Starting /dee2/code/volunteer_pipeline.sh SRR18272731 current disk space = 3057276080128 free memory = 1127790900 SRR18272731 SRAfilesize f9b79f4cdaa8e941ebf5bceb33021608 SRR18272731.sra SRR18272731.sra file validated SRR18272731 is paired end SRR18272731 is conventional basespace SRR18272731 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272731_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.287 37.0 36.0 37.0 35.0 38.0 2 35.801 37.0 36.0 37.0 34.0 38.0 3 36.30325 37.0 36.0 37.0 35.0 38.0 4 36.367 37.0 36.0 37.0 35.0 38.0 5 36.186 37.0 36.0 37.0 35.0 38.0 6 36.261 37.0 36.0 37.0 35.0 38.0 7 36.26025 37.0 36.0 37.0 35.0 38.0 8 36.26125 37.0 36.0 37.0 35.0 38.0 9 36.23825 37.0 36.0 37.0 35.0 38.0 10-14 36.216150000000006 37.0 36.0 37.0 35.0 38.0 15-19 36.16 37.0 36.0 37.0 35.0 38.0 20-24 36.270250000000004 37.0 36.0 37.0 35.0 38.0 25-29 36.22135 37.0 36.0 37.0 35.0 38.0 30-34 36.143299999999996 37.0 36.0 37.0 35.0 38.0 35-39 36.1743 37.0 36.0 37.0 35.0 38.0 40-44 36.171499999999995 37.0 36.0 37.0 35.0 38.0 45-49 36.14835 37.0 36.0 37.0 35.0 38.0 50-54 36.141099999999994 37.0 36.0 37.0 34.8 38.0 55-59 36.01305 37.0 36.0 37.0 35.0 38.0 60-64 36.006600000000006 37.0 36.0 37.0 35.0 38.0 65-69 36.01495 37.0 36.0 37.0 34.8 38.0 70-74 35.9117 37.0 36.0 37.0 34.2 38.0 75-79 35.968900000000005 37.0 36.0 37.0 34.4 38.0 80-84 35.91945 37.0 36.0 37.0 34.2 38.0 85-89 35.78885 37.0 36.0 37.0 34.0 38.0 90-94 35.72305 37.0 36.0 37.0 33.8 38.0 95-99 35.71155 37.0 36.0 37.0 33.6 38.0 100-104 35.5179 37.0 36.0 37.0 32.8 38.0 105-109 35.5332 37.0 36.0 37.0 33.2 38.0 110-114 35.42700000000001 37.0 36.0 37.0 33.0 38.0 115-119 35.398450000000004 37.0 36.0 37.0 32.6 38.0 120-124 35.295100000000005 37.0 36.0 37.0 32.4 38.0 125-129 35.154399999999995 37.0 35.8 37.0 31.6 38.0 130-134 35.082049999999995 37.0 35.8 37.0 31.4 38.0 135-139 34.93634999999999 37.0 35.6 37.0 30.6 38.0 140-144 34.7649 37.0 35.0 37.0 29.8 38.0 145-149 34.6741 37.0 35.0 37.0 29.2 38.0 150 34.49425 37.0 35.0 37.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 6.0 28 24.0 29 44.0 30 60.0 31 86.0 32 111.0 33 204.0 34 335.0 35 709.0 36 1594.0 37 826.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.725 16.925 11.799999999999999 36.55 2 17.75 23.724999999999998 44.324999999999996 14.2 3 15.725 28.125 30.599999999999998 25.55 4 20.825 37.625 24.95 16.6 5 20.9 35.8 26.075 17.224999999999998 6 14.774999999999999 36.199999999999996 28.599999999999998 20.424999999999997 7 14.549999999999999 15.7 45.574999999999996 24.175 8 19.275000000000002 20.974999999999998 28.799999999999997 30.95 9 20.05 23.325000000000003 27.85 28.775000000000002 10-14 21.125 28.799999999999997 26.765 23.31 15-19 21.565 28.21 28.46 21.765 20-24 21.515 28.105000000000004 27.700000000000003 22.68 25-29 21.66 27.894999999999996 28.42 22.025 30-34 21.51 28.689999999999998 27.485 22.314999999999998 35-39 21.705 28.349999999999998 27.965 21.98 40-44 22.31 27.889999999999997 27.765 22.035 45-49 21.709999999999997 28.48 27.615000000000002 22.195 50-54 21.925 28.64 26.965 22.470000000000002 55-59 22.74 28.07 27.24 21.95 60-64 22.045 28.46 27.305 22.189999999999998 65-69 22.23 28.144999999999996 27.83 21.795 70-74 22.085 28.455000000000002 27.529999999999998 21.93 75-79 22.785 28.17 27.27 21.775 80-84 21.925 28.389999999999997 27.029999999999998 22.655 85-89 21.975 28.59 27.705000000000002 21.73 90-94 22.7 27.375 28.355000000000004 21.57 95-99 22.17 27.805000000000003 27.845 22.18 100-104 22.55 27.52 27.955000000000002 21.975 105-109 22.055 27.725 27.975 22.245 110-114 22.25 28.26 27.794999999999998 21.695 115-119 22.81 28.17 27.455000000000002 21.565 120-124 22.345000000000002 28.03 27.615000000000002 22.009999999999998 125-129 22.865 27.750000000000004 27.185 22.2 130-134 22.766138306915344 28.746437321866093 27.57637881894095 20.911045552277614 135-139 22.855 27.255000000000003 27.76 22.13 140-144 22.195 27.76 27.689999999999998 22.355 145-149 23.35 27.08 26.924999999999997 22.645 150 22.05 29.549999999999997 26.625 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.5 23 1.5 24 1.5 25 4.5 26 7.5 27 6.0 28 9.0 29 13.5 30 18.0 31 26.5 32 34.0 33 40.0 34 49.0 35 72.0 36 87.0 37 104.0 38 145.5 39 174.0 40 192.0 41 224.5 42 242.0 43 253.5 44 272.5 45 274.0 46 270.0 47 237.0 48 201.5 49 204.5 50 180.0 51 142.5 52 115.5 53 90.0 54 73.0 55 57.0 56 43.5 57 31.0 58 22.5 59 13.0 60 14.0 61 14.5 62 9.0 63 7.5 64 5.5 65 3.5 66 3.0 67 2.5 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11464968152866 96.275 2 1.8598726114649682 3.65 3 0.025477707006369425 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTTG 10 0.006973645 144.0 3 GTTTTCT 10 0.006973645 144.0 1 CTACCAC 10 0.006973645 144.0 8 >>END_MODULE SRR18272731 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272731_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.00675 37.0 36.0 37.0 35.0 38.0 2 35.5565 37.0 36.0 37.0 34.0 38.0 3 36.11675 37.0 36.0 37.0 35.0 38.0 4 36.03775 37.0 36.0 37.0 35.0 38.0 5 35.96075 37.0 36.0 37.0 34.0 38.0 6 36.05925 37.0 36.0 37.0 35.0 38.0 7 35.8415 37.0 36.0 37.0 34.0 38.0 8 35.90425 37.0 36.0 37.0 34.0 38.0 9 36.2205 37.0 36.0 37.0 35.0 38.0 10-14 35.94415 37.0 36.0 37.0 34.2 38.0 15-19 35.94055 37.0 36.0 37.0 34.2 38.0 20-24 36.0125 37.0 36.0 37.0 34.2 38.0 25-29 35.8719 37.0 36.0 37.0 34.0 38.0 30-34 35.8834 37.0 36.0 37.0 34.0 38.0 35-39 35.7932 37.0 36.0 37.0 34.0 38.0 40-44 35.724700000000006 37.0 36.0 37.0 34.0 38.0 45-49 35.7998 37.0 36.0 37.0 33.8 38.0 50-54 35.672650000000004 37.0 36.0 37.0 33.6 38.0 55-59 35.613249999999994 37.0 36.0 37.0 33.0 38.0 60-64 35.4829 37.0 36.0 37.0 32.8 38.0 65-69 35.450900000000004 37.0 36.0 37.0 32.8 38.0 70-74 35.3891 37.0 36.0 37.0 32.2 38.0 75-79 35.28245 37.0 36.0 37.0 32.4 38.0 80-84 35.188100000000006 37.0 35.8 37.0 31.6 38.0 85-89 34.96235 37.0 35.2 37.0 31.2 38.0 90-94 34.90605 37.0 35.0 37.0 30.6 38.0 95-99 34.839800000000004 37.0 35.0 37.0 30.4 38.0 100-104 34.6854 37.0 35.0 37.0 29.8 38.0 105-109 34.513549999999995 37.0 35.0 37.0 28.6 38.0 110-114 34.37214999999999 37.0 35.0 37.0 28.0 38.0 115-119 34.19255 37.0 35.0 37.0 27.4 38.0 120-124 34.01575 36.6 35.0 37.0 26.4 38.0 125-129 33.63875 36.0 34.4 37.0 24.6 38.0 130-134 33.585699999999996 36.0 34.2 37.0 24.6 38.0 135-139 33.1546 36.0 34.0 37.0 22.4 37.4 140-144 32.89834999999999 36.0 33.2 37.0 21.4 37.6 145-149 32.83415 36.0 33.2 37.0 21.2 37.2 150 32.50325 36.0 32.0 37.0 20.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 32.0 28 76.0 29 91.0 30 109.0 31 177.0 32 232.0 33 307.0 34 475.0 35 748.0 36 1212.0 37 539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.924999999999997 17.849999999999998 12.375 37.85 2 19.325 25.4 40.925 14.35 3 16.6 28.999999999999996 28.349999999999998 26.05 4 19.950000000000003 36.325 25.25 18.475 5 19.75 37.875 25.324999999999996 17.05 6 15.0 35.775 28.95 20.275000000000002 7 15.25 15.425 46.025 23.3 8 19.0 20.95 30.225 29.825000000000003 9 20.225 22.650000000000002 29.299999999999997 27.825 10-14 20.705000000000002 29.28 26.63 23.385 15-19 21.060000000000002 28.92 27.055 22.965 20-24 21.305 28.04 28.205000000000002 22.45 25-29 21.385 28.294999999999998 28.03 22.29 30-34 21.375 28.475 27.63 22.52 35-39 21.855 28.54 27.515 22.09 40-44 21.66 28.494999999999997 27.595 22.25 45-49 21.745 27.700000000000003 27.655 22.900000000000002 50-54 21.435000000000002 28.075 27.889999999999997 22.6 55-59 21.755 28.305000000000003 27.589999999999996 22.35 60-64 21.86 28.18 27.48 22.48 65-69 21.325 27.985 27.82 22.869999999999997 70-74 21.55 27.905 27.474999999999998 23.07 75-79 22.205 27.91 27.66 22.225 80-84 21.815 28.12 27.455000000000002 22.61 85-89 22.30611530576529 28.001400070003502 27.011350567528375 22.681134056702835 90-94 21.759999999999998 28.349999999999998 27.229999999999997 22.66 95-99 21.996099804990248 27.86639331966598 27.816390819540977 22.32111605580279 100-104 21.775 27.58 27.755000000000003 22.89 105-109 22.125 27.389999999999997 27.79 22.695 110-114 22.14 27.57 27.485 22.805 115-119 22.33 27.994999999999997 27.555000000000003 22.12 120-124 22.21 26.86 27.74 23.189999999999998 125-129 22.515 27.51 27.62 22.355 130-134 22.7 27.705000000000002 27.435 22.16 135-139 22.31 27.555000000000003 27.395000000000003 22.74 140-144 22.97114855742787 27.27636381819091 26.97134856742837 22.78113905695285 145-149 23.447344734473447 27.402740274027405 26.832683268326836 22.317231723172316 150 24.125 26.025 26.8 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 2.5 25 4.0 26 7.0 27 7.5 28 10.5 29 13.5 30 16.0 31 24.0 32 39.5 33 50.5 34 57.5 35 70.5 36 81.0 37 103.0 38 137.5 39 160.5 40 193.0 41 221.0 42 238.5 43 256.0 44 258.0 45 260.5 46 255.5 47 244.0 48 229.0 49 208.5 50 183.5 51 148.5 52 108.5 53 91.0 54 72.5 55 54.0 56 49.5 57 38.5 58 27.5 59 18.0 60 10.5 61 6.0 62 8.5 63 8.0 64 4.0 65 4.5 66 5.0 67 3.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06320081549438 96.2 2 1.9367991845056065 3.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra Read 1505429 spots for SRR18272731.sra Written 1505429 spots for SRR18272731.sra Read 1505424 spots for SRR18272731.sra Written 1505424 spots for SRR18272731.sra SRR ids: ['SRR18272731.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_25s3gn8b SRR18272731.sra spots: 30108485 blocks: [[1, 1505424], [1505425, 3010848], [3010849, 4516272], [4516273, 6021696], [6021697, 7527120], [7527121, 9032544], [9032545, 10537968], [10537969, 12043392], [12043393, 13548816], [13548817, 15054240], [15054241, 16559664], [16559665, 18065088], [18065089, 19570512], [19570513, 21075936], [21075937, 22581360], [22581361, 24086784], [24086785, 25592208], [25592209, 27097632], [27097633, 28603056], [28603057, 30108485]] SRR18272731 file size 10721178 SRR18272731 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18272731 SRR18272731_1.fastq SRR18272731_2.fastq Input file: SRR18272731_1.fastq Paired file: SRR18272731_2.fastq trimmed: SRR18272731-trimmed-pair1.fastq, SRR18272731-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:13:41 2025 >> started Tue Feb 11 01:14:16 2025 >> done (35.243s) 30108485 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 30108485 (100.00%) read pairs available; of these: 1613063 ( 5.36%) trimmed read pairs available after processing 28495422 (94.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 139 1 0.00% 140 0 0.00% 141 1 0.00% 142 31 0.00% 143 25 0.00% 144 31 0.00% 145 18 0.00% 146 32 0.00% 147 288 0.00% 148 14409 0.05% 149 1598227 5.31% 150 28495422 94.64% 30108485 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=64.21 fanout-score-rank=9 prefix-density=0.72 prefix-fanout=30.5 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=444.25 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=28.3 sequence=CTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=62.29 fanout-score-rank=8 prefix-density=0.74 prefix-fanout=29.9 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=392.28 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=34.5 sequence=TTCTTCTTCTTT SRR18272731 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:15:00 Started mapping on | Feb 11 01:15:00 Finished on | Feb 11 01:17:45 Mapping speed, Million of reads per hour | 656.91 Number of input reads | 30108485 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 28717666 Uniquely mapped reads % | 95.38% Average mapped length | 298.27 Number of splices: Total | 27655680 Number of splices: Annotated (sjdb) | 27190577 Number of splices: GT/AG | 27199629 Number of splices: GC/AG | 365919 Number of splices: AT/AC | 27364 Number of splices: Non-canonical | 62768 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700542 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 1161 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 690277 690277 690277 N_multimapping 700542 700542 700542 N_noFeature 611784 14300466 14843500 N_ambiguous 337824 79558 73790 UnstrandedReadsAssigned:27768058 PositiveStrandReadsAssigned:14337642 NegativeStrandReadsAssigned:13800376 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18272731 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18272731-trimmed-pair1.fastq SRR18272731-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,108,485 reads, 28,538,518 reads pseudoaligned [quant] estimated average fragment length: 253.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR18272731.ke.tsv 34699 SRR18272731.se.tsv 87100 total ==> SRR18272731.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.26 1687 29.534 Potri.005G024800.1.v4.1 1035 782.259 402 15.8815 Potri.004G059700.1.v4.1 961 708.267 354 15.4462 Potri.007G009000.2.v4.1 1416 1163.26 0 0 Potri.003G141000.2.v4.1 2943 2690.26 1430.14 16.4286 Potri.016G087400.1.v4.1 270 66.5206 2069 961.212 Potri.015G069301.1.v4.1 564 312.807 0 0 Potri.010G195200.1.v4.1 1773 1520.26 162 3.29316 Potri.012G127500.1.v4.1 977 724.267 29464 1257.21 ==> SRR18272731.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1100 Potri.001G233950.v4.1 15 Potri.001G122700.v4.1 868 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 85 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 36 SRR18272731 completed mapping pipeline successfully