Starting /dee2/code/volunteer_pipeline.sh SRR1799560 current disk space = 3089298386944 free memory = 1564433344 SRR1799560 SRAfilesize 4c1d05fdadf3cea5eca2e9864cd83640 SRR1799560.sra SRR1799560.sra file validated SRR1799560 is paired end SRR1799560 is conventional basespace SRR1799560 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49525 34.0 34.0 34.0 31.0 34.0 2 32.965 34.0 34.0 34.0 31.0 34.0 3 33.4 34.0 34.0 34.0 31.0 34.0 4 36.662 37.0 37.0 37.0 35.0 37.0 5 36.691 37.0 37.0 37.0 35.0 37.0 6 36.71325 37.0 37.0 37.0 36.0 37.0 7 36.71725 37.0 37.0 37.0 36.0 37.0 8 36.7275 37.0 37.0 37.0 37.0 37.0 9 38.6405 39.0 39.0 39.0 38.0 39.0 10-14 39.0064 39.4 39.4 39.4 38.2 39.4 15-19 40.325900000000004 41.0 40.2 41.0 39.0 41.0 20-24 40.2952 41.0 40.0 41.0 39.0 41.0 25-29 40.2613 41.0 40.0 41.0 39.0 41.0 30-34 40.115700000000004 41.0 40.0 41.0 38.2 41.0 35-39 39.9997 41.0 40.0 41.0 38.0 41.0 40-44 39.8076 41.0 40.0 41.0 38.0 41.0 45-49 39.62215 41.0 40.0 41.0 37.0 41.0 50-54 39.3403 41.0 39.2 41.0 36.2 41.0 55-59 39.058 40.2 38.8 41.0 35.4 41.0 60-64 38.84409999999999 40.0 38.0 41.0 35.0 41.0 65-69 38.127100000000006 39.2 36.6 41.0 35.0 41.0 70-74 37.02405 37.4 35.4 39.6 34.6 41.0 75-79 35.7907 36.2 34.8 37.4 33.4 39.4 80-84 35.26305000000001 35.2 35.0 36.6 34.0 37.8 85-89 34.646699999999996 35.0 35.0 35.6 34.0 36.6 90-94 34.38054999999999 35.0 35.0 35.0 33.6 36.0 95-99 34.226549999999996 35.0 35.0 35.0 33.2 35.4 100-104 34.0935 35.0 35.0 35.0 33.0 35.0 105-109 33.86319999999999 35.0 35.0 35.0 32.4 35.0 110-114 33.8488 35.0 35.0 35.0 32.4 35.0 115-119 33.738 35.0 34.0 35.0 32.0 35.0 120-124 33.49995 35.0 34.0 35.0 31.4 35.0 125-129 33.271 35.0 34.0 35.0 30.8 35.0 130-134 32.90495 35.0 34.0 35.0 30.0 35.0 135-139 32.75295 35.0 34.0 35.0 29.4 35.0 140-144 32.3912 35.0 33.8 35.0 28.8 35.0 145-149 30.78125 35.0 32.4 35.0 17.6 35.0 150 24.95575 32.0 18.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 3.0 11 2.0 12 6.0 13 3.0 14 0.0 15 2.0 16 1.0 17 4.0 18 3.0 19 2.0 20 1.0 21 6.0 22 8.0 23 10.0 24 8.0 25 17.0 26 9.0 27 16.0 28 17.0 29 29.0 30 27.0 31 39.0 32 57.0 33 70.0 34 155.0 35 322.0 36 1116.0 37 2020.0 38 46.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.610537190082646 12.035123966942148 9.22004132231405 40.13429752066116 2 23.709273182957393 14.43609022556391 33.78446115288221 28.07017543859649 3 20.125 16.775000000000002 24.224999999999998 38.875 4 23.979974968710888 25.406758448060074 22.052565707133915 28.56070087609512 5 24.099999999999998 31.1 24.075 20.724999999999998 6 19.425 33.85 25.025 21.7 7 14.575 29.349999999999998 38.525 17.549999999999997 8 17.349999999999998 26.85 31.874999999999996 23.925 9 17.075000000000003 26.150000000000002 32.625 24.15 10-14 19.145 31.245 26.93 22.68 15-19 19.56 29.815 26.87 23.755000000000003 20-24 19.015 29.945 27.935 23.105 25-29 18.884999999999998 30.305 27.08 23.73 30-34 19.2 29.74 27.029999999999998 24.03 35-39 19.564999999999998 29.64 26.919999999999998 23.875 40-44 19.365 30.020000000000003 27.155 23.46 45-49 19.689999999999998 30.375000000000004 26.31 23.625 50-54 19.755 29.244999999999997 27.255000000000003 23.745 55-59 19.564999999999998 29.64 27.284999999999997 23.51 60-64 19.67 29.09 27.139999999999997 24.099999999999998 65-69 20.19 29.42 26.540000000000003 23.849999999999998 70-74 20.105 29.599999999999998 26.645000000000003 23.65 75-79 19.625 29.409999999999997 27.339999999999996 23.625 80-84 20.22 28.95 26.669999999999998 24.16 85-89 19.98 29.535 26.884999999999998 23.599999999999998 90-94 19.75 29.7 26.790000000000003 23.76 95-99 19.88 29.520000000000003 26.645000000000003 23.955000000000002 100-104 19.994999999999997 29.21 27.01 23.785 105-109 20.315 29.134999999999998 27.025 23.525 110-114 20.815 29.759999999999998 26.455000000000002 22.97 115-119 21.085 29.445 25.835 23.635 120-124 21.62 29.42 25.585 23.375 125-129 20.645 29.054999999999996 26.075 24.224999999999998 130-134 21.23 28.43 26.375 23.965 135-139 21.08 29.165000000000003 25.729999999999997 24.025 140-144 21.959999999999997 30.025000000000002 24.395 23.62 145-149 22.189999999999998 29.86 24.545 23.405 150 18.117942283563362 32.2961104140527 25.01882057716437 24.567126725219573 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.0 23 0.0 24 2.5 25 3.0 26 2.5 27 7.5 28 14.5 29 20.0 30 22.5 31 34.0 32 49.0 33 53.0 34 59.5 35 76.5 36 101.0 37 124.5 38 144.0 39 168.0 40 184.5 41 204.5 42 235.5 43 246.0 44 254.0 45 266.0 46 261.5 47 251.0 48 231.0 49 189.0 50 156.5 51 139.5 52 115.0 53 88.0 54 68.0 55 57.0 56 44.0 57 33.5 58 25.0 59 14.0 60 11.5 61 9.5 62 4.0 63 4.0 64 4.0 65 3.5 66 3.5 67 2.0 68 0.5 69 1.0 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.25 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.3375000000000004 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.9625 0.0 0.0 0.0 0.0 116-117 6.175 0.0 0.0 0.0 0.0 118-119 6.5875 0.0 0.0 0.0 0.0 120-121 6.8 0.0 0.0 0.0 0.0 122-123 6.949999999999999 0.0 0.0 0.0 0.0 124-125 7.275 0.0 0.0 0.0 0.0 126-127 7.4375 0.0 0.0 0.0 0.0 128-129 7.8875 0.0 0.0 0.0 0.0 130-131 8.375 0.0 0.0 0.0 0.0 132-133 9.725 0.0 0.0 0.0 0.0 134-135 10.725000000000001 0.0 0.0 0.0 0.0 136-137 12.1 0.0 0.0 0.0 0.0 138 13.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAGAT 10 0.006217765 149.55844 1 CTCGCAA 10 0.006217765 149.55844 1 >>END_MODULE SRR1799560 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799560_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9625 34.0 33.0 34.0 31.0 34.0 2 33.05525 34.0 34.0 34.0 31.0 34.0 3 33.07525 34.0 34.0 34.0 31.0 34.0 4 36.348 37.0 37.0 37.0 35.0 37.0 5 36.40125 37.0 37.0 37.0 35.0 37.0 6 36.438 37.0 37.0 37.0 36.0 37.0 7 36.402 37.0 37.0 37.0 35.0 37.0 8 36.455 37.0 37.0 37.0 36.0 37.0 9 38.31475 39.0 39.0 39.0 38.0 39.0 10-14 38.6489 39.4 39.2 39.4 38.2 39.4 15-19 39.970600000000005 41.0 40.0 41.0 38.8 41.0 20-24 39.9188 41.0 40.0 41.0 38.8 41.0 25-29 39.824 41.0 40.0 41.0 38.0 41.0 30-34 39.65175 41.0 40.0 41.0 38.0 41.0 35-39 39.515699999999995 41.0 40.0 41.0 38.0 41.0 40-44 39.318349999999995 41.0 40.0 41.0 37.4 41.0 45-49 39.049350000000004 41.0 39.4 41.0 36.4 41.0 50-54 38.13125 39.6 38.0 40.6 34.6 41.0 55-59 38.282000000000004 40.0 38.0 41.0 34.6 41.0 60-64 38.20219999999999 40.0 37.4 41.0 35.0 41.0 65-69 37.4835 39.0 36.2 41.0 34.6 41.0 70-74 36.499249999999996 37.2 35.0 39.2 34.0 41.0 75-79 35.441250000000004 36.0 35.0 37.6 33.8 39.2 80-84 34.57425 35.0 35.0 36.4 33.0 37.8 85-89 33.9239 35.0 35.0 35.4 32.8 36.4 90-94 33.61075 35.0 35.0 35.0 32.0 36.0 95-99 33.3838 35.0 34.6 35.0 31.6 35.4 100-104 33.1899 35.0 34.0 35.0 31.2 35.0 105-109 33.112849999999995 35.0 34.0 35.0 31.0 35.0 110-114 32.90645 35.0 34.0 35.0 30.0 35.0 115-119 32.7122 35.0 34.0 35.0 29.6 35.0 120-124 32.50705000000001 35.0 34.0 35.0 29.2 35.0 125-129 32.311400000000006 35.0 33.8 35.0 28.6 35.0 130-134 31.9841 35.0 33.0 35.0 27.4 35.0 135-139 31.578699999999998 35.0 33.0 35.0 25.0 35.0 140-144 31.180650000000004 35.0 32.6 35.0 23.4 35.0 145-149 30.266550000000002 34.2 31.4 35.0 12.0 35.0 150 28.176 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 3.0 4 5.0 5 0.0 6 0.0 7 4.0 8 3.0 9 2.0 10 3.0 11 2.0 12 6.0 13 6.0 14 2.0 15 6.0 16 6.0 17 9.0 18 8.0 19 7.0 20 6.0 21 4.0 22 12.0 23 11.0 24 11.0 25 19.0 26 17.0 27 21.0 28 26.0 29 16.0 30 44.0 31 37.0 32 56.0 33 98.0 34 146.0 35 355.0 36 1161.0 37 1803.0 38 59.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.222054760110524 16.855061542326048 14.669680984677216 32.25320271288621 2 26.766917293233085 26.766917293233085 30.601503759398497 15.86466165413534 3 22.302878598247812 27.434292866082604 30.01251564455569 20.250312891113893 4 25.075075075075077 31.83183183183183 24.524524524524523 18.56856856856857 5 26.3013013013013 34.83483483483483 23.34834834834835 15.515515515515515 6 20.175 37.8 24.125 17.9 7 21.025 21.575 37.75 19.650000000000002 8 21.05 25.424999999999997 29.2 24.325 9 22.125 23.25 32.4 22.225 10-14 23.794758951790357 28.570714142828567 26.935387077415484 20.699139827965592 15-19 23.78 27.450000000000003 28.02 20.75 20-24 23.05 27.955000000000002 28.139999999999997 20.855 25-29 23.215 27.810000000000002 28.425 20.549999999999997 30-34 23.585 27.195000000000004 28.165000000000003 21.055 35-39 23.3 27.455000000000002 28.435 20.810000000000002 40-44 24.12 26.955000000000002 27.884999999999998 21.04 45-49 23.380000000000003 27.445000000000004 28.845 20.330000000000002 50-54 23.845 27.08 28.535 20.54 55-59 23.84 27.115000000000002 28.58 20.465 60-64 23.625 27.505000000000003 28.515 20.355 65-69 23.415 27.284999999999997 29.025000000000002 20.275000000000002 70-74 23.985 27.015 28.425 20.575 75-79 23.87 27.51 28.425 20.195 80-84 23.885 27.115000000000002 28.735 20.265 85-89 23.875 26.895000000000003 29.285 19.945 90-94 23.89 26.99 28.875 20.244999999999997 95-99 23.71 27.41 29.470000000000002 19.41 100-104 24.285 27.200000000000003 28.83 19.685 105-109 23.54 27.415 28.985 20.06 110-114 24.235 27.779999999999998 28.050000000000004 19.935 115-119 24.486224311215558 27.641382069103454 28.356417820891046 19.51597579878994 120-124 25.430000000000003 27.04 28.17 19.36 125-129 25.535000000000004 26.275 28.610000000000003 19.580000000000002 130-134 25.27 27.41 28.555000000000003 18.765 135-139 25.115 28.915000000000003 27.02 18.95 140-144 26.39 29.035 25.895000000000003 18.68 145-149 28.110000000000003 27.715 26.145000000000003 18.029999999999998 150 29.159303206261043 26.25599596061601 25.852057561221915 18.732643271901033 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 3.5 26 4.5 27 6.0 28 7.5 29 10.5 30 15.0 31 19.5 32 25.5 33 36.5 34 51.5 35 75.0 36 92.0 37 101.0 38 117.5 39 151.0 40 197.0 41 230.5 42 246.0 43 257.5 44 264.5 45 264.0 46 259.5 47 259.5 48 252.0 49 218.0 50 182.0 51 156.5 52 127.0 53 100.0 54 72.0 55 42.0 56 30.5 57 27.0 58 22.5 59 17.5 60 12.0 61 8.0 62 6.5 63 5.5 64 3.5 65 2.5 66 2.0 67 1.5 68 0.5 69 1.5 70 1.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.25 3 0.125 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.48750000000000004 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.3375000000000004 0.0 0.0 0.0 0.0 112-113 4.2125 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 6.125 0.0 0.0 0.0 0.0 118-119 6.512499999999999 0.0 0.0 0.0 0.0 120-121 6.737500000000001 0.0 0.0 0.0 0.0 122-123 6.9 0.0 0.0 0.0 0.0 124-125 7.225 0.0 0.0 0.0 0.0 126-127 7.4 0.0 0.0 0.0 0.0 128-129 7.875 0.0 0.0 0.0 0.0 130-131 8.3375 0.0 0.0 0.0 0.0 132-133 9.625 0.0 0.0 0.0 0.0 134-135 10.675 0.0 0.0 0.0 0.0 136-137 12.125 0.0 0.0 0.0 0.0 138 13.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 20 0.0060001626 28.934671 140-144 >>END_MODULE Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969676 spots for SRR1799560.sra Written 969676 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra Read 969662 spots for SRR1799560.sra Written 969662 spots for SRR1799560.sra SRR ids: ['SRR1799560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aujqzla4 SRR1799560.sra spots: 19393254 blocks: [[1, 969662], [969663, 1939324], [1939325, 2908986], [2908987, 3878648], [3878649, 4848310], [4848311, 5817972], [5817973, 6787634], [6787635, 7757296], [7757297, 8726958], [8726959, 9696620], [9696621, 10666282], [10666283, 11635944], [11635945, 12605606], [12605607, 13575268], [13575269, 14544930], [14544931, 15514592], [15514593, 16484254], [16484255, 17453916], [17453917, 18423578], [18423579, 19393254]] SRR1799560 file size 6512159 SRR1799560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799560 SRR1799560_1.fastq SRR1799560_2.fastq Input file: SRR1799560_1.fastq Paired file: SRR1799560_2.fastq trimmed: SRR1799560-trimmed-pair1.fastq, SRR1799560-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:23:56 2025 >> started Thu Feb 13 23:24:17 2025 >> done (21.057s) 19393254 read pairs processed; of these: 40200 ( 0.21%) short read pairs filtered out after trimming by size control 94687 ( 0.49%) empty read pairs filtered out after trimming by size control 19258367 (99.30%) read pairs available; of these: 7898368 (41.01%) trimmed read pairs available after processing 11359999 (58.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 9 0.00% 22 8 0.00% 23 13 0.00% 24 18 0.00% 25 31 0.00% 26 46 0.00% 27 36 0.00% 28 51 0.00% 29 49 0.00% 30 77 0.00% 31 74 0.00% 32 97 0.00% 33 145 0.00% 34 157 0.00% 35 181 0.00% 36 195 0.00% 37 222 0.00% 38 242 0.00% 39 290 0.00% 40 294 0.00% 41 327 0.00% 42 321 0.00% 43 347 0.00% 44 375 0.00% 45 432 0.00% 46 492 0.00% 47 517 0.00% 48 590 0.00% 49 677 0.00% 50 675 0.00% 51 790 0.00% 52 876 0.00% 53 932 0.00% 54 1009 0.01% 55 1145 0.01% 56 1328 0.01% 57 1415 0.01% 58 1607 0.01% 59 1729 0.01% 60 1989 0.01% 61 2330 0.01% 62 2652 0.01% 63 3076 0.02% 64 3352 0.02% 65 3849 0.02% 66 4231 0.02% 67 4829 0.03% 68 5410 0.03% 69 6132 0.03% 70 6821 0.04% 71 7821 0.04% 72 8645 0.04% 73 9786 0.05% 74 10295 0.05% 75 10027 0.05% 76 8541 0.04% 77 7267 0.04% 78 6216 0.03% 79 5338 0.03% 80 4581 0.02% 81 4996 0.03% 82 5496 0.03% 83 5871 0.03% 84 9466 0.05% 85 10592 0.05% 86 12343 0.06% 87 10384 0.05% 88 11425 0.06% 89 17086 0.09% 90 11895 0.06% 91 12038 0.06% 92 13168 0.07% 93 13258 0.07% 94 14162 0.07% 95 14965 0.08% 96 14644 0.08% 97 17070 0.09% 98 16500 0.09% 99 20778 0.11% 100 41977 0.22% 101 17333 0.09% 102 20533 0.11% 103 50851 0.26% 104 38011 0.20% 105 30191 0.16% 106 41701 0.22% 107 87669 0.46% 108 28718 0.15% 109 46014 0.24% 110 58285 0.30% 111 113243 0.59% 112 73645 0.38% 113 37419 0.19% 114 120363 0.62% 115 191948 1.00% 116 32641 0.17% 117 55846 0.29% 118 35190 0.18% 119 33502 0.17% 120 51056 0.27% 121 31046 0.16% 122 27341 0.14% 123 35081 0.18% 124 53115 0.28% 125 22375 0.12% 126 23141 0.12% 127 61761 0.32% 128 48673 0.25% 129 49669 0.26% 130 60218 0.31% 131 163366 0.85% 132 115988 0.60% 133 65806 0.34% 134 185288 0.96% 135 193605 1.01% 136 193073 1.00% 137 204277 1.06% 138 204025 1.06% 139 221515 1.15% 140 223788 1.16% 141 231936 1.20% 142 236773 1.23% 143 242812 1.26% 144 252965 1.31% 145 261557 1.36% 146 297760 1.55% 147 352927 1.83% 148 466485 2.42% 149 1788715 9.29% 150 11359999 58.99% 19258367 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=71.19 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=15.8 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGTTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTACATTAAGCTCTAACCTGCCACCTGATCCTGCTTGTGTGGTCAGAGGGTTGCTCACAGTCTGGAACTGGGAACTTGATAGAAATTGTGGTATAATGTGAAACTGTACTAGCTCAGCCTTTTCTTGATCGCTTAGGGAGTTGAGG criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=24.46 fanout-score-rank=8 prefix-density=0.40 prefix-fanout=9.3 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=110.77 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=16.3 sequence=AGAAGGAGAAAGAAAAGGAGAGTGCTTCCCAGTAGGGCAGCAGGCAGTATTCTTGTGTTCTATAGAACGGTGATGATGATGCTTGATGTGTGGCTTGTTTGGTTATGTCCATCTACTGTTTTTCTTCCTTTTTAGAAAAAAAAGCTCGGTTTACTGCAAATATTACAAGACCATACGTGCTTGTAATTTGATGTAAGATTGTT SRR1799560 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:24:58 Started mapping on | Feb 13 23:24:58 Finished on | Feb 13 23:26:33 Mapping speed, Million of reads per hour | 729.79 Number of input reads | 19258367 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 18599162 Uniquely mapped reads % | 96.58% Average mapped length | 286.98 Number of splices: Total | 14835713 Number of splices: Annotated (sjdb) | 14553419 Number of splices: GT/AG | 14604933 Number of splices: GC/AG | 176944 Number of splices: AT/AC | 14476 Number of splices: Non-canonical | 39360 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351973 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 37926 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.37% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322238 322238 322238 N_multimapping 351973 351973 351973 N_noFeature 555297 18342714 684380 N_ambiguous 197738 1285 69569 UnstrandedReadsAssigned:17846127 PositiveStrandReadsAssigned:255163 NegativeStrandReadsAssigned:17845213 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR1799560 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799560-trimmed-pair1.fastq SRR1799560-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,258,367 reads, 17,790,814 reads pseudoaligned [quant] estimated average fragment length: 185.366 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR1799560.ke.tsv 34699 SRR1799560.se.tsv 87100 total ==> SRR1799560.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1833.63 351 10.7198 Potri.005G024800.1.v4.1 1035 850.634 50 3.2917 Potri.004G059700.1.v4.1 961 776.634 21 1.51425 Potri.007G009000.2.v4.1 1416 1231.63 0 0 Potri.003G141000.2.v4.1 2943 2758.63 265.029 5.38013 Potri.016G087400.1.v4.1 270 101.597 2465.79 1359.15 Potri.015G069301.1.v4.1 564 380.082 0 0 Potri.010G195200.1.v4.1 1773 1588.63 64 2.25605 Potri.012G127500.1.v4.1 977 792.634 5984 422.778 ==> SRR1799560.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2228 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799560 completed mapping pipeline successfully