Starting /dee2/code/volunteer_pipeline.sh SRR1799558 current disk space = 3089321160704 free memory = 1559440104 SRR1799558 SRAfilesize 8c0921c068211d0468a18e3944575aa4 SRR1799558.sra SRR1799558.sra file validated SRR1799558 is paired end SRR1799558 is conventional basespace SRR1799558 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21725 34.0 34.0 34.0 31.0 34.0 2 33.44275 34.0 34.0 34.0 31.0 34.0 3 33.591 34.0 34.0 34.0 31.0 34.0 4 36.80075 37.0 37.0 37.0 37.0 37.0 5 36.7195 37.0 37.0 37.0 37.0 37.0 6 36.793 37.0 37.0 37.0 37.0 37.0 7 36.77175 37.0 37.0 37.0 37.0 37.0 8 36.7695 37.0 37.0 37.0 37.0 37.0 9 38.7155 39.0 39.0 39.0 39.0 39.0 10-14 39.06015 39.4 39.4 39.4 38.6 39.4 15-19 40.43205 41.0 41.0 41.0 39.2 41.0 20-24 40.392250000000004 41.0 40.6 41.0 39.0 41.0 25-29 40.325 41.0 40.0 41.0 39.0 41.0 30-34 40.2222 41.0 40.0 41.0 38.6 41.0 35-39 40.0413 41.0 40.0 41.0 38.0 41.0 40-44 40.05695 41.0 40.0 41.0 38.0 41.0 45-49 40.1217 41.0 40.0 41.0 38.2 41.0 50-54 39.9605 41.0 40.0 41.0 37.8 41.0 55-59 39.61895 41.0 39.4 41.0 36.6 41.0 60-64 39.1598 40.6 38.2 41.0 35.4 41.0 65-69 38.39035 39.4 36.6 41.0 35.0 41.0 70-74 37.37115 37.6 35.4 39.6 35.0 41.0 75-79 35.925349999999995 36.0 34.8 37.4 33.6 39.4 80-84 35.47510000000001 35.2 35.0 36.6 34.0 37.8 85-89 34.91525 35.0 35.0 35.8 34.0 36.6 90-94 34.5925 35.0 35.0 35.0 34.0 36.0 95-99 34.41179999999999 35.0 35.0 35.0 34.0 35.4 100-104 34.33905 35.0 35.0 35.0 34.0 35.0 105-109 34.272299999999994 35.0 35.0 35.0 33.4 35.0 110-114 34.1459 35.0 35.0 35.0 33.0 35.0 115-119 34.09865 35.0 35.0 35.0 33.0 35.0 120-124 33.9413 35.0 34.2 35.0 32.8 35.0 125-129 33.77565 35.0 34.0 35.0 32.2 35.0 130-134 33.637800000000006 35.0 34.0 35.0 32.0 35.0 135-139 33.427949999999996 35.0 34.0 35.0 31.4 35.0 140-144 33.112199999999994 35.0 34.0 35.0 31.0 35.0 145-149 32.2589 35.0 33.2 35.0 28.8 35.0 150 27.8175 31.0 25.0 34.0 16.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 2.0 20 1.0 21 4.0 22 5.0 23 5.0 24 6.0 25 8.0 26 6.0 27 6.0 28 15.0 29 16.0 30 23.0 31 28.0 32 28.0 33 59.0 34 117.0 35 270.0 36 991.0 37 2361.0 38 37.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.67683387950592 13.435845727249813 6.251575497857323 34.63574489538694 2 23.825 13.875000000000002 34.275 28.025 3 19.725 19.0 26.775 34.5 4 22.825 26.400000000000002 24.05 26.724999999999998 5 23.45 31.2 23.875 21.475 6 19.3 35.85 23.275000000000002 21.575 7 14.149999999999999 27.625 41.375 16.85 8 17.075000000000003 27.125 31.574999999999996 24.224999999999998 9 16.975 24.675 33.875 24.474999999999998 10-14 19.525000000000002 31.085 26.695 22.695 15-19 19.67 29.770000000000003 27.224999999999998 23.335 20-24 19.475 30.470000000000002 26.840000000000003 23.215 25-29 19.31 30.595 27.38 22.715 30-34 19.62 30.014999999999997 27.35 23.015 35-39 19.93 29.365000000000002 26.790000000000003 23.915 40-44 19.865 30.159999999999997 26.655 23.32 45-49 19.765 29.98 26.590000000000003 23.665 50-54 20.285 30.06 26.75 22.905 55-59 19.7 29.459999999999997 27.084999999999997 23.755000000000003 60-64 20.055 29.360000000000003 27.084999999999997 23.5 65-69 20.23 30.009999999999998 26.88 22.88 70-74 20.49 29.62 26.939999999999998 22.95 75-79 19.723875744084836 29.3432044419989 27.357310789855433 23.575609024060828 80-84 20.267026702670268 28.95289528952895 27.33273327332733 23.447344734473447 85-89 20.035 30.005 26.974999999999998 22.985 90-94 20.397238343005803 29.41765059035421 26.360816489893935 23.82429457674605 95-99 20.724325946676004 29.193136911610225 26.45190335651043 23.630633785203344 100-104 20.096028808642593 28.92367710313094 27.243172951885562 23.737121136340903 105-109 19.953979290680806 29.683357510879897 26.456905607523385 23.905757590915915 110-114 20.83958771139798 29.44060842589813 26.273391373961775 23.44641248874212 115-119 21.43857543017207 29.39675870348139 25.36514605842337 23.79951980792317 120-124 20.805 28.904999999999998 25.805 24.485 125-129 20.175 28.249999999999996 26.22 25.355 130-134 21.22 27.87 26.66 24.25 135-139 20.39621791985592 28.58071939566762 25.76917304517485 25.25388963930161 140-144 21.172117211721172 29.53795379537954 24.34743474347435 24.942494249424943 145-149 21.6 29.310000000000002 23.535 25.555 150 20.349999999999998 28.575 24.125 26.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 5.5 25 4.5 26 4.5 27 7.0 28 9.5 29 16.0 30 26.0 31 35.5 32 51.0 33 65.0 34 70.0 35 93.5 36 115.0 37 113.5 38 122.5 39 145.5 40 189.5 41 213.0 42 219.0 43 246.5 44 258.5 45 268.5 46 274.5 47 251.5 48 227.5 49 199.5 50 162.0 51 131.5 52 105.0 53 89.0 54 66.5 55 46.5 56 39.5 57 27.5 58 19.0 59 15.0 60 8.0 61 6.5 62 11.5 63 9.5 64 3.0 65 6.5 66 7.5 67 2.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.045 80-84 0.01 85-89 0.0 90-94 0.06 95-99 0.045 100-104 0.03 105-109 0.045 110-114 0.06999999999999999 115-119 0.04 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.055 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.45 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 1.9875 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.8499999999999996 0.0 0.0 0.0 0.0 104-105 3.35 0.0 0.0 0.0 0.0 106-107 4.449999999999999 0.0 0.0 0.0 0.0 108-109 5.5 0.0 0.0 0.0 0.0 110-111 6.4375 0.0 0.0 0.0 0.0 112-113 7.2125 0.0 0.0 0.0 0.0 114-115 7.9 0.0 0.0 0.0 0.0 116-117 9.0 0.0 0.0 0.0 0.0 118-119 9.162500000000001 0.0 0.0 0.0 0.0 120-121 9.1875 0.0 0.0 0.0 0.0 122-123 9.575 0.0 0.0 0.0 0.0 124-125 10.8625 0.0 0.0 0.0 0.0 126-127 11.55 0.0 0.0 0.0 0.0 128-129 12.225 0.0 0.0 0.0 0.0 130-131 12.9375 0.0 0.0 0.0 0.0 132-133 13.85 0.0 0.0 0.0 0.0 134-135 15.7125 0.0 0.0 0.0 0.0 136-137 17.375 0.0 0.0 0.0 0.0 138 18.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTTT 10 0.006973645 144.0 8 AGCTCTT 10 0.006973645 144.0 8 TAGCTCT 10 0.006973645 144.0 7 AAAAAAA 95 3.5116296E-5 13.642105 140-144 GGAAGAG 85 0.003342231 11.858823 140-144 CGGAAGA 90 0.0051234453 11.2 140-144 TCGGAAG 95 0.0076621785 10.610526 140-144 >>END_MODULE SRR1799558 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799558_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8675 34.0 33.0 34.0 31.0 34.0 2 32.96875 34.0 34.0 34.0 31.0 34.0 3 33.0315 34.0 34.0 34.0 31.0 34.0 4 36.16675 37.0 37.0 37.0 35.0 37.0 5 36.19575 37.0 37.0 37.0 35.0 37.0 6 36.226 37.0 37.0 37.0 36.0 37.0 7 36.20025 37.0 37.0 37.0 36.0 37.0 8 36.18175 37.0 37.0 37.0 35.0 37.0 9 38.048 39.0 39.0 39.0 38.0 39.0 10-14 38.39390000000001 39.4 39.4 39.4 38.2 39.4 15-19 39.71355 41.0 40.6 41.0 38.6 41.0 20-24 39.68475 41.0 40.0 41.0 38.8 41.0 25-29 39.5887 41.0 40.0 41.0 38.2 41.0 30-34 39.44895 41.0 40.0 41.0 38.0 41.0 35-39 39.34654999999999 41.0 40.0 41.0 38.0 41.0 40-44 39.22205 41.0 40.0 41.0 37.6 41.0 45-49 39.17005 41.0 40.0 41.0 37.2 41.0 50-54 38.34325 39.8 38.6 40.6 35.6 40.8 55-59 38.6269 40.8 39.0 41.0 35.0 41.0 60-64 37.988 39.8 37.4 41.0 34.8 41.0 65-69 37.46419999999999 39.0 36.4 41.0 35.0 41.0 70-74 36.4168 37.2 35.2 39.2 34.4 41.0 75-79 35.425599999999996 36.0 35.0 37.8 34.0 39.4 80-84 34.626999999999995 35.0 35.0 36.4 34.0 37.8 85-89 34.111200000000004 35.0 35.0 35.6 33.2 36.4 90-94 33.85645000000001 35.0 35.0 35.0 33.0 36.0 95-99 33.6592 35.0 35.0 35.0 33.0 35.4 100-104 33.52335 35.0 35.0 35.0 32.4 35.0 105-109 33.421350000000004 35.0 34.8 35.0 32.0 35.0 110-114 33.3054 35.0 34.0 35.0 31.8 35.0 115-119 33.185550000000006 35.0 34.0 35.0 31.0 35.0 120-124 33.017399999999995 35.0 34.0 35.0 30.8 35.0 125-129 32.7817 35.0 34.0 35.0 30.0 35.0 130-134 32.561249999999994 35.0 34.0 35.0 29.4 35.0 135-139 32.24305 35.0 33.2 35.0 28.6 35.0 140-144 31.775649999999995 35.0 33.0 35.0 26.8 35.0 145-149 31.0468 34.8 32.6 35.0 23.2 35.0 150 26.9635 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 58.0 3 4.0 4 2.0 5 2.0 6 1.0 7 3.0 8 3.0 9 3.0 10 2.0 11 2.0 12 4.0 13 2.0 14 2.0 15 3.0 16 2.0 17 2.0 18 1.0 19 3.0 20 3.0 21 2.0 22 9.0 23 5.0 24 7.0 25 7.0 26 7.0 27 13.0 28 14.0 29 19.0 30 32.0 31 28.0 32 40.0 33 82.0 34 147.0 35 305.0 36 1196.0 37 1927.0 38 58.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.199999999999996 22.6 10.549999999999999 24.65 2 27.325 26.950000000000003 30.7 15.024999999999999 3 21.224999999999998 27.55 31.1 20.125 4 26.200000000000003 32.550000000000004 23.825 17.424999999999997 5 25.3 36.3 22.55 15.85 6 20.674999999999997 37.8 24.025 17.5 7 21.875 19.975 38.525 19.625 8 21.325 25.650000000000002 29.775000000000002 23.25 9 22.236118059029515 24.662331165582792 30.61530765382691 22.486243121560783 10-14 23.5997199439888 28.985797159431886 26.750350070014 20.66413282656531 15-19 23.565 28.389999999999997 27.275 20.77 20-24 23.68 27.755000000000003 28.165000000000003 20.4 25-29 23.330000000000002 27.744999999999997 28.000000000000004 20.925 30-34 23.269307723089234 27.906162464985997 28.38635454181673 20.438175270108044 35-39 23.200000000000003 27.389999999999997 28.544999999999998 20.865000000000002 40-44 23.935000000000002 27.67 28.04 20.355 45-49 23.89172420694486 26.943860702491744 28.760132092464723 20.40428299809867 50-54 23.774509803921568 27.73609443777511 28.52140856342537 19.96798719487795 55-59 23.642364236423642 26.997699769976997 28.802880288028803 20.557055705570555 60-64 23.763317161006352 27.854749162206772 28.33491722102736 20.04701645575952 65-69 23.848346921422497 27.91977192017206 28.59500825288851 19.63687290551693 70-74 23.385200380247163 27.397808575574125 28.7887126632311 20.428278380947614 75-79 23.13078269567392 27.576894223555886 28.892223055763942 20.400100025006253 80-84 23.044999999999998 26.945000000000004 29.74 20.27 85-89 24.033411694092933 27.684689641374483 28.304906717351074 19.976991947181514 90-94 23.880000000000003 26.99 28.665000000000003 20.465 95-99 23.865 26.985 29.065 20.085 100-104 24.6 27.165 28.804999999999996 19.43 105-109 24.2248449689938 27.545509101820365 28.370674134826967 19.858971794358872 110-114 24.98 27.415 28.305000000000003 19.3 115-119 25.1 28.299999999999997 27.755000000000003 18.845 120-124 25.392617785335602 26.63298989696909 28.173452035610687 19.800940282084625 125-129 25.508928124843695 27.43460211073876 27.869754414044916 19.18671535037263 130-134 25.878881832274843 28.20423063459519 27.57913687053058 18.33775066259939 135-139 26.427642764276428 28.12281228122812 27.547754775477546 17.9017901790179 140-144 26.1907144286572 28.447068240944567 26.91614968981389 18.446067640584353 145-149 28.10607955966975 27.135351513635225 25.624218163622718 19.134350763072305 150 28.621466099574683 27.1703777833375 25.293970477858394 18.914185639229423 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.5 14 1.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 0.5 23 1.5 24 3.0 25 3.0 26 4.5 27 7.0 28 9.0 29 13.0 30 14.0 31 17.0 32 30.5 33 40.5 34 53.0 35 64.5 36 94.0 37 127.5 38 146.5 39 170.0 40 191.5 41 211.0 42 234.5 43 259.0 44 263.0 45 255.5 46 274.5 47 264.5 48 219.0 49 193.0 50 166.0 51 147.0 52 122.5 53 95.0 54 72.0 55 52.0 56 40.5 57 29.5 58 20.5 59 15.5 60 12.5 61 10.5 62 9.5 63 7.5 64 4.5 65 2.5 66 4.0 67 3.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.04 35-39 0.0 40-44 0.0 45-49 0.06999999999999999 50-54 0.04 55-59 0.01 60-64 0.034999999999999996 65-69 0.034999999999999996 70-74 0.065 75-79 0.025 80-84 0.0 85-89 0.034999999999999996 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.034999999999999996 130-134 0.015 135-139 0.01 140-144 0.06 145-149 0.075 150 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.45 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 1.9875 0.0 0.0 0.0 0.0 100-101 2.275 0.0 0.0 0.0 0.0 102-103 2.8875 0.0 0.0 0.0 0.0 104-105 3.4 0.0 0.0 0.0 0.0 106-107 4.5 0.0 0.0 0.0 0.0 108-109 5.65 0.0 0.0 0.0 0.0 110-111 6.612500000000001 0.0 0.0 0.0 0.0 112-113 7.387499999999999 0.0 0.0 0.0 0.0 114-115 8.0875 0.0 0.0 0.0 0.0 116-117 9.149999999999999 0.0 0.0 0.0 0.0 118-119 9.3125 0.0 0.0 0.0 0.0 120-121 9.337499999999999 0.0 0.0 0.0 0.0 122-123 9.725 0.0 0.0 0.0 0.0 124-125 11.0125 0.0 0.0 0.0 0.0 126-127 11.725 0.0 0.0 0.0 0.0 128-129 12.425 0.0 0.0 0.0 0.0 130-131 13.1625 0.0 0.0 0.0 0.0 132-133 14.075 0.0 0.0 0.0 0.0 134-135 15.9375 0.0 0.0 0.0 0.0 136-137 17.6 0.0 0.0 0.0 0.0 138 19.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTTGA 10 0.006973645 144.0 8 CGGAAGA 80 0.0021206664 12.599999 140-144 GGAAGAG 80 0.0021206664 12.599999 140-144 TCGGAAG 85 0.003342231 11.858823 140-144 >>END_MODULE Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847497 spots for SRR1799558.sra Written 847497 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra Read 847489 spots for SRR1799558.sra Written 847489 spots for SRR1799558.sra SRR ids: ['SRR1799558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xm1rizc8 SRR1799558.sra spots: 16949788 blocks: [[1, 847489], [847490, 1694978], [1694979, 2542467], [2542468, 3389956], [3389957, 4237445], [4237446, 5084934], [5084935, 5932423], [5932424, 6779912], [6779913, 7627401], [7627402, 8474890], [8474891, 9322379], [9322380, 10169868], [10169869, 11017357], [11017358, 11864846], [11864847, 12712335], [12712336, 13559824], [13559825, 14407313], [14407314, 15254802], [15254803, 16102291], [16102292, 16949788]] SRR1799558 file size 5688921 SRR1799558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799558 SRR1799558_1.fastq SRR1799558_2.fastq Input file: SRR1799558_1.fastq Paired file: SRR1799558_2.fastq trimmed: SRR1799558-trimmed-pair1.fastq, SRR1799558-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:18:30 2025 >> started Thu Feb 13 23:18:48 2025 >> done (18.055s) 16949788 read pairs processed; of these: 61251 ( 0.36%) short read pairs filtered out after trimming by size control 238446 ( 1.41%) empty read pairs filtered out after trimming by size control 16650091 (98.23%) read pairs available; of these: 7186197 (43.16%) trimmed read pairs available after processing 9463894 (56.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 9 0.00% 23 13 0.00% 24 19 0.00% 25 13 0.00% 26 32 0.00% 27 26 0.00% 28 65 0.00% 29 54 0.00% 30 51 0.00% 31 73 0.00% 32 77 0.00% 33 111 0.00% 34 116 0.00% 35 168 0.00% 36 160 0.00% 37 187 0.00% 38 236 0.00% 39 255 0.00% 40 268 0.00% 41 283 0.00% 42 330 0.00% 43 351 0.00% 44 400 0.00% 45 396 0.00% 46 443 0.00% 47 490 0.00% 48 548 0.00% 49 605 0.00% 50 738 0.00% 51 728 0.00% 52 828 0.00% 53 906 0.01% 54 924 0.01% 55 1024 0.01% 56 1186 0.01% 57 1358 0.01% 58 1669 0.01% 59 2884 0.02% 60 2036 0.01% 61 2108 0.01% 62 2369 0.01% 63 2680 0.02% 64 3060 0.02% 65 3416 0.02% 66 3883 0.02% 67 4936 0.03% 68 5413 0.03% 69 5438 0.03% 70 6179 0.04% 71 6969 0.04% 72 7918 0.05% 73 9126 0.05% 74 10142 0.06% 75 11174 0.07% 76 12127 0.07% 77 12464 0.07% 78 12128 0.07% 79 11745 0.07% 80 9868 0.06% 81 8321 0.05% 82 7185 0.04% 83 6001 0.04% 84 8749 0.05% 85 8642 0.05% 86 9220 0.06% 87 10130 0.06% 88 11254 0.07% 89 18848 0.11% 90 36021 0.22% 91 22866 0.14% 92 19234 0.12% 93 18060 0.11% 94 55172 0.33% 95 40446 0.24% 96 15997 0.10% 97 25536 0.15% 98 28639 0.17% 99 20317 0.12% 100 58510 0.35% 101 72550 0.44% 102 28904 0.17% 103 19904 0.12% 104 124705 0.75% 105 91394 0.55% 106 54176 0.33% 107 95791 0.58% 108 133614 0.80% 109 42082 0.25% 110 76464 0.46% 111 33022 0.20% 112 89758 0.54% 113 64409 0.39% 114 27193 0.16% 115 147405 0.89% 116 31649 0.19% 117 27865 0.17% 118 13765 0.08% 119 12244 0.07% 120 13928 0.08% 121 48169 0.29% 122 37065 0.22% 123 143426 0.86% 124 145367 0.87% 125 93509 0.56% 126 41073 0.25% 127 29791 0.18% 128 113697 0.68% 129 62403 0.37% 130 52776 0.32% 131 77826 0.47% 132 159888 0.96% 133 161609 0.97% 134 135529 0.81% 135 172734 1.04% 136 181399 1.09% 137 175895 1.06% 138 176006 1.06% 139 181351 1.09% 140 180633 1.08% 141 188810 1.13% 142 192542 1.16% 143 197465 1.19% 144 211919 1.27% 145 221827 1.33% 146 252522 1.52% 147 308041 1.85% 148 404345 2.43% 149 1045394 6.28% 150 9463894 56.84% 16650091 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=14.72 fanout-score-rank=10 prefix-density=0.35 prefix-fanout=7.2 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=423.02 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=20.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.98 fanout-score-rank=24 prefix-density=0.21 prefix-fanout=4.5 sequence=CAGCACCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=246.99 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=14.5 sequence=TGGTGGTGGAGCCAACACTTTGGCCGATGGGTTCAGCACCGGCACTGGATTGGGTGCTGAGATCATTG SRR1799558 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:19:33 Started mapping on | Feb 13 23:19:33 Finished on | Feb 13 23:20:41 Mapping speed, Million of reads per hour | 881.48 Number of input reads | 16650091 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 16088361 Uniquely mapped reads % | 96.63% Average mapped length | 282.60 Number of splices: Total | 12239935 Number of splices: Annotated (sjdb) | 12003287 Number of splices: GT/AG | 12039717 Number of splices: GC/AG | 150521 Number of splices: AT/AC | 12623 Number of splices: Non-canonical | 37074 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.04% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323990 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 44232 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 256879 256879 256879 N_multimapping 323990 323990 323990 N_noFeature 497420 15869077 596344 N_ambiguous 180181 1051 59116 UnstrandedReadsAssigned:15410760 PositiveStrandReadsAssigned:218233 NegativeStrandReadsAssigned:15432901 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR1799558 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799558-trimmed-pair1.fastq SRR1799558-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,650,091 reads, 15,434,712 reads pseudoaligned [quant] estimated average fragment length: 180.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR1799558.ke.tsv 34699 SRR1799558.se.tsv 87100 total ==> SRR1799558.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.5 304 10.9879 Potri.005G024800.1.v4.1 1035 855.502 49 3.8061 Potri.004G059700.1.v4.1 961 781.502 43 3.65631 Potri.007G009000.2.v4.1 1416 1236.5 0 0 Potri.003G141000.2.v4.1 2943 2763.5 231.061 5.55613 Potri.016G087400.1.v4.1 270 105.07 1798.65 1137.55 Potri.015G069301.1.v4.1 564 384.916 0 0 Potri.010G195200.1.v4.1 1773 1593.5 47 1.95997 Potri.012G127500.1.v4.1 977 797.502 6478 539.777 ==> SRR1799558.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1559 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799558 completed mapping pipeline successfully