Starting /dee2/code/volunteer_pipeline.sh SRR1799557 current disk space = 3088650792960 free memory = 1418019016 SRR1799557 SRAfilesize fd4011ee1ed363138ae3244ca22d2bad SRR1799557.sra SRR1799557.sra file validated SRR1799557 is paired end SRR1799557 is conventional basespace SRR1799557 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799557_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51375 34.0 34.0 34.0 31.0 34.0 2 33.04225 34.0 34.0 34.0 31.0 34.0 3 33.44875 34.0 34.0 34.0 31.0 34.0 4 36.72775 37.0 37.0 37.0 35.0 37.0 5 36.7245 37.0 37.0 37.0 35.0 37.0 6 36.7665 37.0 37.0 37.0 37.0 37.0 7 36.77875 37.0 37.0 37.0 37.0 37.0 8 36.786 37.0 37.0 37.0 37.0 37.0 9 38.692 39.0 39.0 39.0 38.0 39.0 10-14 39.004 39.4 39.4 39.4 38.2 39.4 15-19 40.372499999999995 41.0 41.0 41.0 39.0 41.0 20-24 40.330200000000005 41.0 41.0 41.0 39.0 41.0 25-29 40.2539 41.0 40.4 41.0 39.0 41.0 30-34 40.0908 41.0 40.0 41.0 38.0 41.0 35-39 40.02095 41.0 40.0 41.0 38.0 41.0 40-44 39.89874999999999 41.0 40.0 41.0 38.0 41.0 45-49 39.6912 41.0 40.0 41.0 37.2 41.0 50-54 39.431549999999994 41.0 39.4 41.0 36.4 41.0 55-59 39.15495 41.0 39.0 41.0 35.2 41.0 60-64 38.9867 40.4 38.2 41.0 35.0 41.0 65-69 38.2601 39.2 36.6 41.0 35.0 41.0 70-74 37.2319 37.6 35.4 39.6 35.0 41.0 75-79 35.99815 36.2 34.8 37.8 33.8 39.4 80-84 35.32085 35.2 35.0 36.6 34.0 37.8 85-89 34.725699999999996 35.0 35.0 35.8 34.0 36.6 90-94 34.4462 35.0 35.0 35.0 34.0 36.0 95-99 34.30425 35.0 35.0 35.0 33.8 35.6 100-104 34.1286 35.0 35.0 35.0 33.0 35.0 105-109 34.0911 35.0 35.0 35.0 33.0 35.0 110-114 34.01625 35.0 35.0 35.0 33.0 35.0 115-119 33.9204 35.0 35.0 35.0 33.0 35.0 120-124 33.772450000000006 35.0 34.8 35.0 32.6 35.0 125-129 33.704449999999994 35.0 34.6 35.0 32.0 35.0 130-134 33.501850000000005 35.0 34.0 35.0 32.0 35.0 135-139 33.208999999999996 35.0 34.0 35.0 31.0 35.0 140-144 33.0363 35.0 34.0 35.0 30.6 35.0 145-149 32.69885 35.0 34.0 35.0 30.4 35.0 150 27.72575 34.0 25.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 2.0 11 0.0 12 2.0 13 2.0 14 1.0 15 2.0 16 4.0 17 0.0 18 3.0 19 3.0 20 6.0 21 5.0 22 6.0 23 5.0 24 11.0 25 14.0 26 12.0 27 18.0 28 17.0 29 18.0 30 27.0 31 30.0 32 46.0 33 68.0 34 109.0 35 204.0 36 924.0 37 2383.0 38 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.661498708010335 11.602067183462532 7.002583979328166 38.73385012919896 2 21.891418563922944 13.58518889166875 34.92619464598449 29.597197898423815 3 18.6 16.175 25.624999999999996 39.6 4 22.886443221610804 23.71185592796398 23.06153076538269 30.340170085042523 5 23.525 30.8 24.675 21.0 6 19.675 34.975 24.25 21.099999999999998 7 14.6 28.050000000000004 39.0 18.35 8 17.599999999999998 28.499999999999996 29.975 23.925 9 16.45 25.775 34.8 22.975 10-14 18.87 31.555 27.639999999999997 21.935 15-19 19.09 29.455 28.005000000000003 23.45 20-24 19.67 29.25 27.794999999999998 23.285 25-29 19.195 30.154999999999998 27.345000000000002 23.305 30-34 20.095 29.275000000000002 27.445000000000004 23.185 35-39 19.634999999999998 30.29 26.805 23.27 40-44 19.794999999999998 29.565 27.029999999999998 23.61 45-49 20.305 29.45 26.534999999999997 23.71 50-54 19.53 30.17 26.810000000000002 23.49 55-59 19.61 29.759999999999998 26.845000000000002 23.785 60-64 19.54 29.395 27.325 23.74 65-69 19.825 28.689999999999998 27.794999999999998 23.69 70-74 19.475 29.549999999999997 27.63 23.345 75-79 19.43 28.945 27.595 24.03 80-84 19.66 29.68 27.145000000000003 23.515 85-89 20.01 28.749999999999996 27.57 23.669999999999998 90-94 20.044999999999998 29.385 26.939999999999998 23.630000000000003 95-99 20.275000000000002 29.294999999999998 27.0 23.43 100-104 19.794999999999998 29.404999999999998 27.185 23.615 105-109 20.205000000000002 29.509999999999998 26.375 23.91 110-114 20.275000000000002 29.73 26.495 23.5 115-119 21.27 29.705 25.130000000000003 23.895 120-124 21.065 30.049999999999997 25.115 23.77 125-129 21.465 28.54 25.945 24.05 130-134 20.96 30.154999999999998 25.31 23.575 135-139 21.395 28.970000000000002 25.064999999999998 24.57 140-144 21.205 28.29 25.230000000000004 25.275 145-149 20.94 28.89 25.174999999999997 24.995 150 17.234468937875754 29.058116232464933 25.60120240480962 28.106212424849698 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 3.5 25 6.0 26 5.0 27 5.5 28 9.5 29 15.0 30 22.0 31 28.5 32 40.0 33 56.0 34 74.0 35 92.5 36 105.0 37 110.0 38 131.0 39 169.5 40 200.5 41 223.0 42 253.0 43 268.0 44 255.0 45 247.5 46 254.0 47 254.0 48 225.0 49 192.5 50 162.5 51 137.0 52 110.0 53 86.0 54 66.5 55 46.0 56 34.5 57 24.5 58 18.5 59 18.0 60 17.5 61 10.0 62 6.0 63 4.0 64 1.5 65 2.0 66 1.5 67 0.5 68 1.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.075 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 1.0499999999999998 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 90-91 1.675 0.0 0.0 0.0 0.0 92-93 1.9625 0.0 0.0 0.0 0.0 94-95 2.375 0.0 0.0 0.0 0.0 96-97 2.725 0.0 0.0 0.0 0.0 98-99 3.0250000000000004 0.0 0.0 0.0 0.0 100-101 3.5625 0.0 0.0 0.0 0.0 102-103 3.9875 0.0 0.0 0.0 0.0 104-105 4.4125 0.0 0.0 0.0 0.0 106-107 5.1625 0.0 0.0 0.0 0.0 108-109 6.375 0.0 0.0 0.0 0.0 110-111 7.25 0.0 0.0 0.0 0.0 112-113 8.175 0.0 0.0 0.0 0.0 114-115 9.100000000000001 0.0 0.0 0.0 0.0 116-117 10.100000000000001 0.0 0.0 0.0 0.0 118-119 11.1875 0.0 0.0 0.0 0.0 120-121 12.05 0.0 0.0 0.0 0.0 122-123 13.325 0.0 0.0 0.0 0.0 124-125 14.575 0.0 0.0 0.0 0.0 126-127 15.649999999999999 0.0 0.0 0.0 0.0 128-129 16.924999999999997 0.0 0.0 0.0 0.0 130-131 18.0375 0.0 0.0 0.0 0.0 132-133 19.5875 0.0 0.0 0.0 0.0 134-135 20.8875 0.0 0.0 0.0 0.0 136-137 22.299999999999997 0.0 0.0 0.0 0.0 138 23.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1799557 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799557_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9745 34.0 33.0 34.0 31.0 34.0 2 33.05875 34.0 34.0 34.0 31.0 34.0 3 33.162 34.0 34.0 34.0 31.0 34.0 4 36.36975 37.0 37.0 37.0 35.0 37.0 5 36.36825 37.0 37.0 37.0 35.0 37.0 6 36.16475 37.0 37.0 37.0 35.0 37.0 7 36.29975 37.0 37.0 37.0 35.0 37.0 8 36.31875 37.0 37.0 37.0 35.0 37.0 9 38.24575 39.0 39.0 39.0 38.0 39.0 10-14 38.5627 39.4 39.2 39.4 38.2 39.4 15-19 39.86995 41.0 40.0 41.0 38.4 41.0 20-24 39.84445 41.0 40.0 41.0 38.6 41.0 25-29 39.80105 41.0 40.0 41.0 38.0 41.0 30-34 39.696 41.0 40.0 41.0 38.0 41.0 35-39 39.4819 41.0 40.0 41.0 38.0 41.0 40-44 39.3351 41.0 40.0 41.0 37.2 41.0 45-49 39.140100000000004 41.0 39.8 41.0 36.8 41.0 50-54 38.35445 40.0 38.4 40.6 35.0 41.0 55-59 38.45119999999999 40.0 38.2 41.0 34.8 41.0 60-64 38.302600000000005 40.0 37.6 41.0 35.0 41.0 65-69 37.68245 39.0 36.4 41.0 35.0 41.0 70-74 36.66225000000001 37.2 35.2 39.6 34.4 41.0 75-79 35.534299999999995 36.0 35.0 37.8 33.8 39.4 80-84 34.5946 35.0 35.0 36.4 33.2 37.6 85-89 34.1152 35.0 35.0 35.6 33.0 36.4 90-94 33.842650000000006 35.0 35.0 35.0 33.0 36.0 95-99 33.689750000000004 35.0 35.0 35.0 32.8 35.4 100-104 33.534000000000006 35.0 35.0 35.0 32.0 35.0 105-109 33.449850000000005 35.0 35.0 35.0 32.0 35.0 110-114 33.2673 35.0 34.6 35.0 31.0 35.0 115-119 33.08795 35.0 34.0 35.0 30.8 35.0 120-124 32.8719 35.0 34.0 35.0 30.2 35.0 125-129 32.7411 35.0 34.0 35.0 29.6 35.0 130-134 32.6164 35.0 34.0 35.0 29.6 35.0 135-139 32.3022 35.0 33.6 35.0 28.6 35.0 140-144 31.930449999999997 35.0 33.0 35.0 26.6 35.0 145-149 31.48395 35.0 33.0 35.0 24.8 35.0 150 29.33075 34.0 29.0 35.0 15.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 2.0 4 2.0 5 1.0 6 2.0 7 4.0 8 2.0 9 2.0 10 3.0 11 2.0 12 2.0 13 1.0 14 3.0 15 3.0 16 3.0 17 8.0 18 7.0 19 4.0 20 7.0 21 4.0 22 10.0 23 15.0 24 10.0 25 11.0 26 9.0 27 18.0 28 17.0 29 27.0 30 28.0 31 41.0 32 51.0 33 59.0 34 116.0 35 297.0 36 1115.0 37 2026.0 38 54.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.866599799398195 20.486459378134402 11.885656970912738 28.761283851554666 2 25.31898924193145 27.1703777833375 31.07330497873405 16.437327995997 3 20.090067550662997 28.14610958218664 31.848886664998748 19.914936202151615 4 25.481370342585645 33.458364591147784 23.005751437859466 18.0545136284071 5 26.76338169084542 35.1175587793897 22.461230615307652 15.657828914457228 6 20.599999999999998 39.35 23.474999999999998 16.575 7 21.25 20.4 39.4 18.95 8 22.725 25.974999999999998 27.925 23.375 9 22.375 25.724999999999998 30.475 21.425 10-14 23.773566034905237 29.554433164974746 26.934040106015907 19.737960694104114 15-19 24.12 27.500000000000004 28.37 20.01 20-24 23.31 27.565 28.799999999999997 20.325 25-29 23.395 27.725 28.134999999999998 20.745 30-34 23.799999999999997 28.03 28.305000000000003 19.865 35-39 23.505000000000003 27.905 28.465 20.125 40-44 24.09 27.02 28.565 20.325 45-49 23.57 27.694999999999997 28.65 20.085 50-54 23.794999999999998 27.725 28.71 19.77 55-59 23.505000000000003 27.41 28.89 20.195 60-64 23.69 27.57 29.01 19.73 65-69 23.7 26.905 29.005 20.39 70-74 24.175 27.415 28.685 19.725 75-79 23.35 27.405 29.57 19.675 80-84 24.099999999999998 27.67 28.360000000000003 19.869999999999997 85-89 23.95 27.495000000000005 28.735 19.82 90-94 23.974999999999998 27.685 28.125 20.215 95-99 24.39 27.189999999999998 28.384999999999998 20.035 100-104 24.615000000000002 26.979999999999997 28.565 19.84 105-109 25.240000000000002 27.305 28.015 19.439999999999998 110-114 25.495 27.935 26.82 19.75 115-119 25.53021208483393 28.141256502601042 27.225890356142457 19.10264105642257 120-124 25.873881082162324 27.2890933640046 27.084062609391406 19.752962944441666 125-129 26.240000000000002 27.425 27.450000000000003 18.884999999999998 130-134 26.83 27.91 27.04 18.22 135-139 27.450000000000003 27.439999999999998 26.705000000000002 18.404999999999998 140-144 27.815 28.470000000000002 25.900000000000002 17.815 145-149 28.315 28.12 25.91 17.655 150 28.014095142209918 27.71205638056884 26.47873143720111 17.795117040020138 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.0 24 1.0 25 2.5 26 5.5 27 6.5 28 7.0 29 10.0 30 17.5 31 24.0 32 30.0 33 46.0 34 63.0 35 86.5 36 99.0 37 100.5 38 131.0 39 168.5 40 207.0 41 232.5 42 250.5 43 255.0 44 261.0 45 268.0 46 265.5 47 260.0 48 225.0 49 188.0 50 173.0 51 147.5 52 110.5 53 90.5 54 70.5 55 45.0 56 31.0 57 31.5 58 23.0 59 13.0 60 8.5 61 9.5 62 9.0 63 4.5 64 3.0 65 3.0 66 2.0 67 1.0 68 0.5 69 1.5 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.075 3 0.075 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.04 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 1.0499999999999998 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 90-91 1.675 0.0 0.0 0.0 0.0 92-93 2.0125 0.0 0.0 0.0 0.0 94-95 2.425 0.0 0.0 0.0 0.0 96-97 2.775 0.0 0.0 0.0 0.0 98-99 3.075 0.0 0.0 0.0 0.0 100-101 3.6125 0.0 0.0 0.0 0.0 102-103 4.012499999999999 0.0 0.0 0.0 0.0 104-105 4.425000000000001 0.0 0.0 0.0 0.0 106-107 5.1625 0.0 0.0 0.0 0.0 108-109 6.375 0.0 0.0 0.0 0.0 110-111 7.25 0.0 0.0 0.0 0.0 112-113 8.212499999999999 0.0 0.0 0.0 0.0 114-115 9.1625 0.0 0.0 0.0 0.0 116-117 10.2 0.0 0.0 0.0 0.0 118-119 11.3125 0.0 0.0 0.0 0.0 120-121 12.2 0.0 0.0 0.0 0.0 122-123 13.525 0.0 0.0 0.0 0.0 124-125 14.8125 0.0 0.0 0.0 0.0 126-127 15.95 0.0 0.0 0.0 0.0 128-129 17.175 0.0 0.0 0.0 0.0 130-131 18.2875 0.0 0.0 0.0 0.0 132-133 19.875 0.0 0.0 0.0 0.0 134-135 21.2125 0.0 0.0 0.0 0.0 136-137 22.6625 0.0 0.0 0.0 0.0 138 23.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATTG 10 0.006973645 144.0 3 CTAAAGG 10 0.006973645 144.0 1 >>END_MODULE Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184953 spots for SRR1799557.sra Written 1184953 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra Read 1184944 spots for SRR1799557.sra Written 1184944 spots for SRR1799557.sra SRR ids: ['SRR1799557.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_75i6nypd SRR1799557.sra spots: 23698889 blocks: [[1, 1184944], [1184945, 2369888], [2369889, 3554832], [3554833, 4739776], [4739777, 5924720], [5924721, 7109664], [7109665, 8294608], [8294609, 9479552], [9479553, 10664496], [10664497, 11849440], [11849441, 13034384], [13034385, 14219328], [14219329, 15404272], [15404273, 16589216], [16589217, 17774160], [17774161, 18959104], [18959105, 20144048], [20144049, 21328992], [21328993, 22513936], [22513937, 23698889]] SRR1799557 file size 7962788 SRR1799557 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799557 SRR1799557_1.fastq SRR1799557_2.fastq Input file: SRR1799557_1.fastq Paired file: SRR1799557_2.fastq trimmed: SRR1799557-trimmed-pair1.fastq, SRR1799557-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:38:31 2025 >> started Thu Feb 13 22:39:12 2025 >> done (40.820s) 23698889 read pairs processed; of these: 59925 ( 0.25%) short read pairs filtered out after trimming by size control 159584 ( 0.67%) empty read pairs filtered out after trimming by size control 23479380 (99.07%) read pairs available; of these: 11035782 (47.00%) trimmed read pairs available after processing 12443598 (53.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 8 0.00% 21 11 0.00% 22 14 0.00% 23 17 0.00% 24 29 0.00% 25 51 0.00% 26 48 0.00% 27 63 0.00% 28 85 0.00% 29 105 0.00% 30 110 0.00% 31 149 0.00% 32 173 0.00% 33 177 0.00% 34 215 0.00% 35 244 0.00% 36 297 0.00% 37 321 0.00% 38 342 0.00% 39 391 0.00% 40 444 0.00% 41 441 0.00% 42 474 0.00% 43 581 0.00% 44 549 0.00% 45 626 0.00% 46 647 0.00% 47 770 0.00% 48 823 0.00% 49 855 0.00% 50 925 0.00% 51 1055 0.00% 52 1181 0.01% 53 1239 0.01% 54 1374 0.01% 55 1495 0.01% 56 1658 0.01% 57 1916 0.01% 58 2052 0.01% 59 2316 0.01% 60 2515 0.01% 61 2810 0.01% 62 3194 0.01% 63 3446 0.01% 64 3886 0.02% 65 4141 0.02% 66 4600 0.02% 67 5101 0.02% 68 5726 0.02% 69 6294 0.03% 70 7026 0.03% 71 7987 0.03% 72 9055 0.04% 73 10189 0.04% 74 11376 0.05% 75 12766 0.05% 76 14380 0.06% 77 15224 0.06% 78 16880 0.07% 79 18457 0.08% 80 19836 0.08% 81 21556 0.09% 82 23346 0.10% 83 24908 0.11% 84 28655 0.12% 85 29783 0.13% 86 32298 0.14% 87 37695 0.16% 88 45884 0.20% 89 52290 0.22% 90 39136 0.17% 91 41653 0.18% 92 30296 0.13% 93 41586 0.18% 94 50117 0.21% 95 51314 0.22% 96 53812 0.23% 97 53116 0.23% 98 51230 0.22% 99 66087 0.28% 100 74747 0.32% 101 63772 0.27% 102 69485 0.30% 103 76962 0.33% 104 85992 0.37% 105 122151 0.52% 106 123002 0.52% 107 136578 0.58% 108 112478 0.48% 109 137695 0.59% 110 122996 0.52% 111 141693 0.60% 112 146955 0.63% 113 145115 0.62% 114 147465 0.63% 115 164806 0.70% 116 139800 0.60% 117 144421 0.62% 118 117530 0.50% 119 126304 0.54% 120 124667 0.53% 121 139902 0.60% 122 169355 0.72% 123 157698 0.67% 124 170964 0.73% 125 160581 0.68% 126 140747 0.60% 127 159464 0.68% 128 148863 0.63% 129 181436 0.77% 130 178482 0.76% 131 186303 0.79% 132 188905 0.80% 133 185147 0.79% 134 187947 0.80% 135 187793 0.80% 136 194314 0.83% 137 195405 0.83% 138 197001 0.84% 139 201683 0.86% 140 201998 0.86% 141 206501 0.88% 142 209867 0.89% 143 213152 0.91% 144 222718 0.95% 145 238408 1.02% 146 264018 1.12% 147 317172 1.35% 148 447292 1.91% 149 1874125 7.98% 150 12443598 53.00% 23479380 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.9 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=191.93 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.4 sequence=AAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACCCTTTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGCTTCCCTGATTTCTCCAGTTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAATAAGTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.21 fanout-score-rank=17 prefix-density=0.23 prefix-fanout=3.9 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=40.54 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.8 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCACTTATTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAACTGGAGAAATCAGGGAAGCATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAAAGGGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT SRR1799557 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:40:22 Started mapping on | Feb 13 22:40:22 Finished on | Feb 13 22:44:40 Mapping speed, Million of reads per hour | 327.62 Number of input reads | 23479380 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 22119354 Uniquely mapped reads % | 94.21% Average mapped length | 277.24 Number of splices: Total | 17606141 Number of splices: Annotated (sjdb) | 17171457 Number of splices: GT/AG | 17269006 Number of splices: GC/AG | 214200 Number of splices: AT/AC | 14863 Number of splices: Non-canonical | 108072 Mismatch rate per base, % | 1.14% Deletion rate per base | 0.11% Deletion average length | 2.94 Insertion rate per base | 0.07% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 797216 % of reads mapped to multiple loci | 3.40% Number of reads mapped to too many loci | 48884 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 590557 590557 590557 N_multimapping 797216 797216 797216 N_noFeature 610566 21794683 759647 N_ambiguous 284660 1191 108599 UnstrandedReadsAssigned:21224128 PositiveStrandReadsAssigned:323480 NegativeStrandReadsAssigned:21251108 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=130 echo kmer=125 SRR1799557 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799557-trimmed-pair1.fastq SRR1799557-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,479,380 reads, 20,717,903 reads pseudoaligned [quant] estimated average fragment length: 177.63 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,278 rounds 52401 SRR1799557.ke.tsv 34699 SRR1799557.se.tsv 87100 total ==> SRR1799557.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.37 361 10.63 Potri.005G024800.1.v4.1 1035 858.37 232 14.6548 Potri.004G059700.1.v4.1 961 784.381 30 2.07378 Potri.007G009000.2.v4.1 1416 1239.37 0 0 Potri.003G141000.2.v4.1 2943 2766.37 299.174 5.86383 Potri.016G087400.1.v4.1 270 109.931 2021 996.817 Potri.015G069301.1.v4.1 564 387.935 0 0 Potri.010G195200.1.v4.1 1773 1596.37 27 0.91706 Potri.012G127500.1.v4.1 977 800.375 4328 293.198 ==> SRR1799557.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1290 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 410 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR1799557 completed mapping pipeline successfully