Starting /dee2/code/volunteer_pipeline.sh SRR18272729 current disk space = 3057137963008 free memory = 1477869668 SRR18272729 SRAfilesize 5a12d3ff91babaa16659542e2f6e5310 SRR18272729.sra SRR18272729.sra file validated SRR18272729 is paired end SRR18272729 is conventional basespace SRR18272729 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272729_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2945 37.0 36.0 37.0 35.0 38.0 2 35.705 37.0 36.0 37.0 34.0 38.0 3 36.134 37.0 36.0 37.0 35.0 38.0 4 36.268 37.0 36.0 37.0 35.0 38.0 5 36.19875 37.0 36.0 37.0 35.0 38.0 6 36.23975 37.0 36.0 37.0 35.0 38.0 7 36.24875 37.0 36.0 37.0 35.0 38.0 8 36.31175 37.0 36.0 37.0 35.0 38.0 9 36.24975 37.0 36.0 37.0 35.0 38.0 10-14 36.19455 37.0 36.0 37.0 35.0 38.0 15-19 36.210750000000004 37.0 36.0 37.0 35.0 38.0 20-24 36.21745 37.0 36.0 37.0 35.0 38.0 25-29 36.145050000000005 37.0 36.0 37.0 35.0 38.0 30-34 36.149 37.0 36.0 37.0 35.0 38.0 35-39 36.1465 37.0 36.0 37.0 35.0 38.0 40-44 36.11625 37.0 36.0 37.0 35.0 38.0 45-49 36.1577 37.0 36.0 37.0 35.0 38.0 50-54 36.031549999999996 37.0 36.0 37.0 34.8 38.0 55-59 36.04495 37.0 36.0 37.0 35.0 38.0 60-64 36.03515 37.0 36.0 37.0 34.8 38.0 65-69 36.0002 37.0 36.0 37.0 34.6 38.0 70-74 35.91705 37.0 36.0 37.0 34.0 38.0 75-79 35.9032 37.0 36.0 37.0 34.0 38.0 80-84 35.85045000000001 37.0 36.0 37.0 34.0 38.0 85-89 35.727050000000006 37.0 36.0 37.0 33.8 38.0 90-94 35.646049999999995 37.0 36.0 37.0 33.8 38.0 95-99 35.68415 37.0 36.0 37.0 33.8 38.0 100-104 35.59825 37.0 36.0 37.0 33.4 38.0 105-109 35.5318 37.0 36.0 37.0 33.0 38.0 110-114 35.393 37.0 36.0 37.0 32.6 38.0 115-119 35.2925 37.0 36.0 37.0 32.2 38.0 120-124 35.168899999999994 37.0 36.0 37.0 31.6 38.0 125-129 35.005 37.0 35.8 37.0 30.8 38.0 130-134 34.94845 37.0 35.6 37.0 30.8 38.0 135-139 34.82755 37.0 35.2 37.0 30.0 38.0 140-144 34.60145 37.0 35.0 37.0 29.0 38.0 145-149 34.5507 37.0 35.0 37.0 29.0 38.0 150 34.43925 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 4.0 28 20.0 29 33.0 30 69.0 31 82.0 32 130.0 33 189.0 34 364.0 35 767.0 36 1661.0 37 680.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 17.25 12.9 37.75 2 18.375 24.95 43.475 13.200000000000001 3 16.475 27.250000000000004 30.325000000000003 25.95 4 20.75 37.0 25.05 17.2 5 20.599999999999998 37.574999999999996 24.75 17.075000000000003 6 14.7 36.5 28.65 20.150000000000002 7 15.25 14.549999999999999 45.800000000000004 24.4 8 19.0 20.825 29.45 30.725 9 20.9 21.75 28.425 28.925 10-14 20.985 28.99 27.16 22.865 15-19 21.535 27.529999999999998 28.185 22.75 20-24 21.029999999999998 28.26 28.1 22.61 25-29 21.36 28.875 27.905 21.86 30-34 21.81 28.689999999999998 27.500000000000004 22.0 35-39 22.35 28.060000000000002 27.565 22.025 40-44 21.8 27.900000000000002 28.335 21.965 45-49 22.215 27.994999999999997 27.650000000000002 22.14 50-54 21.865000000000002 28.46 27.884999999999998 21.790000000000003 55-59 21.845 28.315 27.63 22.21 60-64 22.220000000000002 28.244999999999997 27.32 22.215 65-69 21.955 27.950000000000003 27.67 22.425 70-74 22.11 28.4 27.595 21.895 75-79 22.345000000000002 28.185 27.355 22.115000000000002 80-84 22.42 28.4 27.29 21.89 85-89 22.45 28.389999999999997 27.305 21.855 90-94 23.06 27.55 27.47 21.92 95-99 22.6 27.575 28.32 21.505 100-104 21.955 28.24 27.73 22.075 105-109 21.83 28.249999999999996 27.634999999999998 22.285 110-114 22.11 28.21 27.21 22.470000000000002 115-119 22.68 28.13 27.715 21.475 120-124 22.06 27.529999999999998 27.87 22.54 125-129 21.815 27.750000000000004 27.675 22.759999999999998 130-134 22.994999999999997 27.284999999999997 27.765 21.955 135-139 22.195 27.395000000000003 27.750000000000004 22.66 140-144 22.335 27.939999999999998 27.450000000000003 22.275 145-149 22.689999999999998 27.77 27.279999999999998 22.259999999999998 150 23.400000000000002 25.874999999999996 27.575 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 2.0 26 4.0 27 7.0 28 10.0 29 14.5 30 20.5 31 21.0 32 27.0 33 44.5 34 52.5 35 68.0 36 90.5 37 109.5 38 141.0 39 163.0 40 203.0 41 238.5 42 253.0 43 271.0 44 271.0 45 263.0 46 246.5 47 229.0 48 225.5 49 210.0 50 174.0 51 142.5 52 120.5 53 86.0 54 59.0 55 52.0 56 41.5 57 33.0 58 21.0 59 16.0 60 17.0 61 13.0 62 10.0 63 6.5 64 4.5 65 5.5 66 3.0 67 2.5 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06636386575826 98.15 2 0.9336361342417362 1.8499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAACC 10 0.006973645 144.0 2 GTCTCCA 10 0.006973645 144.0 4 >>END_MODULE SRR18272729 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272729_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.90275 37.0 36.0 37.0 34.0 38.0 2 35.21225 37.0 36.0 37.0 32.0 38.0 3 35.9205 37.0 36.0 37.0 34.0 38.0 4 35.82575 37.0 36.0 37.0 34.0 38.0 5 35.62575 37.0 36.0 37.0 34.0 38.0 6 35.76475 37.0 36.0 37.0 34.0 38.0 7 35.74825 37.0 36.0 37.0 34.0 38.0 8 35.73975 37.0 36.0 37.0 34.0 38.0 9 35.96 37.0 36.0 37.0 34.0 38.0 10-14 35.75435 37.0 36.0 37.0 33.8 38.0 15-19 35.78189999999999 37.0 36.0 37.0 34.0 38.0 20-24 35.72305 37.0 36.0 37.0 33.8 38.0 25-29 35.7115 37.0 36.0 37.0 34.0 38.0 30-34 35.6192 37.0 36.0 37.0 33.6 38.0 35-39 35.5229 37.0 36.0 37.0 33.2 38.0 40-44 35.5224 37.0 36.0 37.0 33.0 38.0 45-49 35.5877 37.0 36.0 37.0 33.2 38.0 50-54 35.4582 37.0 36.0 37.0 32.8 38.0 55-59 35.32395 37.0 36.0 37.0 32.2 37.8 60-64 35.2333 37.0 35.6 37.0 32.0 38.0 65-69 35.211949999999995 37.0 35.4 37.0 32.0 38.0 70-74 35.1493 37.0 35.2 37.0 31.8 37.6 75-79 34.85355 37.0 35.0 37.0 30.4 37.8 80-84 34.850950000000005 37.0 35.0 37.0 31.0 37.4 85-89 34.6048 37.0 35.0 37.0 29.4 37.0 90-94 34.6102 37.0 35.0 37.0 29.2 37.2 95-99 34.43245 37.0 35.0 37.0 28.6 37.2 100-104 34.2956 36.6 35.0 37.0 28.0 37.0 105-109 34.10795 36.2 35.0 37.0 27.2 37.0 110-114 33.934749999999994 36.0 34.6 37.0 26.6 37.0 115-119 33.82985 36.0 34.6 37.0 25.6 37.0 120-124 33.508449999999996 36.0 34.0 37.0 24.4 37.0 125-129 33.26925 36.0 34.0 37.0 23.2 37.0 130-134 33.100049999999996 36.0 33.6 37.0 22.8 37.0 135-139 32.608850000000004 36.0 32.8 37.0 20.4 37.0 140-144 32.4987 36.0 32.4 37.0 20.0 37.0 145-149 32.2457 36.0 31.8 37.0 19.0 37.0 150 32.042 36.0 32.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 32.0 28 79.0 29 123.0 30 143.0 31 203.0 32 284.0 33 363.0 34 542.0 35 825.0 36 1046.0 37 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.825 15.7 12.3 38.175 2 18.725 24.45 42.425000000000004 14.399999999999999 3 15.7 27.400000000000002 30.575000000000003 26.325 4 20.325 38.2 24.099999999999998 17.375 5 19.225 35.85 27.175 17.75 6 14.524999999999999 36.375 29.9 19.2 7 15.975 13.975000000000001 46.5 23.549999999999997 8 18.575 20.875 29.625 30.925000000000004 9 19.775000000000002 22.225 30.375000000000004 27.625 10-14 21.08 29.104999999999997 26.77 23.044999999999998 15-19 21.355 27.66 28.299999999999997 22.685 20-24 21.47 28.315 28.03 22.185 25-29 21.485000000000003 27.925 28.335 22.255 30-34 21.395 28.265 27.58 22.759999999999998 35-39 21.495 27.985 27.91 22.61 40-44 21.485000000000003 28.244999999999997 27.775 22.495 45-49 21.560000000000002 28.22 27.41 22.81 50-54 21.605 27.91 27.51 22.975 55-59 22.08 28.439999999999998 27.175 22.305 60-64 21.645 28.23 27.61 22.515 65-69 21.39 28.494999999999997 27.41 22.705000000000002 70-74 21.845 27.68 27.855 22.62 75-79 22.634999999999998 28.065 27.055 22.245 80-84 21.5 28.375 27.315 22.81 85-89 22.225 28.08 27.725 21.97 90-94 22.175 27.675 27.685 22.465 95-99 21.795 28.155 27.465 22.585 100-104 21.83 28.535 27.744999999999997 21.89 105-109 22.23 27.74 27.200000000000003 22.830000000000002 110-114 22.134999999999998 27.6 27.51 22.755 115-119 22.34 27.58 27.425 22.655 120-124 21.990000000000002 27.450000000000003 27.875 22.685 125-129 22.97 26.935 27.439999999999998 22.655 130-134 22.98614930746537 27.706385319265962 26.516325816290813 22.79113955697785 135-139 22.585 27.47 27.345000000000002 22.6 140-144 22.89 26.985 27.065 23.06 145-149 23.097309730973098 27.11271127112711 26.897689768976896 22.892289228922895 150 23.35 25.775 27.625 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 2.0 25 4.0 26 3.0 27 3.0 28 8.0 29 13.5 30 21.0 31 26.5 32 33.5 33 40.0 34 48.5 35 59.5 36 76.5 37 101.5 38 137.0 39 163.0 40 185.0 41 219.0 42 249.5 43 281.5 44 290.0 45 281.5 46 268.0 47 244.5 48 220.0 49 204.5 50 176.5 51 140.5 52 115.5 53 89.5 54 66.5 55 48.5 56 39.5 57 30.5 58 20.0 59 17.5 60 13.0 61 9.5 62 10.0 63 7.5 64 7.0 65 6.5 66 3.5 67 1.5 68 2.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.81102959777385 97.65 2 1.1889704022261574 2.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322923 spots for SRR18272729.sra Written 1322923 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra Read 1322913 spots for SRR18272729.sra Written 1322913 spots for SRR18272729.sra SRR ids: ['SRR18272729.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nyzsne1r SRR18272729.sra spots: 26458270 blocks: [[1, 1322913], [1322914, 2645826], [2645827, 3968739], [3968740, 5291652], [5291653, 6614565], [6614566, 7937478], [7937479, 9260391], [9260392, 10583304], [10583305, 11906217], [11906218, 13229130], [13229131, 14552043], [14552044, 15874956], [15874957, 17197869], [17197870, 18520782], [18520783, 19843695], [19843696, 21166608], [21166609, 22489521], [22489522, 23812434], [23812435, 25135347], [25135348, 26458270]] SRR18272729 file size 9420076 SRR18272729 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18272729 SRR18272729_1.fastq SRR18272729_2.fastq Input file: SRR18272729_1.fastq Paired file: SRR18272729_2.fastq trimmed: SRR18272729-trimmed-pair1.fastq, SRR18272729-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:17:35 2025 >> started Tue Feb 11 01:18:05 2025 >> done (30.939s) 26458270 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 26458270 (100.00%) read pairs available; of these: 1473998 ( 5.57%) trimmed read pairs available after processing 24984272 (94.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 1 0.00% 142 15 0.00% 143 15 0.00% 144 6 0.00% 145 6 0.00% 146 25 0.00% 147 266 0.00% 148 12786 0.05% 149 1460878 5.52% 150 24984272 94.43% 26458270 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=41.88 fanout-score-rank=12 prefix-density=0.30 prefix-fanout=22.0 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=344.06 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=29.7 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=47.63 fanout-score-rank=11 prefix-density=0.33 prefix-fanout=24.6 sequence=AAGTCGGATCGTAGCCATG criterion=fanout-score sequence-density=0.06 sequence-density-rank=9 fanout-score=346.36 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=34.1 sequence=TTCTTCTTCTTT SRR18272729 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:18:49 Started mapping on | Feb 11 01:18:52 Finished on | Feb 11 01:21:20 Mapping speed, Million of reads per hour | 643.58 Number of input reads | 26458270 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 25328058 Uniquely mapped reads % | 95.73% Average mapped length | 298.40 Number of splices: Total | 24455672 Number of splices: Annotated (sjdb) | 24047418 Number of splices: GT/AG | 24049929 Number of splices: GC/AG | 327671 Number of splices: AT/AC | 23740 Number of splices: Non-canonical | 54332 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.02% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 612215 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 928 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 517997 517997 517997 N_multimapping 612215 612215 612215 N_noFeature 539417 12593470 13109097 N_ambiguous 298039 69493 64516 UnstrandedReadsAssigned:24490602 PositiveStrandReadsAssigned:12665095 NegativeStrandReadsAssigned:12154445 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18272729 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18272729-trimmed-pair1.fastq SRR18272729-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,458,270 reads, 25,039,278 reads pseudoaligned [quant] estimated average fragment length: 266.857 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR18272729.ke.tsv 34699 SRR18272729.se.tsv 87100 total ==> SRR18272729.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.14 1479 29.6281 Potri.005G024800.1.v4.1 1035 769.143 322 14.6945 Potri.004G059700.1.v4.1 961 695.143 369 18.6319 Potri.007G009000.2.v4.1 1416 1150.14 0 0 Potri.003G141000.2.v4.1 2943 2677.14 1307 17.136 Potri.016G087400.1.v4.1 270 58.5599 1717.51 1029.45 Potri.015G069301.1.v4.1 564 299.772 0 0 Potri.010G195200.1.v4.1 1773 1507.14 133 3.09744 Potri.012G127500.1.v4.1 977 711.143 24614 1214.87 ==> SRR18272729.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1028 Potri.001G233950.v4.1 11 Potri.001G122700.v4.1 770 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 85 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 31 SRR18272729 completed mapping pipeline successfully