Starting /dee2/code/volunteer_pipeline.sh SRR1799555 current disk space = 3088633061376 free memory = 1439806888 SRR1799555 SRAfilesize ef0e0976d31a42e1230a2a5617b79f78 SRR1799555.sra SRR1799555.sra file validated SRR1799555 is paired end SRR1799555 is conventional basespace SRR1799555 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799555_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37725 34.0 34.0 34.0 31.0 34.0 2 32.953 34.0 34.0 34.0 31.0 34.0 3 33.3515 34.0 34.0 34.0 31.0 34.0 4 36.62325 37.0 37.0 37.0 35.0 37.0 5 36.63975 37.0 37.0 37.0 35.0 37.0 6 36.68225 37.0 37.0 37.0 35.0 37.0 7 36.62725 37.0 37.0 37.0 35.0 37.0 8 36.66525 37.0 37.0 37.0 35.0 37.0 9 38.5155 39.0 39.0 39.0 38.0 39.0 10-14 38.88415 39.4 39.2 39.4 37.8 39.4 15-19 40.19305 41.0 40.0 41.0 38.4 41.0 20-24 40.18775 41.0 40.0 41.0 38.8 41.0 25-29 39.99164999999999 41.0 40.0 41.0 38.0 41.0 30-34 40.0133 41.0 40.0 41.0 38.0 41.0 35-39 39.7852 41.0 40.0 41.0 37.8 41.0 40-44 39.599149999999995 41.0 40.0 41.0 37.4 41.0 45-49 39.389199999999995 41.0 40.0 41.0 37.0 41.0 50-54 39.12195 40.8 39.0 41.0 35.8 41.0 55-59 38.82535 40.0 38.8 41.0 35.0 41.0 60-64 38.57965 40.2 37.8 41.0 35.0 41.0 65-69 38.0068 39.2 36.6 41.0 35.0 41.0 70-74 37.003 37.6 35.2 39.8 34.4 41.0 75-79 35.626400000000004 36.2 34.8 37.6 33.4 39.4 80-84 35.07895 35.2 35.0 36.6 33.8 38.0 85-89 34.47879999999999 35.0 35.0 35.8 33.4 36.6 90-94 33.98745 35.0 35.0 35.0 33.0 36.0 95-99 33.76435 35.0 35.0 35.0 32.0 35.4 100-104 33.83225 35.0 35.0 35.0 33.0 35.0 105-109 33.7161 35.0 35.0 35.0 32.2 35.0 110-114 33.6352 35.0 34.8 35.0 32.0 35.0 115-119 33.4139 35.0 34.0 35.0 31.4 35.0 120-124 33.379 35.0 34.0 35.0 31.2 35.0 125-129 33.300149999999995 35.0 34.0 35.0 31.2 35.0 130-134 33.005250000000004 35.0 34.0 35.0 30.2 35.0 135-139 32.72235 35.0 34.0 35.0 29.6 35.0 140-144 32.4242 35.0 34.0 35.0 29.0 35.0 145-149 31.844549999999998 35.0 33.0 35.0 27.0 35.0 150 26.71525 33.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 2.0 9 3.0 10 4.0 11 6.0 12 4.0 13 5.0 14 1.0 15 5.0 16 5.0 17 1.0 18 3.0 19 13.0 20 4.0 21 2.0 22 7.0 23 8.0 24 12.0 25 6.0 26 12.0 27 19.0 28 26.0 29 25.0 30 26.0 31 39.0 32 54.0 33 75.0 34 144.0 35 299.0 36 1019.0 37 2119.0 38 48.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.687030805073775 13.228061092415222 6.419880921563552 37.665027180947455 2 21.955488872218055 13.87846961740435 34.60865216304076 29.557389347336834 3 18.175 15.825 28.9 37.1 4 23.29246935201401 24.168126094570926 23.217413059794847 29.321991493620214 5 23.549999999999997 30.25 25.275 20.925 6 20.9 33.85 23.200000000000003 22.05 7 14.524999999999999 29.15 39.225 17.1 8 15.975 28.475 32.574999999999996 22.975 9 17.474999999999998 25.3 34.1 23.125 10-14 20.185 31.28 26.790000000000003 21.745 15-19 19.145 29.49 27.884999999999998 23.48 20-24 20.0 29.785 27.560000000000002 22.655 25-29 19.555 29.81 27.375 23.26 30-34 19.54 29.57 27.034999999999997 23.855 35-39 19.645000000000003 29.12 27.544999999999998 23.69 40-44 19.765 29.604999999999997 27.48 23.150000000000002 45-49 19.685 29.509999999999998 26.83 23.974999999999998 50-54 19.545 29.285 27.279999999999998 23.89 55-59 19.725 29.13 27.66 23.485 60-64 20.055 28.82 27.560000000000002 23.565 65-69 19.59 29.244999999999997 27.589999999999996 23.575 70-74 19.905 29.28 27.405 23.41 75-79 20.335 28.299999999999997 27.675 23.69 80-84 20.055 29.465000000000003 27.48 23.0 85-89 19.88 29.635 27.189999999999998 23.294999999999998 90-94 20.47 29.38 26.93 23.22 95-99 20.455000000000002 29.409999999999997 27.0 23.135 100-104 20.165 29.099999999999998 26.755000000000003 23.98 105-109 20.355 28.705000000000002 27.245 23.695 110-114 20.64 29.345 26.6 23.415 115-119 21.66 29.285 25.785000000000004 23.27 120-124 21.305 29.25 25.674999999999997 23.77 125-129 21.13 28.895 25.729999999999997 24.245 130-134 20.555 29.69 25.119999999999997 24.635 135-139 20.645 29.115000000000002 24.98 25.259999999999998 140-144 20.9 29.735 24.2 25.165 145-149 19.79 29.86 24.490000000000002 25.86 150 15.48694779116466 30.948795180722893 24.347389558232933 29.21686746987952 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.5 24 1.5 25 2.0 26 7.0 27 10.0 28 11.0 29 15.5 30 27.0 31 30.5 32 38.5 33 59.5 34 64.0 35 80.0 36 107.0 37 125.0 38 147.5 39 171.5 40 190.5 41 207.0 42 238.0 43 253.0 44 270.5 45 274.0 46 244.0 47 225.5 48 200.5 49 189.0 50 172.5 51 131.0 52 110.0 53 99.5 54 83.0 55 61.0 56 40.5 57 30.5 58 22.0 59 15.5 60 7.5 61 5.5 62 7.0 63 5.0 64 2.5 65 2.5 66 2.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.025 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.425 0.0 0.0 0.0 0.0 74-75 0.5249999999999999 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 1.175 0.0 0.0 0.0 0.0 82-83 1.5750000000000002 0.0 0.0 0.0 0.0 84-85 1.85 0.0 0.0 0.0 0.0 86-87 2.15 0.0 0.0 0.0 0.0 88-89 2.325 0.0 0.0 0.0 0.0 90-91 2.45 0.0 0.0 0.0 0.0 92-93 2.8 0.0 0.0 0.0 0.0 94-95 3.0375 0.0 0.0 0.0 0.0 96-97 3.4000000000000004 0.0 0.0 0.0 0.0 98-99 4.0375 0.0 0.0 0.0 0.0 100-101 4.2875 0.0 0.0 0.0 0.0 102-103 5.0375 0.0 0.0 0.0 0.0 104-105 5.675000000000001 0.0 0.0 0.0 0.0 106-107 6.55 0.0 0.0 0.0 0.0 108-109 7.550000000000001 0.0 0.0 0.0 0.0 110-111 8.9 0.0 0.0 0.0 0.0 112-113 9.975 0.0 0.0 0.0 0.0 114-115 11.0 0.0 0.0 0.0 0.0 116-117 12.0 0.0 0.0 0.0 0.0 118-119 12.9375 0.0 0.0 0.0 0.0 120-121 14.1125 0.0 0.0 0.0 0.0 122-123 15.5 0.0 0.0 0.0 0.0 124-125 16.75 0.0 0.0 0.0 0.0 126-127 17.762500000000003 0.0 0.0 0.0 0.0 128-129 19.237499999999997 0.0 0.0 0.0 0.0 130-131 20.7875 0.0 0.0 0.0 0.0 132-133 22.237499999999997 0.0 0.0 0.0 0.0 134-135 23.775 0.0 0.0 0.0 0.0 136-137 25.262500000000003 0.0 0.0 0.0 0.0 138 26.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTAAAG 10 0.0069808904 143.95 7 CTAAAGT 10 0.0069808904 143.95 8 ACCTAAA 10 0.0069808904 143.95 6 >>END_MODULE SRR1799555 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799555_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72825 34.0 33.0 34.0 31.0 34.0 2 32.79175 34.0 34.0 34.0 31.0 34.0 3 32.87575 34.0 34.0 34.0 31.0 34.0 4 36.01 37.0 37.0 37.0 35.0 37.0 5 36.11375 37.0 37.0 37.0 35.0 37.0 6 36.12625 37.0 37.0 37.0 35.0 37.0 7 36.07975 37.0 37.0 37.0 35.0 37.0 8 36.06375 37.0 37.0 37.0 35.0 37.0 9 37.98775 39.0 39.0 39.0 37.0 39.0 10-14 38.25525 39.4 39.2 39.4 37.2 39.4 15-19 39.534099999999995 41.0 40.0 41.0 38.0 41.0 20-24 39.49345 41.0 40.0 41.0 38.0 41.0 25-29 39.421 41.0 40.0 41.0 38.0 41.0 30-34 39.237 41.0 40.0 41.0 37.6 41.0 35-39 39.0389 41.0 40.0 41.0 36.8 41.0 40-44 38.855 41.0 39.6 41.0 36.4 41.0 45-49 38.565149999999996 40.8 39.0 41.0 34.8 41.0 50-54 37.810199999999995 39.6 38.0 40.6 34.2 40.8 55-59 37.9139 40.0 37.8 41.0 34.0 41.0 60-64 37.84595 39.8 37.2 41.0 34.2 41.0 65-69 37.21894999999999 39.0 36.0 41.0 34.0 41.0 70-74 36.3354 37.2 35.0 39.6 34.0 41.0 75-79 35.252449999999996 36.0 35.0 37.8 33.2 39.6 80-84 34.27455 35.0 35.0 36.4 32.4 37.8 85-89 33.65535 35.0 35.0 35.6 31.6 36.4 90-94 33.382549999999995 35.0 35.0 35.0 31.4 36.0 95-99 33.174 35.0 34.4 35.0 31.0 35.6 100-104 33.067699999999995 35.0 34.0 35.0 31.0 35.0 105-109 32.9042 35.0 34.0 35.0 30.2 35.0 110-114 32.57245 35.0 34.0 35.0 29.2 35.0 115-119 32.60080000000001 35.0 34.0 35.0 29.2 35.0 120-124 32.3834 35.0 34.0 35.0 29.0 35.0 125-129 32.228750000000005 35.0 34.0 35.0 28.6 35.0 130-134 31.911649999999998 35.0 33.0 35.0 26.6 35.0 135-139 31.37005 35.0 33.0 35.0 24.4 35.0 140-144 30.728250000000003 34.6 32.0 35.0 20.8 35.0 145-149 30.2158 34.0 31.6 35.0 10.8 35.0 150 27.8415 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 53.0 3 4.0 4 2.0 5 2.0 6 1.0 7 5.0 8 4.0 9 3.0 10 4.0 11 7.0 12 5.0 13 5.0 14 2.0 15 6.0 16 5.0 17 5.0 18 5.0 19 4.0 20 7.0 21 8.0 22 8.0 23 11.0 24 13.0 25 17.0 26 20.0 27 21.0 28 30.0 29 18.0 30 30.0 31 51.0 32 60.0 33 105.0 34 154.0 35 361.0 36 1148.0 37 1765.0 38 51.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.05740787164703 20.506392579593882 12.810228127350213 27.625971421408874 2 26.906726681670417 25.78144536134033 31.057764441110276 16.25406351587897 3 20.005001250312578 28.032008002000502 32.58314578644661 19.379844961240313 4 24.10602650662666 32.53313328332083 24.031007751937985 19.32983245811453 5 24.281070267566893 36.434108527131784 22.95573893473368 16.32908227056764 6 20.8 37.9 24.525 16.775000000000002 7 20.95 20.95 41.025 17.075000000000003 8 24.125 24.9 28.799999999999997 22.175 9 22.45 23.775 31.874999999999996 21.9 10-14 24.21 28.910000000000004 26.865 20.015 15-19 23.255 28.255000000000003 28.15 20.34 20-24 23.68 28.22 28.189999999999998 19.91 25-29 24.085 27.765 28.415000000000003 19.735 30-34 23.330000000000002 28.055000000000003 28.58 20.035 35-39 23.285 28.720000000000002 28.155 19.84 40-44 23.82 27.74 28.389999999999997 20.05 45-49 23.005 27.685 28.955 20.355 50-54 23.66 27.750000000000004 28.345 20.244999999999997 55-59 23.59 27.229999999999997 28.83 20.349999999999998 60-64 23.599999999999998 27.045 29.630000000000003 19.725 65-69 23.830000000000002 27.034999999999997 28.99 20.145 70-74 23.674999999999997 27.79 28.599999999999998 19.935 75-79 23.365 27.060000000000002 29.285 20.29 80-84 23.599999999999998 27.525 28.335 20.54 85-89 23.815 27.46 28.499999999999996 20.225 90-94 24.125 27.655 28.57 19.650000000000002 95-99 24.08 28.09 28.465 19.365 100-104 24.66 28.134999999999998 27.595 19.61 105-109 25.145 27.915 27.944999999999997 18.995 110-114 24.834999999999997 28.599999999999998 27.445000000000004 19.12 115-119 25.490000000000002 28.325 26.88 19.305 120-124 26.040000000000003 27.665 26.950000000000003 19.345000000000002 125-129 26.875 27.48 26.615 19.03 130-134 26.705000000000002 28.71 25.97 18.615000000000002 135-139 27.125 28.910000000000004 25.564999999999998 18.4 140-144 27.83 28.715000000000003 26.025 17.43 145-149 28.084999999999997 29.160000000000004 25.074999999999996 17.68 150 28.816553116326016 28.059550845319205 25.13247539742619 17.99142064092859 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.5 20 2.0 21 2.5 22 3.0 23 1.0 24 1.5 25 5.5 26 6.0 27 4.5 28 10.0 29 13.0 30 15.0 31 23.0 32 34.5 33 49.0 34 60.5 35 72.0 36 94.0 37 117.0 38 132.0 39 154.0 40 191.0 41 223.0 42 247.5 43 276.0 44 292.0 45 289.5 46 274.0 47 245.0 48 211.0 49 193.5 50 171.0 51 130.5 52 103.5 53 82.0 54 66.0 55 57.5 56 44.0 57 32.5 58 20.5 59 10.0 60 6.0 61 4.0 62 3.5 63 4.5 64 5.0 65 3.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.7875 0.0 0.0 0.0 0.0 78-79 0.9 0.0 0.0 0.0 0.0 80-81 1.125 0.0 0.0 0.0 0.0 82-83 1.525 0.0 0.0 0.0 0.0 84-85 1.7999999999999998 0.0 0.0 0.0 0.0 86-87 2.1 0.0 0.0 0.0 0.0 88-89 2.2625 0.0 0.0 0.0 0.0 90-91 2.3875 0.0 0.0 0.0 0.0 92-93 2.7125 0.0 0.0 0.0 0.0 94-95 2.9375 0.0 0.0 0.0 0.0 96-97 3.3 0.0 0.0 0.0 0.0 98-99 3.9000000000000004 0.0 0.0 0.0 0.0 100-101 4.137499999999999 0.0 0.0 0.0 0.0 102-103 4.887499999999999 0.0 0.0 0.0 0.0 104-105 5.525 0.0 0.0 0.0 0.0 106-107 6.4 0.0 0.0 0.0 0.0 108-109 7.4125 0.0 0.0 0.0 0.0 110-111 8.787500000000001 0.0 0.0 0.0 0.0 112-113 9.85 0.0 0.0 0.0 0.0 114-115 10.875 0.0 0.0 0.0 0.0 116-117 11.8625 0.0 0.0 0.0 0.0 118-119 12.7625 0.0 0.0 0.0 0.0 120-121 13.95 0.0 0.0 0.0 0.0 122-123 15.35 0.0 0.0 0.0 0.0 124-125 16.55 0.0 0.0 0.0 0.0 126-127 17.575000000000003 0.0 0.0 0.0 0.0 128-129 19.0875 0.0 0.0 0.0 0.0 130-131 20.6 0.0 0.0 0.0 0.0 132-133 21.987499999999997 0.0 0.0 0.0 0.0 134-135 23.475 0.0 0.0 0.0 0.0 136-137 24.925 0.0 0.0 0.0 0.0 138 25.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAAAT 10 0.006973645 144.0 1 CCATCAC 10 0.006973645 144.0 4 AAAAATT 10 0.006973645 144.0 2 GTTAATC 10 0.006973645 144.0 2 AGTGTAG 35 0.0036813593 20.571428 130-134 >>END_MODULE Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258469 spots for SRR1799555.sra Written 1258469 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra Read 1258453 spots for SRR1799555.sra Written 1258453 spots for SRR1799555.sra SRR ids: ['SRR1799555.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mv9fr710 SRR1799555.sra spots: 25169076 blocks: [[1, 1258453], [1258454, 2516906], [2516907, 3775359], [3775360, 5033812], [5033813, 6292265], [6292266, 7550718], [7550719, 8809171], [8809172, 10067624], [10067625, 11326077], [11326078, 12584530], [12584531, 13842983], [13842984, 15101436], [15101437, 16359889], [16359890, 17618342], [17618343, 18876795], [18876796, 20135248], [20135249, 21393701], [21393702, 22652154], [22652155, 23910607], [23910608, 25169076]] SRR1799555 file size 8458115 SRR1799555 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799555 SRR1799555_1.fastq SRR1799555_2.fastq Input file: SRR1799555_1.fastq Paired file: SRR1799555_2.fastq trimmed: SRR1799555-trimmed-pair1.fastq, SRR1799555-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:24:54 2025 >> started Thu Feb 13 22:25:21 2025 >> done (27.289s) 25169076 read pairs processed; of these: 78672 ( 0.31%) short read pairs filtered out after trimming by size control 239952 ( 0.95%) empty read pairs filtered out after trimming by size control 24850452 (98.73%) read pairs available; of these: 12649827 (50.90%) trimmed read pairs available after processing 12200625 (49.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 17 0.00% 22 19 0.00% 23 24 0.00% 24 45 0.00% 25 56 0.00% 26 72 0.00% 27 80 0.00% 28 99 0.00% 29 146 0.00% 30 126 0.00% 31 169 0.00% 32 210 0.00% 33 242 0.00% 34 267 0.00% 35 276 0.00% 36 383 0.00% 37 410 0.00% 38 461 0.00% 39 498 0.00% 40 618 0.00% 41 661 0.00% 42 712 0.00% 43 789 0.00% 44 816 0.00% 45 892 0.00% 46 922 0.00% 47 1021 0.00% 48 1272 0.01% 49 1375 0.01% 50 1440 0.01% 51 1625 0.01% 52 1873 0.01% 53 1989 0.01% 54 2192 0.01% 55 2302 0.01% 56 2551 0.01% 57 2939 0.01% 58 3276 0.01% 59 3649 0.01% 60 4178 0.02% 61 4778 0.02% 62 5428 0.02% 63 6126 0.02% 64 6805 0.03% 65 7282 0.03% 66 8245 0.03% 67 9216 0.04% 68 10075 0.04% 69 11685 0.05% 70 12988 0.05% 71 14891 0.06% 72 17152 0.07% 73 19157 0.08% 74 21083 0.08% 75 23865 0.10% 76 26559 0.11% 77 28530 0.11% 78 30122 0.12% 79 33167 0.13% 80 34707 0.14% 81 38561 0.16% 82 41085 0.17% 83 44069 0.18% 84 52460 0.21% 85 58144 0.23% 86 64589 0.26% 87 65059 0.26% 88 35898 0.14% 89 38711 0.16% 90 42460 0.17% 91 82931 0.33% 92 41447 0.17% 93 36306 0.15% 94 44969 0.18% 95 62153 0.25% 96 53860 0.22% 97 73241 0.29% 98 88441 0.36% 99 49445 0.20% 100 47261 0.19% 101 134412 0.54% 102 142191 0.57% 103 88917 0.36% 104 95384 0.38% 105 171097 0.69% 106 86326 0.35% 107 173934 0.70% 108 169548 0.68% 109 195438 0.79% 110 158539 0.64% 111 194370 0.78% 112 111408 0.45% 113 171623 0.69% 114 129265 0.52% 115 211434 0.85% 116 111794 0.45% 117 98478 0.40% 118 175889 0.71% 119 147623 0.59% 120 175084 0.70% 121 164667 0.66% 122 217689 0.88% 123 144010 0.58% 124 119582 0.48% 125 204153 0.82% 126 188905 0.76% 127 213018 0.86% 128 189369 0.76% 129 216163 0.87% 130 211885 0.85% 131 177355 0.71% 132 220430 0.89% 133 217875 0.88% 134 213709 0.86% 135 216343 0.87% 136 219900 0.88% 137 226449 0.91% 138 222103 0.89% 139 224418 0.90% 140 225122 0.91% 141 227512 0.92% 142 231903 0.93% 143 235176 0.95% 144 245164 0.99% 145 262049 1.05% 146 284000 1.14% 147 340928 1.37% 148 465812 1.87% 149 1947727 7.84% 150 12200625 49.10% 24850452 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.18 fanout-score-rank=19 prefix-density=0.27 prefix-fanout=3.3 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=6 fanout-score=62.93 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=11.8 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.47 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=3.2 sequence=TGGCTCCTTGTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=24.91 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.6 sequence=CAGCAAGAAAATCAATTTGTTCATATATATAGTTGAGATCCAGAAATATGGAGGCTCCTCTTAAATTCATCGGTCTTCTGGGATTGCTTGTGCTTTTGAGTGTTGC SRR1799555 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:26:09 Started mapping on | Feb 13 22:26:09 Finished on | Feb 13 22:30:11 Mapping speed, Million of reads per hour | 369.68 Number of input reads | 24850452 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 22704720 Uniquely mapped reads % | 91.37% Average mapped length | 273.89 Number of splices: Total | 17873121 Number of splices: Annotated (sjdb) | 17427646 Number of splices: GT/AG | 17530582 Number of splices: GC/AG | 216969 Number of splices: AT/AC | 14642 Number of splices: Non-canonical | 110928 Mismatch rate per base, % | 1.14% Deletion rate per base | 0.10% Deletion average length | 2.93 Insertion rate per base | 0.07% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 804524 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 47516 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1372194 1372194 1372194 N_multimapping 804524 804524 804524 N_noFeature 721064 22358573 893583 N_ambiguous 288908 1282 114703 UnstrandedReadsAssigned:21694748 PositiveStrandReadsAssigned:344865 NegativeStrandReadsAssigned:21696434 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=126 echo kmer=121 SRR1799555 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799555-trimmed-pair1.fastq SRR1799555-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,850,452 reads, 21,136,061 reads pseudoaligned [quant] estimated average fragment length: 172.627 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR1799555.ke.tsv 34699 SRR1799555.se.tsv 87100 total ==> SRR1799555.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1846.37 434 13.5358 Potri.005G024800.1.v4.1 1035 863.373 260 17.3416 Potri.004G059700.1.v4.1 961 789.373 27 1.96968 Potri.007G009000.2.v4.1 1416 1244.37 0 0 Potri.003G141000.2.v4.1 2943 2771.37 327.056 6.79583 Potri.016G087400.1.v4.1 270 113.804 1625 822.261 Potri.015G069301.1.v4.1 564 392.879 0 0 Potri.010G195200.1.v4.1 1773 1601.37 43 1.54629 Potri.012G127500.1.v4.1 977 805.373 4994 357.081 ==> SRR1799555.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1768 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 508 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR1799555 completed mapping pipeline successfully