Starting /dee2/code/volunteer_pipeline.sh SRR1799559 current disk space = 3089289297920 free memory = 1407498300 SRR1799559 SRAfilesize 23c02c0af78cc702cf7a8d700070e40e SRR1799559.sra SRR1799559.sra file validated SRR1799559 is paired end SRR1799559 is conventional basespace SRR1799559 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799559_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.43225 34.0 34.0 34.0 31.0 34.0 2 33.565 34.0 34.0 34.0 31.0 34.0 3 33.59925 34.0 34.0 34.0 31.0 34.0 4 36.781 37.0 37.0 37.0 37.0 37.0 5 36.76075 37.0 37.0 37.0 37.0 37.0 6 36.7765 37.0 37.0 37.0 37.0 37.0 7 36.75575 37.0 37.0 37.0 37.0 37.0 8 36.75175 37.0 37.0 37.0 37.0 37.0 9 38.6835 39.0 39.0 39.0 38.0 39.0 10-14 39.0042 39.4 39.2 39.4 38.2 39.4 15-19 40.37665 41.0 40.6 41.0 39.0 41.0 20-24 40.30765 41.0 40.0 41.0 39.0 41.0 25-29 40.2259 41.0 40.0 41.0 38.6 41.0 30-34 40.08240000000001 41.0 40.0 41.0 38.0 41.0 35-39 39.916650000000004 41.0 40.0 41.0 38.0 41.0 40-44 39.9416 41.0 40.0 41.0 38.0 41.0 45-49 40.08845 41.0 40.0 41.0 38.0 41.0 50-54 39.901300000000006 41.0 40.0 41.0 37.8 41.0 55-59 39.608900000000006 41.0 39.6 41.0 36.8 41.0 60-64 39.062599999999996 40.4 38.4 41.0 35.2 41.0 65-69 38.2521 39.2 36.6 41.0 35.0 41.0 70-74 37.246249999999996 37.6 35.4 39.4 35.0 41.0 75-79 35.746300000000005 36.0 34.8 37.4 33.4 39.4 80-84 35.34655 35.2 35.0 36.6 34.0 37.8 85-89 34.79135 35.0 35.0 35.8 34.0 36.6 90-94 34.465199999999996 35.0 35.0 35.0 34.0 36.0 95-99 34.30045 35.0 35.0 35.0 33.6 35.4 100-104 34.22865 35.0 35.0 35.0 33.0 35.0 105-109 34.17035 35.0 35.0 35.0 33.0 35.0 110-114 34.018150000000006 35.0 34.6 35.0 33.0 35.0 115-119 33.96835 35.0 34.4 35.0 33.0 35.0 120-124 33.744949999999996 35.0 34.0 35.0 32.0 35.0 125-129 33.64785 35.0 34.0 35.0 31.8 35.0 130-134 33.4292 35.0 34.0 35.0 31.0 35.0 135-139 33.1346 35.0 34.0 35.0 30.4 35.0 140-144 32.77395 35.0 33.4 35.0 29.6 35.0 145-149 32.09505 34.6 33.0 35.0 28.6 35.0 150 25.70825 32.0 19.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 4.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 1.0 15 5.0 16 3.0 17 3.0 18 0.0 19 4.0 20 1.0 21 1.0 22 1.0 23 5.0 24 2.0 25 5.0 26 7.0 27 6.0 28 8.0 29 17.0 30 20.0 31 27.0 32 45.0 33 63.0 34 140.0 35 290.0 36 1219.0 37 2097.0 38 19.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.29681624467285 11.4063675106543 7.5708197543243925 36.72599649034846 2 23.599999999999998 13.125 32.550000000000004 30.725 3 20.9 16.225 24.55 38.324999999999996 4 23.625 23.849999999999998 22.6 29.925 5 24.55 29.15 23.525 22.775000000000002 6 19.7 36.7 21.9 21.7 7 16.125 28.849999999999998 37.3 17.724999999999998 8 16.7 28.275 31.374999999999996 23.65 9 16.725 25.95 34.675 22.650000000000002 10-14 19.52 31.22 26.779999999999998 22.48 15-19 19.41 29.87 27.250000000000004 23.47 20-24 19.185 30.61 26.47 23.735 25-29 19.830000000000002 29.744999999999997 26.939999999999998 23.485 30-34 19.139999999999997 29.74 27.425 23.695 35-39 19.455 29.345 27.26 23.94 40-44 19.055 29.794999999999998 27.805000000000003 23.345 45-49 19.245 29.770000000000003 27.51 23.474999999999998 50-54 19.759999999999998 30.12 26.735 23.385 55-59 19.759999999999998 29.365000000000002 27.365000000000002 23.51 60-64 19.865 29.7 26.985 23.45 65-69 19.78 29.675 27.295 23.25 70-74 20.415 29.175 26.939999999999998 23.47 75-79 19.919999999999998 29.385 26.640000000000004 24.055 80-84 20.125 29.225 27.150000000000002 23.5 85-89 19.945 29.125 26.919999999999998 24.01 90-94 20.39907981596319 29.180836167233448 26.56531306261252 23.854770954190837 95-99 19.873974794958993 29.38087617523505 26.780356071214246 23.96479295859172 100-104 20.24702470247025 28.587858785878588 27.29272927292729 23.87238723872387 105-109 20.502050205020502 28.85788578857886 26.6026602660266 24.03740374037404 110-114 20.143057222889155 29.28171268507403 26.935774309723893 23.639455782312925 115-119 19.88397679535907 29.070814162832566 26.9503900780156 24.094818963792758 120-124 20.57 28.560000000000002 26.724999999999998 24.145 125-129 20.605 28.325 27.295 23.775 130-134 20.16 29.049999999999997 27.1 23.69 135-139 21.43071535767884 28.954477238619308 25.752876438219108 23.861930965482742 140-144 21.76717671767177 29.487948794879486 25.48754875487549 23.257325732573257 145-149 22.96 29.415000000000003 24.915000000000003 22.71 150 18.575 31.5 25.45 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 4.0 26 6.0 27 6.5 28 12.0 29 14.0 30 17.5 31 33.0 32 42.5 33 48.0 34 61.5 35 80.5 36 94.5 37 111.0 38 129.5 39 159.0 40 190.0 41 215.0 42 243.5 43 265.5 44 266.5 45 262.0 46 257.5 47 257.5 48 231.5 49 194.5 50 175.0 51 137.5 52 115.0 53 95.0 54 76.5 55 54.0 56 33.0 57 29.5 58 19.5 59 14.5 60 11.5 61 3.0 62 2.5 63 4.0 64 3.0 65 2.5 66 3.0 67 2.0 68 2.5 69 2.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.02 100-104 0.01 105-109 0.01 110-114 0.04 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.05 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5874999999999999 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8624999999999998 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 4.55 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 5.5 0.0 0.0 0.0 0.0 126-127 5.887499999999999 0.0 0.0 0.0 0.0 128-129 5.95 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.825 0.0 0.0 0.0 0.0 134-135 8.4375 0.0 0.0 0.0 0.0 136-137 10.3 0.0 0.0 0.0 0.0 138 12.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 55 0.0026350126 15.709091 140-144 GATCGGA 65 0.007995365 13.292308 140-144 AGATCGG 65 0.007995365 13.292308 140-144 >>END_MODULE SRR1799559 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799559_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.036 34.0 34.0 34.0 31.0 34.0 2 33.1695 34.0 34.0 34.0 31.0 34.0 3 33.158 34.0 34.0 34.0 31.0 34.0 4 36.35175 37.0 37.0 37.0 35.0 37.0 5 36.33325 37.0 37.0 37.0 35.0 37.0 6 36.326 37.0 37.0 37.0 36.0 37.0 7 36.30625 37.0 37.0 37.0 35.0 37.0 8 36.273 37.0 37.0 37.0 35.0 37.0 9 38.208 39.0 39.0 39.0 38.0 39.0 10-14 38.5621 39.4 39.2 39.4 38.2 39.4 15-19 39.94755 41.0 40.4 41.0 39.0 41.0 20-24 39.8609 41.0 40.0 41.0 39.0 41.0 25-29 39.723650000000006 41.0 40.0 41.0 38.0 41.0 30-34 39.63885 41.0 40.0 41.0 38.0 41.0 35-39 39.49395 41.0 40.0 41.0 38.0 41.0 40-44 39.38215 41.0 40.0 41.0 38.0 41.0 45-49 39.33815 41.0 40.0 41.0 37.4 41.0 50-54 38.4578 39.8 38.6 40.6 35.8 40.6 55-59 38.81075 40.6 38.8 41.0 35.6 41.0 60-64 38.1992 39.8 37.4 41.0 35.0 41.0 65-69 37.70915 39.0 36.4 41.0 35.0 41.0 70-74 36.66865 37.2 35.2 39.2 34.6 41.0 75-79 35.62575 36.0 35.0 37.6 34.0 39.2 80-84 34.801 35.0 35.0 36.4 33.8 37.8 85-89 34.26495 35.0 35.0 35.6 33.2 36.4 90-94 33.96345 35.0 35.0 35.0 33.0 36.0 95-99 33.8128 35.0 35.0 35.0 33.0 35.4 100-104 33.72435 35.0 35.0 35.0 32.8 35.0 105-109 33.5816 35.0 34.0 35.0 32.0 35.0 110-114 33.47065 35.0 34.0 35.0 31.6 35.0 115-119 33.302 35.0 34.0 35.0 31.0 35.0 120-124 33.149249999999995 35.0 34.0 35.0 31.0 35.0 125-129 32.9846 35.0 34.0 35.0 30.0 35.0 130-134 32.754599999999996 35.0 34.0 35.0 29.4 35.0 135-139 32.392900000000004 35.0 33.0 35.0 28.6 35.0 140-144 31.960250000000002 35.0 33.0 35.0 27.0 35.0 145-149 31.365200000000005 34.2 32.6 35.0 25.2 35.0 150 27.4645 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 43.0 3 1.0 4 1.0 5 2.0 6 2.0 7 3.0 8 3.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 4.0 19 2.0 20 1.0 21 4.0 22 4.0 23 5.0 24 3.0 25 2.0 26 7.0 27 13.0 28 26.0 29 15.0 30 22.0 31 43.0 32 52.0 33 105.0 34 154.0 35 313.0 36 1273.0 37 1845.0 38 43.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.85 20.349999999999998 12.525 29.275000000000002 2 25.5 26.375 30.875000000000004 17.25 3 20.375 27.35 32.875 19.400000000000002 4 25.5 31.0 23.3 20.200000000000003 5 24.65 35.3 22.85 17.2 6 21.025 37.625 23.275000000000002 18.075 7 21.0 22.55 37.4 19.05 8 21.224999999999998 25.775 29.9 23.1 9 23.06153076538269 24.562281140570285 30.540270135067534 21.83591795897949 10-14 23.95 28.955 26.729999999999997 20.365 15-19 23.65 28.349999999999998 27.439999999999998 20.560000000000002 20-24 23.54 28.165000000000003 27.865000000000002 20.43 25-29 23.915 28.18 27.339999999999996 20.565 30-34 23.729745949189837 27.70554110822164 27.900580116023203 20.66413282656531 35-39 23.115 27.595 28.465 20.825 40-44 23.56 27.655 28.535 20.25 45-49 23.647364736473648 26.932693269326936 28.642864286428644 20.77707770777078 50-54 23.332333233323332 27.85778577857786 29.067906790679064 19.741974197419744 55-59 23.87 27.915 27.62 20.595 60-64 23.494999999999997 27.584999999999997 28.910000000000004 20.01 65-69 23.525 27.47 28.565 20.44 70-74 24.147414741474147 27.35273527352735 28.717871787178716 19.781978197819782 75-79 23.745 27.655 28.675 19.925 80-84 23.919999999999998 27.105 29.025000000000002 19.950000000000003 85-89 23.97239723972397 27.552755275527552 28.84788478847885 19.626962696269626 90-94 23.215 26.765 29.220000000000002 20.8 95-99 24.005000000000003 26.72 29.439999999999998 19.835 100-104 23.995 27.18 29.035 19.79 105-109 24.195 27.055 28.76 19.99 110-114 24.03 27.279999999999998 28.51 20.18 115-119 24.115000000000002 27.125 28.835 19.925 120-124 23.88216464939482 26.79803941182355 29.028708612583777 20.29108732619786 125-129 24.527452745274527 27.382738273827385 28.73287328732873 19.35693569356936 130-134 24.607460746074608 27.422742274227424 28.44784478447845 19.521952195219523 135-139 25.34253425342534 27.96279627962796 27.577757775777577 19.11691169116912 140-144 25.545109021804365 29.410882176435287 26.735347069413884 18.308661732346472 145-149 27.260904361744696 28.331332533013203 25.270108043217288 19.137655062024812 150 29.63981990995498 27.51375687843922 25.18759379689845 17.658829414707352 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 2.0 25 2.5 26 3.5 27 6.0 28 8.5 29 12.5 30 23.5 31 30.0 32 27.5 33 36.5 34 47.5 35 61.0 36 83.5 37 109.0 38 137.0 39 166.0 40 202.5 41 234.0 42 247.5 43 248.5 44 263.5 45 286.5 46 274.5 47 257.5 48 235.5 49 198.5 50 163.0 51 148.0 52 136.0 53 91.0 54 64.0 55 53.0 56 36.5 57 22.0 58 16.0 59 15.5 60 10.0 61 6.0 62 8.5 63 7.5 64 2.5 65 1.5 66 1.5 67 2.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.01 130-134 0.01 135-139 0.01 140-144 0.02 145-149 0.04 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.23750000000000002 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.42500000000000004 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 4.5375 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.5625 0.0 0.0 0.0 0.0 124-125 5.6 0.0 0.0 0.0 0.0 126-127 6.012499999999999 0.0 0.0 0.0 0.0 128-129 6.075 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 6.95 0.0 0.0 0.0 0.0 134-135 8.5875 0.0 0.0 0.0 0.0 136-137 10.4625 0.0 0.0 0.0 0.0 138 12.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATACTG 10 0.006973645 144.0 4 CAGAAGG 10 0.006973645 144.0 7 GAAGTTG 40 0.005777437 54.0 2 GATCGGA 65 0.007995365 13.292308 140-144 TCGGAAG 65 0.007995365 13.292308 140-144 AGATCGG 65 0.007995365 13.292308 140-144 >>END_MODULE Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730720 spots for SRR1799559.sra Written 730720 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra Read 730717 spots for SRR1799559.sra Written 730717 spots for SRR1799559.sra SRR ids: ['SRR1799559.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oftpdis3 SRR1799559.sra spots: 14614343 blocks: [[1, 730717], [730718, 1461434], [1461435, 2192151], [2192152, 2922868], [2922869, 3653585], [3653586, 4384302], [4384303, 5115019], [5115020, 5845736], [5845737, 6576453], [6576454, 7307170], [7307171, 8037887], [8037888, 8768604], [8768605, 9499321], [9499322, 10230038], [10230039, 10960755], [10960756, 11691472], [11691473, 12422189], [12422190, 13152906], [13152907, 13883623], [13883624, 14614343]] SRR1799559 file size 4902077 SRR1799559 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799559 SRR1799559_1.fastq SRR1799559_2.fastq Input file: SRR1799559_1.fastq Paired file: SRR1799559_2.fastq trimmed: SRR1799559-trimmed-pair1.fastq, SRR1799559-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:45:19 2025 >> started Thu Feb 13 22:45:35 2025 >> done (15.706s) 14614343 read pairs processed; of these: 33728 ( 0.23%) short read pairs filtered out after trimming by size control 106686 ( 0.73%) empty read pairs filtered out after trimming by size control 14473929 (99.04%) read pairs available; of these: 5680417 (39.25%) trimmed read pairs available after processing 8793512 (60.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 6 0.00% 22 6 0.00% 23 18 0.00% 24 9 0.00% 25 19 0.00% 26 18 0.00% 27 20 0.00% 28 36 0.00% 29 48 0.00% 30 50 0.00% 31 57 0.00% 32 70 0.00% 33 87 0.00% 34 83 0.00% 35 121 0.00% 36 117 0.00% 37 132 0.00% 38 157 0.00% 39 166 0.00% 40 192 0.00% 41 190 0.00% 42 247 0.00% 43 247 0.00% 44 301 0.00% 45 329 0.00% 46 384 0.00% 47 395 0.00% 48 430 0.00% 49 492 0.00% 50 524 0.00% 51 646 0.00% 52 740 0.01% 53 764 0.01% 54 858 0.01% 55 897 0.01% 56 990 0.01% 57 1108 0.01% 58 1322 0.01% 59 1541 0.01% 60 1751 0.01% 61 2002 0.01% 62 2156 0.01% 63 2545 0.02% 64 2867 0.02% 65 3109 0.02% 66 3693 0.03% 67 4235 0.03% 68 4176 0.03% 69 4657 0.03% 70 5065 0.03% 71 5413 0.04% 72 5592 0.04% 73 5436 0.04% 74 4744 0.03% 75 3784 0.03% 76 3038 0.02% 77 2685 0.02% 78 2426 0.02% 79 2243 0.02% 80 2259 0.02% 81 2428 0.02% 82 2589 0.02% 83 2971 0.02% 84 5370 0.04% 85 5748 0.04% 86 6399 0.04% 87 6914 0.05% 88 7190 0.05% 89 7493 0.05% 90 12010 0.08% 91 16281 0.11% 92 8778 0.06% 93 8217 0.06% 94 8544 0.06% 95 10216 0.07% 96 11230 0.08% 97 10524 0.07% 98 9880 0.07% 99 9387 0.06% 100 10164 0.07% 101 37219 0.26% 102 23896 0.17% 103 9932 0.07% 104 13365 0.09% 105 32269 0.22% 106 19434 0.13% 107 27590 0.19% 108 50551 0.35% 109 71209 0.49% 110 21762 0.15% 111 47713 0.33% 112 12025 0.08% 113 10553 0.07% 114 20557 0.14% 115 152398 1.05% 116 36178 0.25% 117 13859 0.10% 118 11861 0.08% 119 42053 0.29% 120 89692 0.62% 121 39132 0.27% 122 13598 0.09% 123 11739 0.08% 124 19651 0.14% 125 42802 0.30% 126 17955 0.12% 127 13029 0.09% 128 14687 0.10% 129 76686 0.53% 130 37353 0.26% 131 24362 0.17% 132 49039 0.34% 133 166050 1.15% 134 146063 1.01% 135 119328 0.82% 136 158271 1.09% 137 169715 1.17% 138 167141 1.15% 139 174061 1.20% 140 175690 1.21% 141 179601 1.24% 142 183708 1.27% 143 189042 1.31% 144 196282 1.36% 145 209099 1.44% 146 222590 1.54% 147 269276 1.86% 148 373136 2.58% 149 1227180 8.48% 150 8793512 60.75% 14473929 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.2 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=61.73 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=12.1 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.3 sequence=AATAGGTTCTTGAAGACAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=1078.33 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=23.3 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAATGCTAACACTGACGCTATTTCTGCTGTTTGTCAAGATGGGGTTCTGACTGTTACTGTTGAGAAATTACCACCTCCTGAGCCTAAGAAGCCTAAGACTATCG SRR1799559 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:46:20 Started mapping on | Feb 13 22:46:20 Finished on | Feb 13 22:47:21 Mapping speed, Million of reads per hour | 854.20 Number of input reads | 14473929 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 13952914 Uniquely mapped reads % | 96.40% Average mapped length | 288.30 Number of splices: Total | 9907665 Number of splices: Annotated (sjdb) | 9705164 Number of splices: GT/AG | 9762741 Number of splices: GC/AG | 107530 Number of splices: AT/AC | 9778 Number of splices: Non-canonical | 27616 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.04% Deletion average length | 2.51 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279586 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 76045 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 254457 254457 254457 N_multimapping 279586 279586 279586 N_noFeature 392985 13692984 499826 N_ambiguous 216405 910 62672 UnstrandedReadsAssigned:13343524 PositiveStrandReadsAssigned:259020 NegativeStrandReadsAssigned:13390416 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR1799559 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799559-trimmed-pair1.fastq SRR1799559-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,473,929 reads, 13,471,117 reads pseudoaligned [quant] estimated average fragment length: 189.904 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR1799559.ke.tsv 34699 SRR1799559.se.tsv 87100 total ==> SRR1799559.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1829.1 432 18.8588 Potri.005G024800.1.v4.1 1035 846.096 24 2.26495 Potri.004G059700.1.v4.1 961 772.111 15 1.55124 Potri.007G009000.2.v4.1 1416 1227.1 0 0 Potri.003G141000.2.v4.1 2943 2754.1 117.031 3.39305 Potri.016G087400.1.v4.1 270 99.138 1611.53 1297.98 Potri.015G069301.1.v4.1 564 375.852 0 0 Potri.010G195200.1.v4.1 1773 1584.1 39 1.96585 Potri.012G127500.1.v4.1 977 788.104 787 79.7368 ==> SRR1799559.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2526 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR1799559 completed mapping pipeline successfully