Starting /dee2/code/volunteer_pipeline.sh SRR18272730 current disk space = 3057212710912 free memory = 1346985848 SRR18272730 SRAfilesize 788e180b2eaa51e096559bef3121250e SRR18272730.sra SRR18272730.sra file validated SRR18272730 is paired end SRR18272730 is conventional basespace SRR18272730 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272730_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.302 37.0 37.0 37.0 35.0 38.0 2 35.9015 37.0 36.0 37.0 34.0 38.0 3 36.335 37.0 37.0 37.0 35.0 38.0 4 36.37275 37.0 37.0 37.0 35.0 38.0 5 36.29225 37.0 36.0 37.0 35.0 38.0 6 36.26025 37.0 36.0 37.0 35.0 38.0 7 36.38475 37.0 37.0 37.0 35.0 38.0 8 36.466 37.0 37.0 37.0 35.0 38.0 9 36.33625 37.0 36.0 37.0 35.0 38.0 10-14 36.28885 37.0 36.2 37.0 35.0 38.0 15-19 36.31985000000001 37.0 36.0 37.0 35.0 38.0 20-24 36.306999999999995 37.0 36.6 37.0 35.0 38.0 25-29 36.318099999999994 37.0 36.0 37.0 35.0 38.0 30-34 36.27135 37.0 36.0 37.0 35.0 38.0 35-39 36.2493 37.0 36.0 37.0 35.0 38.0 40-44 36.2762 37.0 36.0 37.0 35.0 38.0 45-49 36.2449 37.0 36.0 37.0 35.0 38.0 50-54 36.221450000000004 37.0 36.0 37.0 35.0 38.0 55-59 36.10475 37.0 36.0 37.0 35.0 38.0 60-64 36.09135 37.0 36.0 37.0 35.0 38.0 65-69 36.087450000000004 37.0 36.0 37.0 34.8 38.0 70-74 36.06465 37.0 36.0 37.0 35.0 38.0 75-79 35.98365 37.0 36.0 37.0 34.6 38.0 80-84 35.95235 37.0 36.0 37.0 34.4 38.0 85-89 35.893550000000005 37.0 36.0 37.0 34.0 38.0 90-94 35.75535 37.0 36.0 37.0 33.8 38.0 95-99 35.79559999999999 37.0 36.0 37.0 34.0 38.0 100-104 35.6394 37.0 36.0 37.0 33.4 38.0 105-109 35.589999999999996 37.0 36.0 37.0 33.2 38.0 110-114 35.560449999999996 37.0 36.0 37.0 33.0 38.0 115-119 35.5038 37.0 36.0 37.0 33.0 38.0 120-124 35.34805000000001 37.0 36.0 37.0 32.2 38.0 125-129 35.18765 37.0 36.0 37.0 31.8 38.0 130-134 35.126 37.0 36.0 37.0 31.4 38.0 135-139 34.9987 37.0 35.8 37.0 30.8 38.0 140-144 34.780150000000006 37.0 35.2 37.0 29.8 38.0 145-149 34.675399999999996 37.0 35.0 37.0 29.2 38.0 150 34.653 37.0 35.0 37.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 7.0 28 28.0 29 46.0 30 54.0 31 67.0 32 110.0 33 160.0 34 324.0 35 673.0 36 1633.0 37 896.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.35 16.175 11.675 37.8 2 18.45 24.275 42.75 14.524999999999999 3 17.150000000000002 26.8 31.974999999999998 24.075 4 21.4 34.949999999999996 25.6 18.05 5 21.099999999999998 34.849999999999994 25.85 18.2 6 15.45 35.85 28.499999999999996 20.200000000000003 7 13.450000000000001 14.6 46.6 25.35 8 19.025 21.4 29.4 30.175 9 21.475 22.85 28.475 27.200000000000003 10-14 21.23 28.544999999999998 27.389999999999997 22.835 15-19 21.88 28.29 27.96 21.87 20-24 21.615000000000002 28.345 27.544999999999998 22.495 25-29 21.535 28.139999999999997 28.315 22.009999999999998 30-34 21.595 28.04 27.49 22.875 35-39 21.69 27.73 27.915 22.665 40-44 21.875 28.26 27.284999999999997 22.58 45-49 22.994999999999997 27.77 26.825 22.41 50-54 21.985 27.49 27.91 22.615 55-59 22.3 27.994999999999997 27.87 21.834999999999997 60-64 21.91 28.299999999999997 27.584999999999997 22.205 65-69 22.475 27.79 27.325 22.41 70-74 22.175 28.310000000000002 27.24 22.275 75-79 22.415 27.955000000000002 27.584999999999997 22.045 80-84 22.2 27.705000000000002 28.065 22.03 85-89 23.1 27.334999999999997 27.474999999999998 22.09 90-94 22.509999999999998 27.565 27.250000000000004 22.675 95-99 22.14 27.32 28.349999999999998 22.189999999999998 100-104 22.57 27.810000000000002 27.73 21.89 105-109 22.215 28.255000000000003 27.689999999999998 21.84 110-114 22.814999999999998 27.634999999999998 27.810000000000002 21.740000000000002 115-119 22.46 27.900000000000002 27.51 22.13 120-124 22.46 27.77 27.13 22.64 125-129 22.435 27.315 28.544999999999998 21.705 130-134 22.79 27.68 28.015 21.515 135-139 22.335 27.339999999999996 28.455000000000002 21.87 140-144 23.285 27.42 27.089999999999996 22.205 145-149 23.035 27.18 27.500000000000004 22.285 150 23.125 27.625 27.950000000000003 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.0 23 2.0 24 4.0 25 2.5 26 2.5 27 3.5 28 9.5 29 15.0 30 18.0 31 21.0 32 28.5 33 38.0 34 53.5 35 66.0 36 77.5 37 104.5 38 135.0 39 157.0 40 186.5 41 227.0 42 248.5 43 260.0 44 266.5 45 265.5 46 259.0 47 242.0 48 216.0 49 192.0 50 168.5 51 157.5 52 135.5 53 97.5 54 70.0 55 56.5 56 48.0 57 40.0 58 29.5 59 15.0 60 16.0 61 17.0 62 12.0 63 7.0 64 6.5 65 6.5 66 3.0 67 3.0 68 3.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42559674961909 96.89999999999999 2 1.5744032503809042 3.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18272730 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272730_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.00425 37.0 36.0 37.0 35.0 38.0 2 35.53225 37.0 36.0 37.0 33.0 38.0 3 36.15625 37.0 36.0 37.0 35.0 38.0 4 36.093 37.0 36.0 37.0 35.0 38.0 5 36.0435 37.0 36.0 37.0 35.0 38.0 6 35.93825 37.0 36.0 37.0 34.0 38.0 7 35.95025 37.0 36.0 37.0 34.0 38.0 8 35.91425 37.0 36.0 37.0 34.0 38.0 9 36.037 37.0 36.0 37.0 35.0 38.0 10-14 35.9234 37.0 36.0 37.0 34.2 38.0 15-19 35.9416 37.0 36.0 37.0 34.2 38.0 20-24 35.946099999999994 37.0 36.0 37.0 34.0 38.0 25-29 35.87965 37.0 36.0 37.0 34.0 38.0 30-34 35.844049999999996 37.0 36.0 37.0 34.0 38.0 35-39 35.8166 37.0 36.0 37.0 33.8 38.0 40-44 35.74275 37.0 36.0 37.0 33.8 38.0 45-49 35.731849999999994 37.0 36.0 37.0 33.8 38.0 50-54 35.617399999999996 37.0 36.0 37.0 33.2 38.0 55-59 35.59245 37.0 36.0 37.0 33.0 38.0 60-64 35.46315 37.0 36.0 37.0 32.8 38.0 65-69 35.38430000000001 37.0 36.0 37.0 32.2 38.0 70-74 35.36664999999999 37.0 36.0 37.0 32.4 38.0 75-79 35.09745 37.0 35.6 37.0 31.2 38.0 80-84 35.10855 37.0 35.2 37.0 31.2 38.0 85-89 34.911899999999996 37.0 35.0 37.0 30.8 38.0 90-94 34.864850000000004 37.0 35.0 37.0 30.6 38.0 95-99 34.6349 37.0 35.0 37.0 29.2 38.0 100-104 34.47605 37.0 35.0 37.0 28.8 38.0 105-109 34.3174 37.0 35.0 37.0 27.6 38.0 110-114 34.2214 37.0 35.0 37.0 27.4 38.0 115-119 34.03580000000001 36.8 35.0 37.0 26.4 38.0 120-124 33.83710000000001 36.0 34.4 37.0 25.6 38.0 125-129 33.6143 36.0 34.2 37.0 24.2 38.0 130-134 33.404450000000004 36.0 34.0 37.0 23.6 37.6 135-139 33.0938 36.0 33.6 37.0 22.4 37.2 140-144 32.87605 36.0 33.4 37.0 21.8 37.4 145-149 32.554649999999995 36.0 32.8 37.0 19.6 37.2 150 32.7305 36.0 33.0 37.0 21.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 6.0 27 30.0 28 76.0 29 114.0 30 140.0 31 166.0 32 208.0 33 320.0 34 481.0 35 795.0 36 1160.0 37 504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.15 17.65 11.35 37.85 2 19.675 23.825 41.975 14.524999999999999 3 14.825 28.475 30.625000000000004 26.075 4 18.65 37.075 24.65 19.625 5 21.2 35.099999999999994 25.35 18.35 6 14.875 36.199999999999996 27.675 21.25 7 15.075 14.924999999999999 46.45 23.549999999999997 8 18.25 20.95 30.525000000000002 30.275000000000002 9 19.675 23.075000000000003 28.475 28.775000000000002 10-14 20.205000000000002 29.110000000000003 26.985 23.7 15-19 20.93 28.349999999999998 27.560000000000002 23.16 20-24 21.16 28.110000000000003 27.644999999999996 23.085 25-29 21.8 28.27 27.295 22.634999999999998 30-34 21.87 28.83 26.915 22.384999999999998 35-39 21.335 28.255000000000003 27.88 22.53 40-44 21.77 28.13 27.405 22.695 45-49 22.105 27.92 27.455000000000002 22.52 50-54 21.709999999999997 27.82 27.705000000000002 22.765 55-59 21.625 27.694999999999997 27.74 22.939999999999998 60-64 21.265 28.315 27.665 22.755 65-69 21.745 28.249999999999996 27.47 22.535 70-74 21.88 28.215 26.82 23.085 75-79 21.945 28.08 27.13 22.845 80-84 22.009999999999998 28.035 27.6 22.355 85-89 21.61 28.225 27.060000000000002 23.105 90-94 22.445 27.68 27.22 22.655 95-99 22.67 27.779999999999998 27.11 22.439999999999998 100-104 22.71 27.575 27.82 21.895 105-109 21.87 28.32 26.96 22.85 110-114 21.905 27.474999999999998 27.575 23.044999999999998 115-119 22.975 27.224999999999998 27.185 22.615 120-124 22.21 26.965 27.21 23.615 125-129 22.605 27.139999999999997 27.205000000000002 23.05 130-134 22.67 27.595 26.919999999999998 22.814999999999998 135-139 23.31 27.355 26.41 22.925 140-144 23.225 27.54 27.04 22.195 145-149 23.11615580779039 27.936396819840994 26.911345567278367 22.036101805090254 150 22.25 27.275 25.95 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 3.5 25 3.5 26 3.0 27 4.0 28 9.5 29 13.5 30 14.5 31 16.0 32 24.0 33 37.5 34 52.0 35 70.0 36 90.0 37 110.5 38 135.0 39 168.0 40 193.0 41 210.0 42 230.0 43 246.5 44 266.5 45 273.0 46 259.5 47 240.0 48 216.5 49 204.0 50 190.0 51 156.5 52 117.0 53 102.0 54 85.0 55 61.0 56 43.5 57 34.0 58 28.5 59 16.0 60 13.0 61 13.5 62 13.0 63 10.0 64 6.0 65 2.5 66 1.5 67 3.0 68 2.0 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.3739837398374 96.8 2 1.6260162601626018 3.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCAG 10 0.006973645 144.0 4 CTGATAT 10 0.006973645 144.0 1 CATCAAA 10 0.006973645 144.0 4 CCATCAA 10 0.006973645 144.0 3 ATCAAAT 10 0.006973645 144.0 5 >>END_MODULE Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598240 spots for SRR18272730.sra Written 1598240 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra Read 1598234 spots for SRR18272730.sra Written 1598234 spots for SRR18272730.sra SRR ids: ['SRR18272730.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_94gt78lr SRR18272730.sra spots: 31964686 blocks: [[1, 1598234], [1598235, 3196468], [3196469, 4794702], [4794703, 6392936], [6392937, 7991170], [7991171, 9589404], [9589405, 11187638], [11187639, 12785872], [12785873, 14384106], [14384107, 15982340], [15982341, 17580574], [17580575, 19178808], [19178809, 20777042], [20777043, 22375276], [22375277, 23973510], [23973511, 25571744], [25571745, 27169978], [27169979, 28768212], [28768213, 30366446], [30366447, 31964686]] SRR18272730 file size 11382812 SRR18272730 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18272730 SRR18272730_1.fastq SRR18272730_2.fastq Input file: SRR18272730_1.fastq Paired file: SRR18272730_2.fastq trimmed: SRR18272730-trimmed-pair1.fastq, SRR18272730-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:44:03 2025 >> started Tue Feb 11 00:44:42 2025 >> done (38.937s) 31964686 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 31964686 (100.00%) read pairs available; of these: 1721593 ( 5.39%) trimmed read pairs available after processing 30243093 (94.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 137 1 0.00% 138 0 0.00% 139 0 0.00% 140 1 0.00% 141 4 0.00% 142 68 0.00% 143 51 0.00% 144 42 0.00% 145 22 0.00% 146 23 0.00% 147 308 0.00% 148 15006 0.05% 149 1706067 5.34% 150 30243093 94.61% 31964686 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=64.85 fanout-score-rank=9 prefix-density=0.79 prefix-fanout=29.2 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=344.39 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=30.4 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=62.30 fanout-score-rank=8 prefix-density=0.86 prefix-fanout=30.0 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=343.52 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=33.6 sequence=TTCTTCTTCTTT SRR18272730 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:45:27 Started mapping on | Feb 11 00:45:27 Finished on | Feb 11 00:48:32 Mapping speed, Million of reads per hour | 622.02 Number of input reads | 31964686 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 30471367 Uniquely mapped reads % | 95.33% Average mapped length | 298.25 Number of splices: Total | 29364683 Number of splices: Annotated (sjdb) | 28873413 Number of splices: GT/AG | 28881098 Number of splices: GC/AG | 389085 Number of splices: AT/AC | 28665 Number of splices: Non-canonical | 65835 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 745768 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 1289 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747551 747551 747551 N_multimapping 745768 745768 745768 N_noFeature 648114 15150657 15773440 N_ambiguous 356881 84672 77916 UnstrandedReadsAssigned:29466372 PositiveStrandReadsAssigned:15236038 NegativeStrandReadsAssigned:14620011 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18272730 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18272730-trimmed-pair1.fastq SRR18272730-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,964,686 reads, 30,323,742 reads pseudoaligned [quant] estimated average fragment length: 248.698 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR18272730.ke.tsv 34699 SRR18272730.se.tsv 87100 total ==> SRR18272730.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.3 1824 30.0036 Potri.005G024800.1.v4.1 1035 787.302 402 14.869 Potri.004G059700.1.v4.1 961 713.322 434 17.7174 Potri.007G009000.2.v4.1 1416 1168.3 0 0 Potri.003G141000.2.v4.1 2943 2695.3 1570.3 16.9657 Potri.016G087400.1.v4.1 270 67.6749 2191 942.78 Potri.015G069301.1.v4.1 564 317.482 0 0 Potri.010G195200.1.v4.1 1773 1525.3 164 3.13101 Potri.012G127500.1.v4.1 977 729.315 31646 1263.57 ==> SRR18272730.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1226 Potri.001G233950.v4.1 11 Potri.001G122700.v4.1 912 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 111 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 42 SRR18272730 completed mapping pipeline successfully