Starting /dee2/code/volunteer_pipeline.sh SRR1799561 current disk space = 3089297727488 free memory = 1579933180 SRR1799561 SRAfilesize 4b437716a49be2e98aa2373f81182138 SRR1799561.sra SRR1799561.sra file validated SRR1799561 is paired end SRR1799561 is conventional basespace SRR1799561 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35425 34.0 33.0 34.0 31.0 34.0 2 32.91225 34.0 34.0 34.0 31.0 34.0 3 33.353 34.0 34.0 34.0 31.0 34.0 4 36.66375 37.0 37.0 37.0 35.0 37.0 5 36.67425 37.0 37.0 37.0 35.0 37.0 6 36.705 37.0 37.0 37.0 35.0 37.0 7 36.65325 37.0 37.0 37.0 35.0 37.0 8 36.674 37.0 37.0 37.0 35.0 37.0 9 38.59075 39.0 39.0 39.0 38.0 39.0 10-14 38.955650000000006 39.4 39.2 39.4 38.0 39.4 15-19 40.31055 41.0 40.2 41.0 39.0 41.0 20-24 40.25865 41.0 40.0 41.0 39.0 41.0 25-29 40.1855 41.0 40.0 41.0 38.8 41.0 30-34 40.0282 41.0 40.0 41.0 38.0 41.0 35-39 39.97585 41.0 40.0 41.0 38.0 41.0 40-44 39.791 41.0 40.0 41.0 37.8 41.0 45-49 39.5773 41.0 40.0 41.0 37.0 41.0 50-54 39.23835 40.8 39.2 41.0 35.8 41.0 55-59 38.9785 40.0 38.6 41.0 35.2 41.0 60-64 38.8073 40.0 37.6 41.0 35.0 41.0 65-69 38.17635 39.2 36.6 41.0 35.0 41.0 70-74 37.122 37.6 35.4 39.6 34.6 41.0 75-79 35.75265 36.2 34.8 37.4 33.4 39.4 80-84 35.200450000000004 35.2 35.0 36.6 34.0 37.8 85-89 34.63969999999999 35.0 35.0 35.6 33.6 36.6 90-94 34.31080000000001 35.0 35.0 35.0 33.2 36.0 95-99 34.1256 35.0 35.0 35.0 33.0 35.6 100-104 34.08325 35.0 35.0 35.0 33.0 35.0 105-109 33.98885 35.0 35.0 35.0 33.0 35.0 110-114 33.81484999999999 35.0 34.8 35.0 32.4 35.0 115-119 33.77905 35.0 34.6 35.0 32.4 35.0 120-124 33.576350000000005 35.0 34.0 35.0 31.8 35.0 125-129 33.41295 35.0 34.0 35.0 31.4 35.0 130-134 33.28724999999999 35.0 34.0 35.0 31.0 35.0 135-139 33.1383 35.0 34.0 35.0 30.8 35.0 140-144 32.747 35.0 34.0 35.0 29.6 35.0 145-149 32.21605 35.0 33.4 35.0 28.6 35.0 150 26.49375 34.0 20.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 2.0 11 2.0 12 0.0 13 4.0 14 4.0 15 4.0 16 2.0 17 3.0 18 3.0 19 5.0 20 4.0 21 7.0 22 5.0 23 13.0 24 8.0 25 7.0 26 12.0 27 14.0 28 17.0 29 27.0 30 27.0 31 34.0 32 46.0 33 69.0 34 119.0 35 298.0 36 1063.0 37 2150.0 38 49.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.83013982392543 10.8234075608493 8.23407560849301 43.11237700673226 2 22.366775081310983 13.985489116837629 35.40155116337253 28.246184638478862 3 19.275000000000002 16.975 25.974999999999998 37.775 4 22.36118059029515 26.463231615807903 21.98599299649825 29.189594797398698 5 22.475 32.125 24.5 20.9 6 19.525000000000002 35.875 23.45 21.15 7 13.575000000000001 28.050000000000004 40.025 18.35 8 16.925 26.325 33.0 23.75 9 17.075000000000003 22.825 35.199999999999996 24.9 10-14 18.990000000000002 31.115 26.69 23.205000000000002 15-19 19.49 29.29 27.63 23.59 20-24 19.42 30.19 27.38 23.01 25-29 19.650000000000002 29.830000000000002 27.639999999999997 22.88 30-34 20.05 29.865000000000002 26.87 23.215 35-39 19.67 29.549999999999997 27.215 23.565 40-44 19.82 30.385 26.505000000000003 23.29 45-49 19.535 29.14 27.544999999999998 23.78 50-54 19.744999999999997 29.095 27.485 23.674999999999997 55-59 19.75 29.715000000000003 26.790000000000003 23.745 60-64 20.474999999999998 29.49 26.515 23.52 65-69 20.265 29.25 26.96 23.525 70-74 19.85 28.815 26.919999999999998 24.415 75-79 20.080000000000002 29.085 27.175 23.66 80-84 19.845 29.080000000000002 27.85 23.225 85-89 20.61 29.110000000000003 26.35 23.93 90-94 19.88 29.134999999999998 26.950000000000003 24.035 95-99 19.785 28.685 27.474999999999998 24.055 100-104 20.369999999999997 29.57 27.11 22.95 105-109 20.745 29.349999999999998 27.205000000000002 22.7 110-114 20.794999999999998 30.085 26.11 23.01 115-119 20.655 30.070000000000004 25.825 23.45 120-124 20.62 28.99 26.11 24.279999999999998 125-129 20.905 28.895 26.355 23.845 130-134 20.305 29.104999999999997 26.615 23.974999999999998 135-139 21.365000000000002 28.599999999999998 25.705 24.33 140-144 21.675 30.314999999999998 24.635 23.375 145-149 21.82 30.45 24.295 23.435 150 18.220551378446114 32.88220551378446 24.360902255639097 24.536340852130326 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 0.5 24 2.5 25 5.0 26 5.5 27 7.0 28 11.0 29 15.5 30 27.0 31 35.0 32 40.5 33 56.0 34 67.0 35 80.0 36 97.5 37 119.0 38 137.0 39 152.5 40 195.0 41 238.0 42 232.5 43 240.0 44 247.5 45 252.5 46 254.0 47 245.0 48 230.5 49 190.0 50 158.5 51 134.5 52 113.5 53 96.5 54 79.0 55 57.5 56 43.5 57 28.5 58 23.0 59 20.5 60 12.0 61 9.5 62 8.0 63 6.5 64 4.5 65 2.0 66 2.5 67 1.5 68 3.0 69 3.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.075 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.2874999999999996 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.4375 0.0 0.0 0.0 0.0 110-111 4.275 0.0 0.0 0.0 0.0 112-113 4.675000000000001 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 6.012499999999999 0.0 0.0 0.0 0.0 118-119 6.275 0.0 0.0 0.0 0.0 120-121 6.762499999999999 0.0 0.0 0.0 0.0 122-123 7.625 0.0 0.0 0.0 0.0 124-125 7.8 0.0 0.0 0.0 0.0 126-127 8.0625 0.0 0.0 0.0 0.0 128-129 8.6 0.0 0.0 0.0 0.0 130-131 9.7125 0.0 0.0 0.0 0.0 132-133 10.3125 0.0 0.0 0.0 0.0 134-135 11.7375 0.0 0.0 0.0 0.0 136-137 13.375 0.0 0.0 0.0 0.0 138 14.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCCAG 10 0.0069754543 143.9875 7 AGAGCAC 65 0.007999954 13.291155 140-144 >>END_MODULE SRR1799561 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799561_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8825 34.0 33.0 34.0 31.0 34.0 2 32.9435 34.0 34.0 34.0 31.0 34.0 3 33.0155 34.0 34.0 34.0 31.0 34.0 4 36.292 37.0 37.0 37.0 35.0 37.0 5 36.31275 37.0 37.0 37.0 35.0 37.0 6 36.3305 37.0 37.0 37.0 35.0 37.0 7 36.2825 37.0 37.0 37.0 35.0 37.0 8 36.31675 37.0 37.0 37.0 35.0 37.0 9 38.104 39.0 39.0 39.0 37.0 39.0 10-14 38.48715 39.4 39.2 39.4 37.4 39.4 15-19 39.79705 41.0 40.0 41.0 38.0 41.0 20-24 39.7057 41.0 40.0 41.0 38.0 41.0 25-29 39.5918 41.0 40.0 41.0 38.0 41.0 30-34 39.46195 41.0 40.0 41.0 37.8 41.0 35-39 39.3281 41.0 40.0 41.0 37.6 41.0 40-44 39.221900000000005 41.0 40.0 41.0 37.2 41.0 45-49 38.8768 40.8 39.2 41.0 35.8 41.0 50-54 38.091049999999996 39.6 38.0 40.6 34.6 40.8 55-59 38.216899999999995 40.0 38.0 41.0 34.6 41.0 60-64 38.149649999999994 39.8 37.2 41.0 35.0 41.0 65-69 37.505700000000004 39.0 36.2 41.0 34.6 41.0 70-74 36.515249999999995 37.0 35.0 39.2 34.0 41.0 75-79 35.4824 35.8 35.0 37.6 33.6 39.2 80-84 34.660000000000004 35.0 35.0 36.4 33.2 37.4 85-89 34.004799999999996 35.0 35.0 35.6 32.6 36.4 90-94 33.70525000000001 35.0 35.0 35.0 32.8 36.0 95-99 33.45905 35.0 35.0 35.0 32.0 35.2 100-104 33.293400000000005 35.0 34.8 35.0 31.4 35.2 105-109 33.1802 35.0 34.0 35.0 31.0 35.0 110-114 33.129850000000005 35.0 34.0 35.0 31.0 35.0 115-119 32.924899999999994 35.0 34.0 35.0 30.2 35.0 120-124 32.73335 35.0 34.0 35.0 29.8 35.0 125-129 32.4865 35.0 34.0 35.0 29.2 35.0 130-134 32.4072 35.0 34.0 35.0 29.0 35.0 135-139 32.2459 35.0 33.8 35.0 29.0 35.0 140-144 31.701900000000002 35.0 33.0 35.0 26.0 35.0 145-149 31.22695 35.0 33.0 35.0 24.4 35.0 150 29.04025 34.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 3.0 4 0.0 5 5.0 6 0.0 7 4.0 8 2.0 9 3.0 10 4.0 11 0.0 12 5.0 13 4.0 14 3.0 15 6.0 16 5.0 17 6.0 18 8.0 19 9.0 20 7.0 21 7.0 22 6.0 23 8.0 24 8.0 25 10.0 26 12.0 27 13.0 28 24.0 29 24.0 30 36.0 31 36.0 32 51.0 33 87.0 34 150.0 35 329.0 36 1132.0 37 1910.0 38 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.764750188300276 17.524479035902583 12.503138337936228 31.20763243786091 2 25.175175175175173 26.026026026026027 33.33333333333333 15.465465465465467 3 21.47147147147147 26.5015015015015 31.181181181181184 20.845845845845844 4 25.31898924193145 31.448586439829874 22.241681260945708 20.99074305729297 5 24.093069802351764 36.15211408556417 22.9672254190643 16.787590693019766 6 20.549999999999997 36.975 24.8 17.675 7 21.525 19.900000000000002 38.550000000000004 20.025000000000002 8 21.5 24.6 31.275 22.625 9 22.15 25.15 30.75 21.95 10-14 24.09 28.585 26.565 20.76 15-19 23.544999999999998 28.03 27.79 20.635 20-24 23.885 27.615000000000002 28.26 20.24 25-29 23.835 27.345000000000002 28.275 20.544999999999998 30-34 23.775 27.67 28.1 20.455000000000002 35-39 23.31 27.46 28.735 20.495 40-44 23.575 27.155 28.815 20.455000000000002 45-49 23.72 27.245 28.965000000000003 20.07 50-54 23.695 27.27 28.79 20.244999999999997 55-59 24.52 26.935 28.060000000000002 20.485 60-64 23.445 27.185 28.98 20.39 65-69 23.285 28.04 28.415000000000003 20.26 70-74 23.115 27.455000000000002 28.999999999999996 20.43 75-79 23.48 27.095000000000002 29.315 20.11 80-84 23.785 27.265 28.825 20.125 85-89 23.9 27.105 28.83 20.165 90-94 24.04 27.47 28.499999999999996 19.99 95-99 23.585 27.625 29.035 19.755 100-104 23.71 27.305 28.825 20.16 105-109 24.38 27.725 28.16 19.735 110-114 24.165 27.894999999999996 28.315 19.625 115-119 24.455 27.76 28.12 19.665 120-124 25.124999999999996 27.52 27.74 19.615 125-129 24.836929252383342 27.957852483692925 27.63672854992474 19.568489713998996 130-134 24.85 28.325 27.935 18.89 135-139 25.755 28.389999999999997 27.52 18.335 140-144 26.37824846026739 28.906915026788845 26.08282008912924 18.63201642381453 145-149 26.790000000000003 27.935 26.669999999999998 18.605 150 28.786333503314637 26.644569097399284 25.191228964813874 19.37786843447221 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 1.0 10 1.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.5 23 3.5 24 2.5 25 1.5 26 3.5 27 7.5 28 11.0 29 10.5 30 10.5 31 15.5 32 27.5 33 45.5 34 58.0 35 69.5 36 99.0 37 125.0 38 139.0 39 156.5 40 174.5 41 203.5 42 232.0 43 247.5 44 267.0 45 289.5 46 274.0 47 244.5 48 231.0 49 210.0 50 183.5 51 155.5 52 125.0 53 93.0 54 65.5 55 48.5 56 36.0 57 25.5 58 21.0 59 17.5 60 14.5 61 10.0 62 5.5 63 6.0 64 7.0 65 3.0 66 1.0 67 1.5 68 3.5 69 3.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.1 3 0.1 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.35000000000000003 130-134 0.0 135-139 0.0 140-144 0.145 145-149 0.0 150 1.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.2874999999999996 0.0 0.0 0.0 0.0 106-107 2.9625 0.0 0.0 0.0 0.0 108-109 3.4749999999999996 0.0 0.0 0.0 0.0 110-111 4.325 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 114-115 5.175 0.0 0.0 0.0 0.0 116-117 6.075 0.0 0.0 0.0 0.0 118-119 6.3625 0.0 0.0 0.0 0.0 120-121 6.8375 0.0 0.0 0.0 0.0 122-123 7.7125 0.0 0.0 0.0 0.0 124-125 7.875 0.0 0.0 0.0 0.0 126-127 8.0875 0.0 0.0 0.0 0.0 128-129 8.6375 0.0 0.0 0.0 0.0 130-131 9.7875 0.0 0.0 0.0 0.0 132-133 10.375 0.0 0.0 0.0 0.0 134-135 11.7875 0.0 0.0 0.0 0.0 136-137 13.4625 0.0 0.0 0.0 0.0 138 14.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 65 0.007899376 13.316367 140-144 AGAGCGT 65 0.007899376 13.316367 140-144 >>END_MODULE Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076939 spots for SRR1799561.sra Written 1076939 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra Read 1076932 spots for SRR1799561.sra Written 1076932 spots for SRR1799561.sra SRR ids: ['SRR1799561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_013zk8kl SRR1799561.sra spots: 21538647 blocks: [[1, 1076932], [1076933, 2153864], [2153865, 3230796], [3230797, 4307728], [4307729, 5384660], [5384661, 6461592], [6461593, 7538524], [7538525, 8615456], [8615457, 9692388], [9692389, 10769320], [10769321, 11846252], [11846253, 12923184], [12923185, 14000116], [14000117, 15077048], [15077049, 16153980], [16153981, 17230912], [17230913, 18307844], [18307845, 19384776], [19384777, 20461708], [20461709, 21538647]] SRR1799561 file size 7234972 SRR1799561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799561 SRR1799561_1.fastq SRR1799561_2.fastq Input file: SRR1799561_1.fastq Paired file: SRR1799561_2.fastq trimmed: SRR1799561-trimmed-pair1.fastq, SRR1799561-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:49:01 2025 >> started Thu Feb 13 23:49:24 2025 >> done (23.058s) 21538647 read pairs processed; of these: 62136 ( 0.29%) short read pairs filtered out after trimming by size control 122809 ( 0.57%) empty read pairs filtered out after trimming by size control 21353702 (99.14%) read pairs available; of these: 9281964 (43.47%) trimmed read pairs available after processing 12071738 (56.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 4 0.00% 21 9 0.00% 22 12 0.00% 23 26 0.00% 24 27 0.00% 25 41 0.00% 26 49 0.00% 27 65 0.00% 28 78 0.00% 29 116 0.00% 30 133 0.00% 31 154 0.00% 32 192 0.00% 33 201 0.00% 34 240 0.00% 35 283 0.00% 36 333 0.00% 37 347 0.00% 38 391 0.00% 39 424 0.00% 40 509 0.00% 41 493 0.00% 42 532 0.00% 43 577 0.00% 44 640 0.00% 45 640 0.00% 46 642 0.00% 47 756 0.00% 48 798 0.00% 49 862 0.00% 50 969 0.00% 51 1071 0.01% 52 1137 0.01% 53 1228 0.01% 54 1349 0.01% 55 1469 0.01% 56 1591 0.01% 57 1705 0.01% 58 1950 0.01% 59 2142 0.01% 60 2460 0.01% 61 2726 0.01% 62 3181 0.01% 63 3445 0.02% 64 3800 0.02% 65 4309 0.02% 66 4600 0.02% 67 5138 0.02% 68 5686 0.03% 69 6488 0.03% 70 7203 0.03% 71 8242 0.04% 72 9474 0.04% 73 10924 0.05% 74 11851 0.06% 75 13452 0.06% 76 14406 0.07% 77 13670 0.06% 78 12496 0.06% 79 10232 0.05% 80 8059 0.04% 81 5550 0.03% 82 5690 0.03% 83 6257 0.03% 84 10935 0.05% 85 12495 0.06% 86 18921 0.09% 87 26226 0.12% 88 15686 0.07% 89 15640 0.07% 90 16827 0.08% 91 28801 0.13% 92 19001 0.09% 93 18302 0.09% 94 18501 0.09% 95 19678 0.09% 96 20682 0.10% 97 36128 0.17% 98 48839 0.23% 99 21404 0.10% 100 20446 0.10% 101 59564 0.28% 102 49863 0.23% 103 31588 0.15% 104 73314 0.34% 105 113743 0.53% 106 25484 0.12% 107 48160 0.23% 108 55932 0.26% 109 98581 0.46% 110 26736 0.13% 111 28351 0.13% 112 174148 0.82% 113 34517 0.16% 114 31337 0.15% 115 192359 0.90% 116 38560 0.18% 117 35341 0.17% 118 43902 0.21% 119 29985 0.14% 120 98594 0.46% 121 188433 0.88% 122 64415 0.30% 123 23496 0.11% 124 22222 0.10% 125 47067 0.22% 126 42235 0.20% 127 42151 0.20% 128 76871 0.36% 129 208003 0.97% 130 100434 0.47% 131 48391 0.23% 132 159744 0.75% 133 211098 0.99% 134 135300 0.63% 135 150038 0.70% 136 207885 0.97% 137 220424 1.03% 138 226086 1.06% 139 231904 1.09% 140 233416 1.09% 141 238044 1.11% 142 241999 1.13% 143 246506 1.15% 144 264417 1.24% 145 290440 1.36% 146 334678 1.57% 147 412465 1.93% 148 551885 2.58% 149 2199811 10.30% 150 12071738 56.53% 21353702 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=38 prefix-density=0.15 prefix-fanout=2.5 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=266.26 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=30.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.49 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=3.6 sequence=ATCCAGAAGGAGTCCACCCTCCACTTGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=233.90 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=26.4 sequence=AAGAAGAAGAAA SRR1799561 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:50:05 Started mapping on | Feb 13 23:50:05 Finished on | Feb 13 23:52:04 Mapping speed, Million of reads per hour | 645.99 Number of input reads | 21353702 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 20496125 Uniquely mapped reads % | 95.98% Average mapped length | 285.62 Number of splices: Total | 16812401 Number of splices: Annotated (sjdb) | 16514708 Number of splices: GT/AG | 16544995 Number of splices: GC/AG | 206282 Number of splices: AT/AC | 16995 Number of splices: Non-canonical | 44129 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.04% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442937 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 50156 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 432867 432867 432867 N_multimapping 442937 442937 442937 N_noFeature 608458 20240663 730846 N_ambiguous 208610 1103 74750 UnstrandedReadsAssigned:19679057 PositiveStrandReadsAssigned:254359 NegativeStrandReadsAssigned:19690529 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR1799561 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799561-trimmed-pair1.fastq SRR1799561-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,353,702 reads, 19,688,741 reads pseudoaligned [quant] estimated average fragment length: 185.866 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR1799561.ke.tsv 34699 SRR1799561.se.tsv 87100 total ==> SRR1799561.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1833.13 486 13.9017 Potri.005G024800.1.v4.1 1035 850.134 74 4.56427 Potri.004G059700.1.v4.1 961 776.134 40 2.70241 Potri.007G009000.2.v4.1 1416 1231.13 0 0 Potri.003G141000.2.v4.1 2943 2758.13 291 5.53229 Potri.016G087400.1.v4.1 270 101.134 2113.52 1095.82 Potri.015G069301.1.v4.1 564 379.615 0 0 Potri.010G195200.1.v4.1 1773 1588.13 84 2.77344 Potri.012G127500.1.v4.1 977 792.134 11136 737.153 ==> SRR1799561.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1849 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 453 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799561 completed mapping pipeline successfully