Starting /dee2/code/volunteer_pipeline.sh SRR1799554 current disk space = 3088654716928 free memory = 1448857616 SRR1799554 SRAfilesize fe2b44b9235388f5674fb5d2f45c5d67 SRR1799554.sra SRR1799554.sra file validated SRR1799554 is paired end SRR1799554 is conventional basespace SRR1799554 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799554_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21875 34.0 33.0 34.0 31.0 34.0 2 32.85225 34.0 34.0 34.0 31.0 34.0 3 33.3045 34.0 34.0 34.0 31.0 34.0 4 36.628 37.0 37.0 37.0 35.0 37.0 5 36.63875 37.0 37.0 37.0 35.0 37.0 6 36.642 37.0 37.0 37.0 35.0 37.0 7 36.6565 37.0 37.0 37.0 35.0 37.0 8 36.66525 37.0 37.0 37.0 35.0 37.0 9 38.60425 39.0 39.0 39.0 38.0 39.0 10-14 38.89975 39.4 39.2 39.4 38.2 39.4 15-19 40.2331 41.0 40.0 41.0 38.4 41.0 20-24 40.213499999999996 41.0 40.0 41.0 38.6 41.0 25-29 40.13355 41.0 40.0 41.0 38.2 41.0 30-34 39.97285 41.0 40.0 41.0 38.0 41.0 35-39 39.8416 41.0 40.0 41.0 38.0 41.0 40-44 39.68805 41.0 40.0 41.0 37.8 41.0 45-49 39.49705000000001 41.0 40.0 41.0 37.0 41.0 50-54 39.25945 40.6 39.0 41.0 36.2 41.0 55-59 38.97065 40.0 38.6 41.0 35.0 41.0 60-64 38.81965 40.0 38.0 41.0 35.0 41.0 65-69 38.20335 39.2 36.6 41.0 35.0 41.0 70-74 37.17255 37.6 35.4 39.6 34.4 41.0 75-79 35.8851 36.2 34.8 37.6 33.4 39.4 80-84 35.248200000000004 35.2 35.0 36.6 34.0 37.8 85-89 34.65265 35.0 35.0 35.8 33.6 36.4 90-94 34.3629 35.0 35.0 35.0 33.0 36.0 95-99 34.156850000000006 35.0 35.0 35.0 33.0 35.6 100-104 33.898700000000005 35.0 34.6 35.0 32.4 35.0 105-109 33.930949999999996 35.0 34.8 35.0 32.8 35.0 110-114 33.8009 35.0 34.0 35.0 32.0 35.0 115-119 33.71535 35.0 34.0 35.0 32.2 35.0 120-124 33.583600000000004 35.0 34.0 35.0 31.6 35.0 125-129 33.446450000000006 35.0 34.0 35.0 31.0 35.0 130-134 33.22095 35.0 34.0 35.0 30.6 35.0 135-139 33.002300000000005 35.0 34.0 35.0 30.0 35.0 140-144 32.6935 35.0 33.2 35.0 29.2 35.0 145-149 32.11755 35.0 33.0 35.0 28.6 35.0 150 27.147 33.0 24.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 5.0 13 2.0 14 2.0 15 1.0 16 5.0 17 2.0 18 3.0 19 0.0 20 3.0 21 2.0 22 9.0 23 5.0 24 8.0 25 5.0 26 13.0 27 19.0 28 21.0 29 21.0 30 39.0 31 28.0 32 59.0 33 73.0 34 138.0 35 328.0 36 1104.0 37 2061.0 38 39.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.973478939157566 10.79043161726469 9.178367134685388 43.05772230889235 2 22.536268134067033 15.682841420710355 33.74187093546773 28.039019509754876 3 20.125 17.175 25.525 37.175000000000004 4 23.635453179769655 25.6885327991988 21.507260891337005 29.16875312969454 5 23.474999999999998 32.0 23.275000000000002 21.25 6 18.25 35.225 26.25 20.275000000000002 7 14.2 26.5 41.199999999999996 18.099999999999998 8 17.65 25.374999999999996 32.574999999999996 24.4 9 16.55 24.825 34.375 24.25 10-14 19.415 30.245 27.465 22.875 15-19 19.215 29.294999999999998 27.935 23.555 20-24 19.66 29.805 26.525 24.01 25-29 19.09 29.645 27.42 23.845 30-34 19.580000000000002 29.304999999999996 27.384999999999998 23.73 35-39 20.215 28.935 27.24 23.61 40-44 19.725 29.625 26.87 23.78 45-49 19.7 29.025000000000002 27.07 24.205 50-54 19.275000000000002 29.575000000000003 27.295 23.855 55-59 19.88 29.335 27.04 23.745 60-64 19.55 29.225 27.525 23.7 65-69 20.200000000000003 29.095 26.91 23.794999999999998 70-74 20.085 28.999999999999996 27.584999999999997 23.330000000000002 75-79 20.185 29.285 26.810000000000002 23.72 80-84 19.814999999999998 29.265 27.075 23.845 85-89 20.24 29.580000000000002 26.91 23.27 90-94 20.3 28.7 27.41 23.59 95-99 20.885 28.194999999999997 27.384999999999998 23.535 100-104 20.849999999999998 28.515 27.07 23.565 105-109 20.36 29.15 26.735 23.755000000000003 110-114 20.775 29.049999999999997 27.07 23.105 115-119 21.09 29.425 25.900000000000002 23.585 120-124 21.345 29.054999999999996 26.165 23.435 125-129 20.955 29.12 26.165 23.76 130-134 20.465 29.110000000000003 26.35 24.075 135-139 20.79 29.535 25.695 23.98 140-144 21.52 30.665 24.915000000000003 22.900000000000002 145-149 21.545 30.349999999999998 24.025 24.08 150 16.884422110552762 32.58793969849246 23.44221105527638 27.08542713567839 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 3.0 26 6.0 27 9.0 28 11.5 29 15.0 30 18.0 31 19.0 32 28.5 33 44.0 34 61.0 35 79.5 36 97.0 37 118.0 38 143.0 39 162.5 40 183.5 41 217.5 42 235.0 43 258.5 44 273.0 45 274.0 46 280.5 47 247.5 48 209.5 49 194.0 50 175.5 51 151.0 52 120.0 53 92.5 54 72.5 55 52.5 56 36.0 57 29.0 58 26.0 59 14.0 60 7.0 61 6.5 62 7.0 63 6.5 64 5.0 65 3.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.05 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.8625 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 0.9125000000000001 0.0 0.0 0.0 0.0 88-89 1.0499999999999998 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.8250000000000002 0.0 0.0 0.0 0.0 102-103 2.1 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 3.2875 0.0 0.0 0.0 0.0 108-109 3.6375 0.0 0.0 0.0 0.0 110-111 4.275 0.0 0.0 0.0 0.0 112-113 4.85 0.0 0.0 0.0 0.0 114-115 5.762499999999999 0.0 0.0 0.0 0.0 116-117 6.75 0.0 0.0 0.0 0.0 118-119 6.925 0.0 0.0 0.0 0.0 120-121 7.25 0.0 0.0 0.0 0.0 122-123 8.5125 0.0 0.0 0.0 0.0 124-125 9.3125 0.0 0.0 0.0 0.0 126-127 9.537500000000001 0.0 0.0 0.0 0.0 128-129 10.4375 0.0 0.0 0.0 0.0 130-131 11.625 0.0 0.0 0.0 0.0 132-133 12.475000000000001 0.0 0.0 0.0 0.0 134-135 13.825 0.0 0.0 0.0 0.0 136-137 15.4 0.0 0.0 0.0 0.0 138 16.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCTC 10 0.0069827023 143.9375 4 >>END_MODULE SRR1799554 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799554_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71575 34.0 33.0 34.0 31.0 34.0 2 32.64175 34.0 33.0 34.0 31.0 34.0 3 32.915 34.0 33.0 34.0 31.0 34.0 4 36.2555 37.0 37.0 37.0 35.0 37.0 5 36.2845 37.0 37.0 37.0 35.0 37.0 6 36.351 37.0 37.0 37.0 35.0 37.0 7 36.265 37.0 37.0 37.0 35.0 37.0 8 36.2875 37.0 37.0 37.0 35.0 37.0 9 38.085 39.0 39.0 39.0 37.0 39.0 10-14 38.4557 39.4 39.2 39.4 37.2 39.4 15-19 39.8044 41.0 40.0 41.0 38.0 41.0 20-24 39.7178 41.0 40.0 41.0 38.0 41.0 25-29 39.63655 41.0 40.0 41.0 38.0 41.0 30-34 39.485049999999994 41.0 40.0 41.0 38.0 41.0 35-39 39.2842 41.0 40.0 41.0 37.0 41.0 40-44 39.1033 41.0 39.8 41.0 36.6 41.0 45-49 38.845800000000004 40.4 39.0 41.0 35.6 41.0 50-54 38.1416 39.6 38.0 40.6 34.6 41.0 55-59 38.1442 40.0 38.0 41.0 34.2 41.0 60-64 38.0747 40.0 37.4 41.0 34.4 41.0 65-69 37.51805 39.0 36.4 41.0 34.4 41.0 70-74 36.549749999999996 37.2 35.2 39.4 34.0 41.0 75-79 35.469849999999994 36.2 35.0 37.8 33.4 39.2 80-84 34.5305 35.0 35.0 36.4 32.8 37.6 85-89 33.8917 35.0 35.0 35.6 32.0 36.4 90-94 33.609950000000005 35.0 34.8 35.0 32.0 36.0 95-99 33.355650000000004 35.0 34.0 35.0 31.2 35.2 100-104 33.2352 35.0 34.0 35.0 31.0 35.0 105-109 33.1074 35.0 34.0 35.0 31.0 35.0 110-114 32.9482 35.0 34.0 35.0 30.4 35.0 115-119 32.759949999999996 35.0 34.0 35.0 29.4 35.0 120-124 32.6083 35.0 34.0 35.0 29.0 35.0 125-129 32.44250000000001 35.0 34.0 35.0 29.0 35.0 130-134 32.14015 35.0 33.2 35.0 28.2 35.0 135-139 31.75475 35.0 33.0 35.0 26.2 35.0 140-144 31.344350000000002 35.0 32.6 35.0 24.8 35.0 145-149 30.780700000000003 34.8 32.0 35.0 22.0 35.0 150 28.80875 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 2.0 4 3.0 5 2.0 6 2.0 7 1.0 8 5.0 9 4.0 10 4.0 11 1.0 12 5.0 13 6.0 14 7.0 15 6.0 16 2.0 17 5.0 18 4.0 19 2.0 20 8.0 21 6.0 22 7.0 23 10.0 24 12.0 25 14.0 26 17.0 27 20.0 28 24.0 29 38.0 30 33.0 31 65.0 32 51.0 33 101.0 34 170.0 35 344.0 36 1152.0 37 1799.0 38 40.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.471783295711056 16.453473789816904 15.023827439177326 31.050915475294712 2 25.56278139069535 25.26263131565783 33.41670835417709 15.757878939469736 3 20.974999999999998 27.375 31.05 20.599999999999998 4 24.25 33.900000000000006 23.25 18.6 5 23.95 35.375 24.2 16.475 6 19.650000000000002 39.225 24.775 16.35 7 20.75 20.525 39.625 19.1 8 21.575 25.074999999999996 29.599999999999998 23.75 9 22.6 23.724999999999998 31.2 22.475 10-14 23.45 28.845 27.175 20.53 15-19 23.380000000000003 27.88 28.535 20.205000000000002 20-24 23.695 27.860000000000003 28.215 20.23 25-29 23.419999999999998 28.09 28.035 20.455000000000002 30-34 23.29 27.445000000000004 28.02 21.245 35-39 23.369999999999997 27.82 28.305000000000003 20.505000000000003 40-44 24.055 27.155 28.38 20.41 45-49 23.375 27.365000000000002 29.095 20.165 50-54 23.685000000000002 27.045 28.675 20.595 55-59 23.51 27.295 29.165000000000003 20.03 60-64 23.745 27.205000000000002 28.815 20.235 65-69 23.805 27.355 28.475 20.365 70-74 23.775 27.265 29.020000000000003 19.939999999999998 75-79 23.645 27.47 29.060000000000002 19.825 80-84 23.46 27.474999999999998 28.799999999999997 20.265 85-89 23.735 27.145000000000003 28.575 20.544999999999998 90-94 23.64 27.439999999999998 29.054999999999996 19.865 95-99 24.29 27.35 28.705000000000002 19.655 100-104 24.095 27.96 28.205000000000002 19.74 105-109 24.545 27.93 27.884999999999998 19.64 110-114 24.05 27.810000000000002 28.249999999999996 19.89 115-119 25.264999999999997 27.334999999999997 27.889999999999997 19.509999999999998 120-124 25.095 27.265 27.97 19.67 125-129 25.03 26.96 28.34 19.67 130-134 25.69 28.139999999999997 27.46 18.709999999999997 135-139 25.490000000000002 28.49 26.935 19.085 140-144 26.92403860579087 28.634295144271643 26.32894934240136 18.112716907536132 145-149 27.48 28.775000000000002 25.465 18.279999999999998 150 28.2367758186398 28.74055415617128 24.811083123425693 18.211586901763223 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 4.5 26 6.0 27 6.5 28 6.5 29 11.5 30 15.0 31 18.0 32 25.5 33 34.5 34 48.0 35 62.0 36 80.5 37 102.0 38 129.5 39 179.0 40 223.0 41 232.5 42 259.0 43 296.5 44 288.0 45 270.5 46 274.5 47 248.5 48 217.5 49 196.5 50 166.0 51 148.0 52 110.0 53 80.0 54 67.0 55 51.0 56 39.0 57 28.0 58 18.5 59 10.0 60 7.0 61 7.5 62 6.0 63 3.5 64 3.5 65 1.5 66 0.5 67 2.0 68 1.5 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.8625 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 0.9125000000000001 0.0 0.0 0.0 0.0 88-89 1.0499999999999998 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8250000000000002 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.475 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.6125 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.862500000000001 0.0 0.0 0.0 0.0 114-115 5.762499999999999 0.0 0.0 0.0 0.0 116-117 6.75 0.0 0.0 0.0 0.0 118-119 6.925 0.0 0.0 0.0 0.0 120-121 7.25 0.0 0.0 0.0 0.0 122-123 8.4875 0.0 0.0 0.0 0.0 124-125 9.2625 0.0 0.0 0.0 0.0 126-127 9.4875 0.0 0.0 0.0 0.0 128-129 10.4125 0.0 0.0 0.0 0.0 130-131 11.625 0.0 0.0 0.0 0.0 132-133 12.475000000000001 0.0 0.0 0.0 0.0 134-135 13.8375 0.0 0.0 0.0 0.0 136-137 15.4375 0.0 0.0 0.0 0.0 138 16.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGCAC 10 0.006973645 144.0 7 CCATTCC 20 0.006139246 28.8 125-129 AAAAAAA 105 5.784126E-6 13.714285 140-144 >>END_MODULE Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498312 spots for SRR1799554.sra Written 1498312 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra Read 1498294 spots for SRR1799554.sra Written 1498294 spots for SRR1799554.sra SRR ids: ['SRR1799554.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ht9wg3tg SRR1799554.sra spots: 29965898 blocks: [[1, 1498294], [1498295, 2996588], [2996589, 4494882], [4494883, 5993176], [5993177, 7491470], [7491471, 8989764], [8989765, 10488058], [10488059, 11986352], [11986353, 13484646], [13484647, 14982940], [14982941, 16481234], [16481235, 17979528], [17979529, 19477822], [19477823, 20976116], [20976117, 22474410], [22474411, 23972704], [23972705, 25470998], [25470999, 26969292], [26969293, 28467586], [28467587, 29965898]] SRR1799554 file size 10074232 SRR1799554 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799554 SRR1799554_1.fastq SRR1799554_2.fastq Input file: SRR1799554_1.fastq Paired file: SRR1799554_2.fastq trimmed: SRR1799554-trimmed-pair1.fastq, SRR1799554-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:30:50 2025 >> started Thu Feb 13 22:31:28 2025 >> done (37.812s) 29965898 read pairs processed; of these: 76851 ( 0.26%) short read pairs filtered out after trimming by size control 172587 ( 0.58%) empty read pairs filtered out after trimming by size control 29716460 (99.17%) read pairs available; of these: 12760371 (42.94%) trimmed read pairs available after processing 16956089 (57.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 6 0.00% 21 10 0.00% 22 18 0.00% 23 29 0.00% 24 39 0.00% 25 37 0.00% 26 51 0.00% 27 73 0.00% 28 72 0.00% 29 109 0.00% 30 137 0.00% 31 168 0.00% 32 185 0.00% 33 218 0.00% 34 302 0.00% 35 322 0.00% 36 381 0.00% 37 398 0.00% 38 461 0.00% 39 480 0.00% 40 513 0.00% 41 601 0.00% 42 593 0.00% 43 711 0.00% 44 789 0.00% 45 838 0.00% 46 902 0.00% 47 923 0.00% 48 994 0.00% 49 1092 0.00% 50 1301 0.00% 51 1379 0.00% 52 1493 0.01% 53 1540 0.01% 54 1795 0.01% 55 1949 0.01% 56 2129 0.01% 57 2362 0.01% 58 2662 0.01% 59 2800 0.01% 60 3277 0.01% 61 3581 0.01% 62 4091 0.01% 63 4764 0.02% 64 5083 0.02% 65 5821 0.02% 66 6324 0.02% 67 6953 0.02% 68 7893 0.03% 69 8920 0.03% 70 10146 0.03% 71 11706 0.04% 72 13223 0.04% 73 15081 0.05% 74 17156 0.06% 75 19402 0.07% 76 21696 0.07% 77 23621 0.08% 78 24185 0.08% 79 23350 0.08% 80 20552 0.07% 81 16683 0.06% 82 10421 0.04% 83 10373 0.03% 84 15792 0.05% 85 16903 0.06% 86 20042 0.07% 87 30331 0.10% 88 34095 0.11% 89 21979 0.07% 90 22259 0.07% 91 27678 0.09% 92 42667 0.14% 93 28387 0.10% 94 27301 0.09% 95 26748 0.09% 96 29631 0.10% 97 37290 0.13% 98 61715 0.21% 99 58895 0.20% 100 31905 0.11% 101 34963 0.12% 102 138366 0.47% 103 74158 0.25% 104 72188 0.24% 105 107570 0.36% 106 120732 0.41% 107 59010 0.20% 108 86455 0.29% 109 101878 0.34% 110 150369 0.51% 111 88451 0.30% 112 62338 0.21% 113 126148 0.42% 114 257173 0.87% 115 275748 0.93% 116 60076 0.20% 117 39032 0.13% 118 54855 0.18% 119 74900 0.25% 120 64306 0.22% 121 216851 0.73% 122 250410 0.84% 123 116523 0.39% 124 48651 0.16% 125 50423 0.17% 126 131675 0.44% 127 136294 0.46% 128 105771 0.36% 129 198956 0.67% 130 289600 0.97% 131 165975 0.56% 132 128499 0.43% 133 265238 0.89% 134 295419 0.99% 135 215934 0.73% 136 292108 0.98% 137 282809 0.95% 138 310918 1.05% 139 312993 1.05% 140 324155 1.09% 141 328094 1.10% 142 334030 1.12% 143 339007 1.14% 144 358966 1.21% 145 389076 1.31% 146 425186 1.43% 147 491121 1.65% 148 666617 2.24% 149 2381569 8.01% 150 16956089 57.06% 29716460 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=274.15 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=43 prefix-density=0.15 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=221.82 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=25.1 sequence=GAAGAAGAAGAAA SRR1799554 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:32:09 Started mapping on | Feb 13 22:32:09 Finished on | Feb 13 22:34:12 Mapping speed, Million of reads per hour | 869.75 Number of input reads | 29716460 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 28970935 Uniquely mapped reads % | 97.49% Average mapped length | 284.05 Number of splices: Total | 25112208 Number of splices: Annotated (sjdb) | 24688312 Number of splices: GT/AG | 24733357 Number of splices: GC/AG | 300325 Number of splices: AT/AC | 21997 Number of splices: Non-canonical | 56529 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527489 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 38942 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 238841 238841 238841 N_multimapping 527489 527489 527489 N_noFeature 896669 28613542 1082302 N_ambiguous 285157 1849 112078 UnstrandedReadsAssigned:27789109 PositiveStrandReadsAssigned:355544 NegativeStrandReadsAssigned:27776555 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR1799554 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799554-trimmed-pair1.fastq SRR1799554-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,716,460 reads, 27,673,320 reads pseudoaligned [quant] estimated average fragment length: 182.737 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR1799554.ke.tsv 34699 SRR1799554.se.tsv 87100 total ==> SRR1799554.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1836.26 614 13.6246 Potri.005G024800.1.v4.1 1035 853.263 63 3.00848 Potri.004G059700.1.v4.1 961 779.27 27 1.41177 Potri.007G009000.2.v4.1 1416 1234.26 0 0 Potri.003G141000.2.v4.1 2943 2761.26 579.178 8.5466 Potri.016G087400.1.v4.1 270 104.772 3021.84 1175.21 Potri.015G069301.1.v4.1 564 382.844 0 0 Potri.010G195200.1.v4.1 1773 1591.26 38 0.97304 Potri.012G127500.1.v4.1 977 795.27 11074 567.386 ==> SRR1799554.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2609 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 481 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR1799554 completed mapping pipeline successfully