Starting /dee2/code/volunteer_pipeline.sh SRR1799556 current disk space = 3088675254272 free memory = 1413292852 SRR1799556 SRAfilesize 7b3d5069b10c0c025046976f1150aa1f SRR1799556.sra SRR1799556.sra file validated SRR1799556 is paired end SRR1799556 is conventional basespace SRR1799556 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.251 34.0 34.0 34.0 31.0 34.0 2 33.3595 34.0 34.0 34.0 31.0 34.0 3 33.44475 34.0 34.0 34.0 31.0 34.0 4 36.6905 37.0 37.0 37.0 35.0 37.0 5 36.6425 37.0 37.0 37.0 35.0 37.0 6 36.48025 37.0 37.0 37.0 35.0 37.0 7 36.6015 37.0 37.0 37.0 35.0 37.0 8 36.65075 37.0 37.0 37.0 35.0 37.0 9 38.53525 39.0 39.0 39.0 37.0 39.0 10-14 38.851299999999995 39.4 39.2 39.4 37.2 39.4 15-19 40.07495 41.0 40.0 41.0 38.0 41.0 20-24 39.82885 41.0 40.0 41.0 37.8 41.0 25-29 39.8623 41.0 40.0 41.0 38.0 41.0 30-34 39.800200000000004 41.0 40.0 41.0 37.8 41.0 35-39 39.8046 41.0 40.0 41.0 38.0 41.0 40-44 39.6683 41.0 40.0 41.0 37.2 41.0 45-49 39.51025 41.0 39.8 41.0 37.0 41.0 50-54 39.352999999999994 41.0 39.0 41.0 36.2 41.0 55-59 39.08655 40.6 38.6 41.0 35.4 41.0 60-64 38.5289 39.8 37.4 41.0 35.0 41.0 65-69 37.6877 38.8 36.2 40.8 34.2 41.0 70-74 36.6359 37.0 35.0 39.2 33.8 41.0 75-79 35.247 35.4 34.4 37.4 32.2 39.2 80-84 34.93815 35.0 35.0 36.4 33.0 37.8 85-89 34.242000000000004 35.0 34.6 35.6 32.2 36.4 90-94 34.0305 35.0 34.0 35.0 32.0 36.0 95-99 33.800399999999996 35.0 34.0 35.0 32.0 35.2 100-104 33.401650000000004 35.0 34.0 35.0 30.8 35.0 105-109 33.24675 35.0 34.0 35.0 30.4 35.0 110-114 33.033699999999996 35.0 34.0 35.0 29.8 35.0 115-119 32.66845000000001 35.0 33.0 35.0 29.0 35.0 120-124 32.280899999999995 34.8 33.0 35.0 27.4 35.0 125-129 31.948950000000004 34.0 32.0 35.0 26.2 35.0 130-134 31.22185 34.0 31.2 35.0 24.4 35.0 135-139 30.648749999999996 34.0 31.0 35.0 23.0 35.0 140-144 29.821199999999997 34.0 29.8 35.0 16.8 35.0 145-149 27.327700000000004 33.0 27.2 34.8 2.0 35.0 150 19.7075 24.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 2.0 15 6.0 16 4.0 17 4.0 18 2.0 19 4.0 20 7.0 21 7.0 22 10.0 23 10.0 24 4.0 25 19.0 26 17.0 27 27.0 28 40.0 29 40.0 30 69.0 31 69.0 32 109.0 33 157.0 34 285.0 35 551.0 36 1333.0 37 1202.0 38 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.498117942283564 11.64366373902133 7.728983688833124 41.12923462986198 2 21.975 14.05 34.4 29.575000000000003 3 20.200000000000003 17.25 24.925 37.625 4 23.325000000000003 25.674999999999997 21.65 29.349999999999998 5 22.925 31.175000000000004 23.65 22.25 6 19.11690918213748 35.14801806322127 24.510787757150023 21.224284997491218 7 14.45 27.150000000000002 41.025 17.375 8 17.175 27.05 32.95 22.825 9 17.9 24.525 34.225 23.35 10-14 20.1 30.659999999999997 26.400000000000002 22.84 15-19 19.275000000000002 29.53 27.750000000000004 23.445 20-24 19.905 29.335 27.275 23.485 25-29 19.875 29.285 27.6 23.24 30-34 20.225 29.435 26.905 23.435 35-39 20.1 29.220000000000002 27.32 23.36 40-44 20.200000000000003 29.054999999999996 27.339999999999996 23.405 45-49 20.115 29.270000000000003 26.889999999999997 23.724999999999998 50-54 19.325 29.695 27.67 23.31 55-59 19.875 29.299999999999997 26.900000000000002 23.925 60-64 20.365 28.83 27.345000000000002 23.46 65-69 19.905 29.189999999999998 27.55 23.355 70-74 19.905 28.98 27.105 24.01 75-79 20.34 28.285 28.050000000000004 23.325000000000003 80-84 20.205000000000002 28.299999999999997 27.889999999999997 23.605 85-89 20.424999999999997 28.904999999999998 27.18 23.49 90-94 20.1 29.275000000000002 27.01 23.615 95-99 20.445 28.49 27.765 23.3 100-104 20.645 29.494999999999997 26.650000000000002 23.21 105-109 20.505000000000003 28.799999999999997 27.11 23.585 110-114 20.755000000000003 29.115000000000002 26.834999999999997 23.294999999999998 115-119 21.16 29.32 25.77 23.75 120-124 21.21 28.999999999999996 25.979999999999997 23.810000000000002 125-129 21.145 28.405 26.529999999999998 23.919999999999998 130-134 20.84 28.815 26.495 23.849999999999998 135-139 21.075 29.075 25.3 24.55 140-144 21.945 28.305000000000003 25.405 24.345 145-149 22.085 29.439999999999998 24.52 23.955000000000002 150 8.225 38.6 24.2 28.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 2.0 24 2.0 25 5.5 26 8.0 27 7.5 28 11.0 29 15.0 30 19.0 31 27.0 32 38.0 33 45.0 34 64.0 35 87.5 36 98.5 37 115.5 38 128.5 39 141.5 40 173.5 41 188.0 42 219.5 43 259.5 44 268.0 45 256.5 46 260.5 47 263.5 48 239.0 49 221.5 50 203.0 51 160.5 52 116.5 53 89.5 54 64.5 55 55.5 56 46.5 57 33.5 58 21.5 59 11.0 60 6.0 61 4.0 62 3.5 63 3.5 64 3.0 65 3.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.35000000000000003 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4875 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.7124999999999999 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.7874999999999996 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.824999999999999 0.0 0.0 0.0 0.0 110-111 5.7375 0.0 0.0 0.0 0.0 112-113 6.0125 0.0 0.0 0.0 0.0 114-115 6.3125 0.0 0.0 0.0 0.0 116-117 7.3875 0.0 0.0 0.0 0.0 118-119 7.762499999999999 0.0 0.0 0.0 0.0 120-121 7.975 0.0 0.0 0.0 0.0 122-123 8.85 0.0 0.0 0.0 0.0 124-125 9.850000000000001 0.0 0.0 0.0 0.0 126-127 10.162500000000001 0.0 0.0 0.0 0.0 128-129 10.649999999999999 0.0 0.0 0.0 0.0 130-131 11.2875 0.0 0.0 0.0 0.0 132-133 12.6875 0.0 0.0 0.0 0.0 134-135 14.1625 0.0 0.0 0.0 0.0 136-137 15.7125 0.0 0.0 0.0 0.0 138 17.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1799556 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799556_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8535 34.0 33.0 34.0 31.0 34.0 2 32.92975 34.0 33.0 34.0 31.0 34.0 3 33.01975 34.0 34.0 34.0 31.0 34.0 4 36.212 37.0 37.0 37.0 35.0 37.0 5 36.22375 37.0 37.0 37.0 35.0 37.0 6 36.33 37.0 37.0 37.0 35.0 37.0 7 36.3125 37.0 37.0 37.0 35.0 37.0 8 36.27975 37.0 37.0 37.0 35.0 37.0 9 38.08975 39.0 39.0 39.0 37.0 39.0 10-14 38.4615 39.4 39.2 39.4 37.2 39.4 15-19 39.6672 41.0 40.0 41.0 38.0 41.0 20-24 39.5972 41.0 40.0 41.0 38.0 41.0 25-29 39.40555 41.0 40.0 41.0 37.6 41.0 30-34 39.1873 40.6 39.6 41.0 36.8 41.0 35-39 38.8681 40.0 38.8 41.0 36.0 41.0 40-44 38.749 40.0 38.4 41.0 35.6 41.0 45-49 38.92515 40.6 39.0 41.0 35.8 41.0 50-54 37.9052 39.6 38.0 40.4 34.2 40.6 55-59 38.0989 40.0 37.8 41.0 34.2 41.0 60-64 37.593849999999996 39.4 36.6 41.0 33.8 41.0 65-69 36.684850000000004 38.2 35.4 40.0 32.4 41.0 70-74 36.064800000000005 36.8 35.0 39.2 32.8 40.8 75-79 35.0351 35.6 35.0 37.4 32.0 39.2 80-84 34.1204 35.0 34.2 36.2 31.6 37.6 85-89 33.33675 35.0 34.0 35.2 30.4 36.2 90-94 33.05825 35.0 34.0 35.0 30.0 36.0 95-99 32.83245000000001 35.0 34.0 35.0 29.8 35.0 100-104 32.5209 35.0 33.2 35.0 29.2 35.0 105-109 32.16645 35.0 33.0 35.0 27.2 35.0 110-114 31.977050000000002 35.0 32.8 35.0 26.6 35.0 115-119 31.556550000000005 34.0 32.2 35.0 25.4 35.0 120-124 31.03075 34.0 31.2 35.0 24.2 35.0 125-129 30.496850000000002 34.0 30.6 35.0 21.8 35.0 130-134 29.7399 34.0 29.4 35.0 18.2 35.0 135-139 29.0736 33.4 29.0 35.0 13.4 35.0 140-144 28.315949999999997 33.0 28.2 35.0 4.0 35.0 145-149 26.54975 32.2 25.0 34.0 2.0 35.0 150 20.46225 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 3.0 4 4.0 5 4.0 6 2.0 7 4.0 8 4.0 9 6.0 10 4.0 11 6.0 12 1.0 13 3.0 14 6.0 15 6.0 16 7.0 17 7.0 18 4.0 19 9.0 20 12.0 21 7.0 22 9.0 23 18.0 24 11.0 25 18.0 26 28.0 27 33.0 28 42.0 29 52.0 30 65.0 31 97.0 32 126.0 33 188.0 34 374.0 35 672.0 36 1334.0 37 801.0 38 11.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.025 18.65 12.65 30.675 2 25.575 26.650000000000002 32.2 15.575 3 21.8 26.974999999999998 31.125000000000004 20.1 4 25.25 32.9 22.900000000000002 18.95 5 26.075 36.025 22.6 15.299999999999999 6 19.75 38.4 23.925 17.925 7 20.474999999999998 21.475 39.95 18.099999999999998 8 22.45 24.474999999999998 30.049999999999997 23.025000000000002 9 24.175 24.325 29.25 22.25 10-14 24.175 28.32 26.919999999999998 20.585 15-19 24.065 28.12 27.77 20.044999999999998 20-24 23.755000000000003 28.110000000000003 27.775 20.36 25-29 23.265 27.96 28.310000000000002 20.465 30-34 23.56 27.305 28.555000000000003 20.580000000000002 35-39 22.39 27.805000000000003 28.910000000000004 20.895 40-44 23.525 27.515 27.950000000000003 21.01 45-49 23.455000000000002 27.715 27.839999999999996 20.990000000000002 50-54 23.080000000000002 28.044999999999998 28.335 20.54 55-59 23.885 27.805000000000003 27.96 20.349999999999998 60-64 23.595 27.605 28.395 20.405 65-69 23.51 27.515 28.444999999999997 20.53 70-74 23.72 27.605 28.884999999999998 19.79 75-79 23.285 27.66 28.78 20.275000000000002 80-84 23.705000000000002 28.13 28.110000000000003 20.055 85-89 23.57 27.105 29.07 20.255000000000003 90-94 23.585 27.68 28.17 20.565 95-99 23.28 27.515 28.26 20.945 100-104 23.51 27.700000000000003 28.544999999999998 20.244999999999997 105-109 24.185000000000002 27.544999999999998 28.15 20.119999999999997 110-114 24.245 27.595 28.24 19.919999999999998 115-119 24.935 27.975 27.305 19.785 120-124 25.45 26.775 27.765 20.01 125-129 25.905 27.889999999999997 27.26 18.945 130-134 25.845000000000002 28.915000000000003 26.525 18.715 135-139 26.375 28.125 26.66 18.84 140-144 26.775 28.505000000000003 26.245 18.475 145-149 27.845 26.955000000000002 26.090000000000003 19.11 150 30.75 26.174999999999997 24.05 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 2.0 24 3.0 25 3.5 26 5.0 27 6.5 28 6.5 29 8.0 30 15.0 31 28.5 32 34.0 33 36.5 34 52.0 35 67.5 36 79.0 37 96.0 38 140.5 39 175.5 40 189.0 41 213.5 42 232.0 43 254.5 44 274.0 45 276.5 46 275.0 47 260.0 48 239.0 49 212.5 50 177.5 51 150.5 52 127.5 53 107.0 54 75.0 55 45.5 56 37.5 57 26.5 58 14.5 59 11.0 60 10.5 61 7.5 62 5.5 63 5.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4875 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.7124999999999999 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.975 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.8375000000000004 0.0 0.0 0.0 0.0 106-107 3.75 0.0 0.0 0.0 0.0 108-109 4.925 0.0 0.0 0.0 0.0 110-111 5.9 0.0 0.0 0.0 0.0 112-113 6.1875 0.0 0.0 0.0 0.0 114-115 6.4625 0.0 0.0 0.0 0.0 116-117 7.5625 0.0 0.0 0.0 0.0 118-119 7.987500000000001 0.0 0.0 0.0 0.0 120-121 8.2 0.0 0.0 0.0 0.0 122-123 9.162500000000001 0.0 0.0 0.0 0.0 124-125 10.1875 0.0 0.0 0.0 0.0 126-127 10.525 0.0 0.0 0.0 0.0 128-129 11.024999999999999 0.0 0.0 0.0 0.0 130-131 11.675 0.0 0.0 0.0 0.0 132-133 13.0375 0.0 0.0 0.0 0.0 134-135 14.537500000000001 0.0 0.0 0.0 0.0 136-137 16.1125 0.0 0.0 0.0 0.0 138 17.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAGC 10 0.006973645 144.0 3 AACCAAC 10 0.006973645 144.0 8 TAACCAA 10 0.006973645 144.0 7 CCTGGCT 10 0.006973645 144.0 1 >>END_MODULE Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242547 spots for SRR1799556.sra Written 1242547 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra Read 1242542 spots for SRR1799556.sra Written 1242542 spots for SRR1799556.sra SRR ids: ['SRR1799556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ysss7e9m SRR1799556.sra spots: 24850845 blocks: [[1, 1242542], [1242543, 2485084], [2485085, 3727626], [3727627, 4970168], [4970169, 6212710], [6212711, 7455252], [7455253, 8697794], [8697795, 9940336], [9940337, 11182878], [11182879, 12425420], [12425421, 13667962], [13667963, 14910504], [14910505, 16153046], [16153047, 17395588], [17395589, 18638130], [18638131, 19880672], [19880673, 21123214], [21123215, 22365756], [22365757, 23608298], [23608299, 24850845]] SRR1799556 file size 8350898 SRR1799556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799556 SRR1799556_1.fastq SRR1799556_2.fastq Input file: SRR1799556_1.fastq Paired file: SRR1799556_2.fastq trimmed: SRR1799556-trimmed-pair1.fastq, SRR1799556-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:40:19 2025 >> started Thu Feb 13 22:40:46 2025 >> done (27.010s) 24850845 read pairs processed; of these: 58106 ( 0.23%) short read pairs filtered out after trimming by size control 139882 ( 0.56%) empty read pairs filtered out after trimming by size control 24652857 (99.20%) read pairs available; of these: 13427067 (54.46%) trimmed read pairs available after processing 11225790 (45.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 8 0.00% 22 18 0.00% 23 29 0.00% 24 27 0.00% 25 32 0.00% 26 54 0.00% 27 55 0.00% 28 67 0.00% 29 88 0.00% 30 96 0.00% 31 136 0.00% 32 151 0.00% 33 194 0.00% 34 235 0.00% 35 243 0.00% 36 259 0.00% 37 337 0.00% 38 367 0.00% 39 447 0.00% 40 499 0.00% 41 503 0.00% 42 611 0.00% 43 622 0.00% 44 722 0.00% 45 798 0.00% 46 789 0.00% 47 854 0.00% 48 1039 0.00% 49 1188 0.00% 50 1249 0.01% 51 1371 0.01% 52 1473 0.01% 53 1550 0.01% 54 1704 0.01% 55 1904 0.01% 56 2046 0.01% 57 2193 0.01% 58 2451 0.01% 59 2748 0.01% 60 3116 0.01% 61 3433 0.01% 62 3692 0.01% 63 4383 0.02% 64 4572 0.02% 65 5165 0.02% 66 5510 0.02% 67 6335 0.03% 68 6962 0.03% 69 7694 0.03% 70 8829 0.04% 71 10053 0.04% 72 11399 0.05% 73 12757 0.05% 74 14272 0.06% 75 15895 0.06% 76 16592 0.07% 77 17031 0.07% 78 16293 0.07% 79 15202 0.06% 80 12577 0.05% 81 10911 0.04% 82 8490 0.03% 83 8458 0.03% 84 11531 0.05% 85 12097 0.05% 86 13682 0.06% 87 19347 0.08% 88 42653 0.17% 89 25948 0.11% 90 20445 0.08% 91 23524 0.10% 92 46000 0.19% 93 31729 0.13% 94 22593 0.09% 95 22324 0.09% 96 23367 0.09% 97 24972 0.10% 98 45045 0.18% 99 57947 0.24% 100 30866 0.13% 101 25273 0.10% 102 108334 0.44% 103 87443 0.35% 104 57432 0.23% 105 126765 0.51% 106 173111 0.70% 107 71885 0.29% 108 101019 0.41% 109 83274 0.34% 110 111890 0.45% 111 49609 0.20% 112 37952 0.15% 113 52309 0.21% 114 165184 0.67% 115 227213 0.92% 116 92977 0.38% 117 99158 0.40% 118 34336 0.14% 119 44543 0.18% 120 42521 0.17% 121 156474 0.63% 122 194545 0.79% 123 148951 0.60% 124 53801 0.22% 125 38446 0.16% 126 119500 0.48% 127 86056 0.35% 128 66190 0.27% 129 68511 0.28% 130 221915 0.90% 131 222567 0.90% 132 134541 0.55% 133 231836 0.94% 134 260771 1.06% 135 212678 0.86% 136 236806 0.96% 137 252178 1.02% 138 274209 1.11% 139 291346 1.18% 140 305496 1.24% 141 315509 1.28% 142 333536 1.35% 143 346209 1.40% 144 383015 1.55% 145 439713 1.78% 146 534982 2.17% 147 697589 2.83% 148 1063845 4.32% 149 3210768 13.02% 150 11225790 45.54% 24652857 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=17.08 fanout-score-rank=7 prefix-density=0.32 prefix-fanout=7.7 sequence=GCACCACCACCATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=190.50 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.4 sequence=AAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACCCTTTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGCTTCCCTGATTTCTCCAGTTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAATAAGTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.3 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=43 fanout-score=32.98 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.9 sequence=GATGAAATTGCCGCTGATCTAAAGGAGCATGTCATCAAGCCTGTTATCCCGGAGAAGTACCT SRR1799556 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:41:59 Started mapping on | Feb 13 22:41:59 Finished on | Feb 13 22:44:53 Mapping speed, Million of reads per hour | 510.06 Number of input reads | 24652857 Average input read length | 274 UNIQUE READS: Uniquely mapped reads number | 19734235 Uniquely mapped reads % | 80.05% Average mapped length | 271.92 Number of splices: Total | 16034123 Number of splices: Annotated (sjdb) | 15624356 Number of splices: GT/AG | 15720445 Number of splices: GC/AG | 187757 Number of splices: AT/AC | 13331 Number of splices: Non-canonical | 112590 Mismatch rate per base, % | 1.18% Deletion rate per base | 0.09% Deletion average length | 2.91 Insertion rate per base | 0.06% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 727851 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 38786 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.80% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4207491 4207491 4207491 N_multimapping 727851 727851 727851 N_noFeature 546916 19466282 658201 N_ambiguous 418322 2326 260495 UnstrandedReadsAssigned:18768997 PositiveStrandReadsAssigned:265627 NegativeStrandReadsAssigned:18815539 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=128 echo kmer=123 SRR1799556 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799556-trimmed-pair1.fastq SRR1799556-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,652,857 reads, 21,469,800 reads pseudoaligned [quant] estimated average fragment length: 175.658 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52401 SRR1799556.ke.tsv 34699 SRR1799556.se.tsv 87100 total ==> SRR1799556.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1843.34 378 11.3267 Potri.005G024800.1.v4.1 1035 860.342 210 13.4824 Potri.004G059700.1.v4.1 961 786.35 23 1.61559 Potri.007G009000.2.v4.1 1416 1241.34 0 0 Potri.003G141000.2.v4.1 2943 2768.34 283.043 5.64743 Potri.016G087400.1.v4.1 270 110.78 1973.91 984.206 Potri.015G069301.1.v4.1 564 389.845 0 0 Potri.010G195200.1.v4.1 1773 1598.34 27 0.933068 Potri.012G127500.1.v4.1 977 802.346 4373 301.049 ==> SRR1799556.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1108 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 411 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799556 completed mapping pipeline successfully