Starting /dee2/code/volunteer_pipeline.sh SRR18272732 current disk space = 3056982609920 free memory = 1576988080 SRR18272732 SRAfilesize a20845b0f636643af6b3e76c72ad368f SRR18272732.sra SRR18272732.sra file validated SRR18272732 is paired end SRR18272732 is conventional basespace SRR18272732 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272732_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31875 37.0 36.0 37.0 35.0 38.0 2 35.56325 37.0 36.0 37.0 34.0 38.0 3 36.32025 37.0 36.0 37.0 35.0 38.0 4 36.275 37.0 36.0 37.0 35.0 38.0 5 36.081 37.0 36.0 37.0 35.0 38.0 6 36.175 37.0 36.0 37.0 35.0 38.0 7 36.3365 37.0 36.0 37.0 35.0 38.0 8 36.37825 37.0 36.0 37.0 35.0 38.0 9 36.31075 37.0 36.0 37.0 35.0 38.0 10-14 36.2034 37.0 36.0 37.0 35.0 38.0 15-19 36.232800000000005 37.0 36.0 37.0 35.0 38.0 20-24 36.21464999999999 37.0 36.0 37.0 35.0 38.0 25-29 36.20195 37.0 36.0 37.0 35.0 38.0 30-34 36.1865 37.0 36.0 37.0 35.0 38.0 35-39 36.16045 37.0 36.0 37.0 35.0 38.0 40-44 36.20615 37.0 36.0 37.0 35.0 38.0 45-49 36.0927 37.0 36.0 37.0 35.0 38.0 50-54 36.06195 37.0 36.0 37.0 34.8 38.0 55-59 36.0826 37.0 36.0 37.0 34.8 38.0 60-64 36.0281 37.0 36.0 37.0 35.0 38.0 65-69 36.042449999999995 37.0 36.0 37.0 35.0 38.0 70-74 35.912850000000006 37.0 36.0 37.0 34.2 38.0 75-79 35.8745 37.0 36.0 37.0 34.0 38.0 80-84 35.8764 37.0 36.0 37.0 34.2 38.0 85-89 35.73145 37.0 36.0 37.0 34.0 38.0 90-94 35.6625 37.0 36.0 37.0 33.6 38.0 95-99 35.695499999999996 37.0 36.0 37.0 34.0 38.0 100-104 35.52505 37.0 36.0 37.0 33.0 38.0 105-109 35.50425 37.0 36.0 37.0 33.0 38.0 110-114 35.46795 37.0 36.0 37.0 32.8 38.0 115-119 35.31179999999999 37.0 36.0 37.0 32.2 38.0 120-124 35.21625 37.0 36.0 37.0 31.8 38.0 125-129 35.09705 37.0 36.0 37.0 31.0 38.0 130-134 34.918150000000004 37.0 35.8 37.0 30.2 38.0 135-139 34.794200000000004 37.0 35.2 37.0 30.0 38.0 140-144 34.63015 37.0 35.0 37.0 29.0 38.0 145-149 34.49565 37.0 35.0 37.0 28.4 38.0 150 34.185 37.0 35.0 37.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 5.0 28 25.0 29 32.0 30 66.0 31 70.0 32 125.0 33 231.0 34 358.0 35 703.0 36 1639.0 37 746.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.949999999999996 15.5 12.7 36.85 2 17.150000000000002 24.45 43.55 14.85 3 16.85 27.575 31.025000000000002 24.55 4 20.474999999999998 36.55 24.474999999999998 18.5 5 22.875 34.675 25.025 17.424999999999997 6 16.150000000000002 35.05 28.275 20.525 7 15.975 14.825 45.675 23.525 8 19.575 21.9 28.875 29.65 9 19.675 22.6 28.749999999999996 28.975 10-14 21.099999999999998 29.24 26.865 22.795 15-19 21.235 28.395 27.765 22.605 20-24 21.584999999999997 28.76 27.355 22.3 25-29 21.755 28.84 27.85 21.555 30-34 22.155 28.134999999999998 27.705000000000002 22.005 35-39 21.709999999999997 28.965000000000003 27.47 21.855 40-44 21.865000000000002 28.499999999999996 27.295 22.34 45-49 21.82 28.65 27.375 22.155 50-54 22.09 28.375 27.485 22.05 55-59 22.59 28.415000000000003 26.889999999999997 22.105 60-64 22.365 28.27 27.029999999999998 22.335 65-69 22.495 27.96 27.72 21.825 70-74 22.009999999999998 28.375 27.6 22.015 75-79 21.89 28.16 27.750000000000004 22.2 80-84 21.959999999999997 28.575 27.195000000000004 22.27 85-89 22.555 28.360000000000003 27.445000000000004 21.64 90-94 22.28 28.375 27.67 21.675 95-99 22.32 27.865000000000002 27.405 22.41 100-104 22.35 28.83 27.534999999999997 21.285 105-109 22.5 27.215 28.105000000000004 22.18 110-114 22.3 27.05 28.52 22.13 115-119 22.67 27.845 27.72 21.765 120-124 22.125 28.194999999999997 27.765 21.915000000000003 125-129 22.564999999999998 27.82 27.785 21.83 130-134 22.675 27.965 28.015 21.345 135-139 22.285 27.1 28.23 22.384999999999998 140-144 22.689999999999998 27.810000000000002 27.735 21.765 145-149 23.055 27.125 28.050000000000004 21.77 150 23.200000000000003 26.5 28.025 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 2.0 24 4.5 25 5.5 26 5.5 27 10.5 28 13.5 29 17.5 30 24.0 31 24.5 32 31.5 33 47.5 34 58.5 35 69.5 36 90.0 37 100.0 38 123.5 39 155.0 40 181.0 41 219.0 42 240.5 43 252.0 44 267.0 45 264.0 46 246.5 47 240.5 48 234.5 49 210.5 50 184.5 51 155.0 52 121.0 53 100.0 54 82.5 55 55.0 56 31.5 57 25.5 58 23.0 59 21.5 60 16.0 61 9.5 62 8.5 63 6.0 64 5.5 65 5.5 66 3.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04088844018173 98.1 2 0.9591115598182737 1.9 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.0 0.025 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGACA 10 0.006973645 144.0 7 TTAAGAC 10 0.006973645 144.0 6 CTTTGTT 10 0.006973645 144.0 1 TTTTTTT 40 0.007966741 18.0 105-109 >>END_MODULE SRR18272732 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272732_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.90375 37.0 36.0 37.0 34.0 38.0 2 35.463 37.0 36.0 37.0 33.0 38.0 3 36.008 37.0 36.0 37.0 35.0 38.0 4 36.121 37.0 36.0 37.0 35.0 38.0 5 36.0315 37.0 36.0 37.0 34.0 38.0 6 35.98425 37.0 36.0 37.0 34.0 38.0 7 35.90575 37.0 36.0 37.0 34.0 38.0 8 35.982 37.0 36.0 37.0 34.0 38.0 9 35.96225 37.0 36.0 37.0 34.0 38.0 10-14 35.891999999999996 37.0 36.0 37.0 34.4 38.0 15-19 35.9092 37.0 36.0 37.0 34.2 38.0 20-24 35.899350000000005 37.0 36.0 37.0 34.2 38.0 25-29 35.845549999999996 37.0 36.0 37.0 34.0 38.0 30-34 35.808949999999996 37.0 36.0 37.0 34.0 38.0 35-39 35.71894999999999 37.0 36.0 37.0 33.8 38.0 40-44 35.7113 37.0 36.0 37.0 33.8 38.0 45-49 35.6519 37.0 36.0 37.0 33.6 38.0 50-54 35.578199999999995 37.0 36.0 37.0 33.4 38.0 55-59 35.4784 37.0 36.0 37.0 33.0 38.0 60-64 35.404849999999996 37.0 36.0 37.0 32.6 38.0 65-69 35.3309 37.0 36.0 37.0 32.2 38.0 70-74 35.13365 37.0 35.6 37.0 31.8 38.0 75-79 34.927350000000004 37.0 35.0 37.0 30.8 38.0 80-84 35.075450000000004 37.0 35.0 37.0 31.4 38.0 85-89 34.802350000000004 37.0 35.0 37.0 30.2 38.0 90-94 34.74235 37.0 35.0 37.0 30.0 38.0 95-99 34.39785 37.0 35.0 37.0 28.2 38.0 100-104 34.34310000000001 37.0 35.0 37.0 28.0 38.0 105-109 34.18515 37.0 35.0 37.0 27.2 37.8 110-114 33.98795 36.4 35.0 37.0 26.6 37.8 115-119 33.735 36.0 34.4 37.0 24.8 37.8 120-124 33.44605 36.0 34.0 37.0 24.0 37.4 125-129 33.35445 36.0 34.0 37.0 23.4 37.0 130-134 33.133250000000004 36.0 33.8 37.0 22.6 37.2 135-139 32.72345 36.0 32.6 37.0 20.6 37.2 140-144 32.5775 36.0 32.8 37.0 20.4 37.0 145-149 32.1713 36.0 31.6 37.0 18.6 37.0 150 32.035 36.0 31.0 37.0 17.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 18.0 28 68.0 29 118.0 30 150.0 31 192.0 32 267.0 33 374.0 34 527.0 35 804.0 36 1058.0 37 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 16.375 13.950000000000001 37.574999999999996 2 17.474999999999998 25.75 41.975 14.799999999999999 3 16.375 29.075 29.125 25.424999999999997 4 19.675 38.550000000000004 23.599999999999998 18.175 5 20.125 36.125 26.05 17.7 6 15.725 36.575 26.75 20.95 7 15.075 15.575 45.025 24.325 8 19.575 21.3 27.975 31.15 9 20.275000000000002 23.0 28.4 28.325 10-14 20.465 29.805 26.71 23.02 15-19 21.13 27.83 28.26 22.78 20-24 20.64 29.244999999999997 27.395000000000003 22.720000000000002 25-29 21.165 28.87 27.63 22.335 30-34 21.015 28.78 27.575 22.63 35-39 21.099999999999998 28.455000000000002 28.115000000000002 22.33 40-44 21.525 28.634999999999998 27.339999999999996 22.5 45-49 21.455 28.715000000000003 27.395000000000003 22.435 50-54 21.595 28.485 27.87 22.05 55-59 22.245 28.035 27.529999999999998 22.189999999999998 60-64 21.560000000000002 28.694999999999997 27.11 22.634999999999998 65-69 21.295 28.775000000000002 27.68 22.25 70-74 21.83 27.965 27.694999999999997 22.509999999999998 75-79 22.1 28.485 26.575 22.84 80-84 21.46 27.644999999999996 27.889999999999997 23.005 85-89 22.009999999999998 27.97 27.515 22.505 90-94 22.105 27.71 27.85 22.335 95-99 21.52 28.18 27.889999999999997 22.41 100-104 22.08110405520276 28.47642382119106 27.26136306815341 22.181109055452772 105-109 21.365000000000002 27.855 27.779999999999998 23.0 110-114 22.395 27.79 27.435 22.38 115-119 22.561128056402822 27.091354567728388 27.466373318665934 22.88114405720286 120-124 22.355 27.500000000000004 27.150000000000002 22.994999999999997 125-129 22.121106055302764 27.076353817690883 28.066403320166007 22.736136806840342 130-134 22.066103305165257 27.251362568128407 27.65638281914096 23.026151307565378 135-139 22.43 27.26 27.37 22.939999999999998 140-144 22.564999999999998 27.145000000000003 27.46 22.830000000000002 145-149 23.055 27.339999999999996 26.775 22.830000000000002 150 23.150000000000002 27.525 26.525 22.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 0.5 24 1.5 25 3.0 26 6.0 27 9.0 28 11.5 29 15.5 30 18.5 31 26.0 32 41.5 33 50.5 34 56.0 35 70.0 36 93.0 37 114.5 38 137.0 39 164.0 40 190.0 41 220.0 42 235.0 43 249.5 44 260.0 45 263.0 46 273.0 47 259.5 48 217.5 49 202.5 50 186.0 51 142.0 52 113.0 53 85.5 54 57.5 55 47.5 56 43.0 57 28.0 58 23.0 59 22.0 60 12.5 61 8.5 62 13.0 63 10.0 64 3.5 65 2.0 66 2.5 67 2.5 68 1.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91304347826086 97.82499999999999 2 1.0616784630940344 2.1 3 0.02527805864509606 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCCTC 10 0.0069863307 143.91249 7 GTCCTCC 10 0.0069863307 143.91249 8 >>END_MODULE Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029957 spots for SRR18272732.sra Written 1029957 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra Read 1029943 spots for SRR18272732.sra Written 1029943 spots for SRR18272732.sra SRR ids: ['SRR18272732.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7hryk2n5 SRR18272732.sra spots: 20598874 blocks: [[1, 1029943], [1029944, 2059886], [2059887, 3089829], [3089830, 4119772], [4119773, 5149715], [5149716, 6179658], [6179659, 7209601], [7209602, 8239544], [8239545, 9269487], [9269488, 10299430], [10299431, 11329373], [11329374, 12359316], [12359317, 13389259], [13389260, 14419202], [14419203, 15449145], [15449146, 16479088], [16479089, 17509031], [17509032, 18538974], [18538975, 19568917], [19568918, 20598874]] SRR18272732 file size 7331522 SRR18272732 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18272732 SRR18272732_1.fastq SRR18272732_2.fastq Input file: SRR18272732_1.fastq Paired file: SRR18272732_2.fastq trimmed: SRR18272732-trimmed-pair1.fastq, SRR18272732-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:32:14 2025 >> started Tue Feb 11 04:37:59 2025 >> done (345.018s) 20598874 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 20598874 (100.00%) read pairs available; of these: 1114708 ( 5.41%) trimmed read pairs available after processing 19484166 (94.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 1 0.00% 142 22 0.00% 143 17 0.00% 144 14 0.00% 145 12 0.00% 146 23 0.00% 147 225 0.00% 148 10016 0.05% 149 1104378 5.36% 150 19484166 94.59% 20598874 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=60.13 fanout-score-rank=6 prefix-density=0.57 prefix-fanout=28.5 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=8 fanout-score=341.81 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=28.7 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=62.75 fanout-score-rank=9 prefix-density=0.60 prefix-fanout=29.8 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=339.04 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=32.2 sequence=TTCTTCTTCTTT SRR18272732 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 05:12:01 Started mapping on | Feb 11 05:12:36 Finished on | Feb 11 06:18:23 Mapping speed, Million of reads per hour | 18.79 Number of input reads | 20598874 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19666439 Uniquely mapped reads % | 95.47% Average mapped length | 298.28 Number of splices: Total | 19429288 Number of splices: Annotated (sjdb) | 19138699 Number of splices: GT/AG | 19114597 Number of splices: GC/AG | 255054 Number of splices: AT/AC | 18890 Number of splices: Non-canonical | 40747 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480243 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 1076 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 452192 452192 452192 N_multimapping 480243 480243 480243 N_noFeature 392935 9722237 10217739 N_ambiguous 224295 55619 49979 UnstrandedReadsAssigned:19049209 PositiveStrandReadsAssigned:9888583 NegativeStrandReadsAssigned:9398721 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18272732 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18272732-trimmed-pair1.fastq SRR18272732-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,598,874 reads, 19,535,546 reads pseudoaligned [quant] estimated average fragment length: 252.115 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR18272732.ke.tsv 34699 SRR18272732.se.tsv 87100 total ==> SRR18272732.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.89 1056 24.4379 Potri.005G024800.1.v4.1 1035 783.885 176 9.18053 Potri.004G059700.1.v4.1 961 709.885 241 13.8815 Potri.007G009000.2.v4.1 1416 1164.89 0 0 Potri.003G141000.2.v4.1 2943 2691.89 1116.16 16.9541 Potri.016G087400.1.v4.1 270 65.0005 1350.43 849.497 Potri.015G069301.1.v4.1 564 314.104 0 0 Potri.010G195200.1.v4.1 1773 1521.89 43 1.1553 Potri.012G127500.1.v4.1 977 725.885 17848 1005.38 ==> SRR18272732.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1308 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 602 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 84 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR18272732 completed mapping pipeline successfully