% 35 280 0.00% 36 351 0.00% 37 364 0.00% 38 411 0.00% 39 439 0.00% 40 494 0.00% 41 526 0.00% 42 621 0.00% 43 679 0.00% 44 761 0.00% 45 790 0.00% 46 940 0.00% 47 1001 0.00% 48 1148 0.01% 49 1121 0.01% 50 1283 0.01% 51 1342 0.01% 52 1477 0.01% 53 1558 0.01% 54 1705 0.01% 55 1828 0.01% 56 2039 0.01% 57 2385 0.01% 58 3123 0.01% 59 3757 0.02% 60 2826 0.01% 61 3064 0.01% 62 3297 0.02% 63 3882 0.02% 64 4128 0.02% 65 4537 0.02% 66 6519 0.03% 67 7062 0.03% 68 5887 0.03% 69 6289 0.03% 70 6811 0.03% 71 7704 0.04% 72 8532 0.04% 73 9603 0.04% 74 10335 0.05% 75 10971 0.05% 76 11179 0.05% 77 10885 0.05% 78 10766 0.05% 79 9926 0.05% 80 8895 0.04% 81 8263 0.04% 82 8002 0.04% 83 8012 0.04% 84 12500 0.06% 85 13548 0.06% 86 15558 0.07% 87 18437 0.08% 88 22352 0.10% 89 27983 0.13% 90 36367 0.17% 91 38159 0.17% 92 35447 0.16% 93 46057 0.21% 94 58411 0.27% 95 54295 0.25% 96 62833 0.29% 97 64668 0.29% 98 42151 0.19% 99 41605 0.19% 100 43688 0.20% 101 48352 0.22% 102 51531 0.24% 103 71741 0.33% 104 73685 0.34% 105 70863 0.32% 106 68890 0.31% 107 75751 0.35% 108 71887 0.33% 109 84996 0.39% 110 66612 0.30% 111 63059 0.29% 112 68903 0.31% 113 70673 0.32% 114 75105 0.34% 115 94212 0.43% 116 92133 0.42% 117 98047 0.45% 118 93915 0.43% 119 90510 0.41% 120 95324 0.43% 121 98089 0.45% 122 97007 0.44% 123 94829 0.43% 124 99319 0.45% 125 98345 0.45% 126 101791 0.46% 127 111742 0.51% 128 105736 0.48% 129 113534 0.52% 130 118484 0.54% 131 118500 0.54% 132 122071 0.56% 133 126058 0.57% 134 130988 0.60% 135 134407 0.61% 136 136608 0.62% 137 141403 0.64% 138 146621 0.67% 139 150893 0.69% 140 155625 0.71% 141 163671 0.75% 142 171489 0.78% 143 184829 0.84% 144 205481 0.94% 145 227149 1.04% 146 277124 1.26% 147 344421 1.57% 148 502712 2.29% 149 1692081 7.72% 150 13383042 61.04% 21923457 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.1 sequence=CGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGGCAGTCAAAGATGAGATCACCTGAGAAACAAGGCGGTTAAGATTGGTGTAAGTGGGACGCTCAATGTCAAGAGAGCGCCTGCAAATGTCATAGATGGCCTCATTGTCAAGGAGCACAGCAACATCAGTATGCTCAAGGAGAGAGTGAGTTGAAAGGACACTGTTGTAGGGCTCTACAACTGATGTGGAAACTTGCGGGGATGGATATACAGTGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=351.14 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.8 sequence=GAATCTTGCATGTCTAGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=60.87 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.1 sequence=TGTTGGTGGTGG SRR1799553 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:36:21 Started mapping on | Feb 13 22:36:21 Finished on | Feb 13 22:37:50 Mapping speed, Million of reads per hour | 886.79 Number of input reads | 21923457 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 21281581 Uniquely mapped reads % | 97.07% Average mapped length | 284.10 Number of splices: Total | 17329699 Number of splices: Annotated (sjdb) | 17018257 Number of splices: GT/AG | 17062803 Number of splices: GC/AG | 204938 Number of splices: AT/AC | 15712 Number of splices: Non-canonical | 46246 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.04% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434228 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 30920 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 228825 228825 228825 N_multimapping 434228 434228 434228 N_noFeature 583507 20935077 779443 N_ambiguous 235100 1781 83140 UnstrandedReadsAssigned:20462974 PositiveStrandReadsAssigned:344723 NegativeStrandReadsAssigned:20418998 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR1799553 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799553-trimmed-pair1.fastq SRR1799553-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,923,457 reads, 20,369,423 reads pseudoaligned [quant] estimated average fragment length: 197.035 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR1799553.ke.tsv 34699 SRR1799553.se.tsv 87100 total ==> SRR1799553.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.97 484 13.7969 Potri.005G024800.1.v4.1 1035 838.965 104 6.43823 Potri.004G059700.1.v4.1 961 764.965 28 1.90105 Potri.007G009000.2.v4.1 1416 1219.97 0 0 Potri.003G141000.2.v4.1 2943 2746.97 324.103 6.12783 Potri.016G087400.1.v4.1 270 98.3774 2909 1535.77 Potri.015G069301.1.v4.1 564 368.882 0 0 Potri.010G195200.1.v4.1 1773 1576.97 114 3.75457 Potri.012G127500.1.v4.1 977 780.965 4583 304.786 ==> SRR1799553.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2382 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR1799553 completed mapping pipeline successfully