Starting /dee2/code/volunteer_pipeline.sh SRR18272733 current disk space = 3056990756864 free memory = 1578456448 SRR18272733 SRAfilesize f5ce1a95d19143cf6c6f48b7b56e1e96 SRR18272733.sra SRR18272733.sra file validated SRR18272733 is paired end SRR18272733 is conventional basespace SRR18272733 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272733_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.259 37.0 36.0 37.0 35.0 38.0 2 35.7615 37.0 36.0 37.0 34.0 38.0 3 36.29225 37.0 36.0 37.0 35.0 38.0 4 36.2945 37.0 36.0 37.0 35.0 38.0 5 36.27075 37.0 36.0 37.0 35.0 38.0 6 36.205 37.0 36.0 37.0 35.0 38.0 7 36.26925 37.0 36.0 37.0 35.0 38.0 8 36.2795 37.0 36.0 37.0 35.0 38.0 9 36.3215 37.0 36.0 37.0 35.0 38.0 10-14 36.238299999999995 37.0 36.0 37.0 35.0 38.0 15-19 36.246950000000005 37.0 36.0 37.0 35.0 38.0 20-24 36.251999999999995 37.0 36.0 37.0 35.0 38.0 25-29 36.241200000000006 37.0 36.0 37.0 35.0 38.0 30-34 36.2263 37.0 36.0 37.0 35.0 38.0 35-39 36.21295 37.0 36.0 37.0 35.0 38.0 40-44 36.17415 37.0 36.0 37.0 35.0 38.0 45-49 36.151799999999994 37.0 36.0 37.0 35.0 38.0 50-54 36.1234 37.0 36.0 37.0 35.0 38.0 55-59 36.0871 37.0 36.0 37.0 34.8 38.0 60-64 36.101000000000006 37.0 36.0 37.0 35.0 38.0 65-69 36.09720000000001 37.0 36.0 37.0 35.0 38.0 70-74 35.9572 37.0 36.0 37.0 34.6 38.0 75-79 35.9545 37.0 36.0 37.0 34.2 38.0 80-84 35.9499 37.0 36.0 37.0 34.4 38.0 85-89 35.86305 37.0 36.0 37.0 34.0 38.0 90-94 35.836400000000005 37.0 36.0 37.0 34.0 38.0 95-99 35.80365 37.0 36.0 37.0 34.0 38.0 100-104 35.64 37.0 36.0 37.0 33.8 38.0 105-109 35.642500000000005 37.0 36.0 37.0 33.6 38.0 110-114 35.62635 37.0 36.0 37.0 33.4 38.0 115-119 35.500299999999996 37.0 36.0 37.0 32.6 38.0 120-124 35.42655 37.0 36.0 37.0 32.8 38.0 125-129 35.289500000000004 37.0 36.0 37.0 31.8 38.0 130-134 35.122749999999996 37.0 36.0 37.0 31.4 38.0 135-139 35.0908 37.0 36.0 37.0 31.2 38.0 140-144 34.9324 37.0 35.4 37.0 30.6 38.0 145-149 34.7976 37.0 35.0 37.0 29.8 38.0 150 34.67825 37.0 35.0 37.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 13.0 28 25.0 29 46.0 30 61.0 31 63.0 32 109.0 33 159.0 34 306.0 35 699.0 36 1665.0 37 853.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.7 17.175 12.025 38.1 2 17.95 24.125 44.45 13.475000000000001 3 16.2 28.15 30.775000000000002 24.875 4 19.05 36.7 25.874999999999996 18.375 5 19.125 36.55 26.650000000000002 17.675 6 14.75 36.075 29.825000000000003 19.35 7 14.299999999999999 14.649999999999999 46.225 24.825 8 18.9 21.875 28.95 30.275000000000002 9 19.75 23.0 29.075 28.175 10-14 21.45 28.765 26.93 22.855 15-19 20.96 27.805000000000003 28.37 22.865 20-24 20.845 28.685 27.939999999999998 22.53 25-29 21.62 29.044999999999998 27.224999999999998 22.11 30-34 21.085 28.84 28.07 22.005 35-39 21.985 28.455000000000002 27.77 21.790000000000003 40-44 21.805 28.33 27.18 22.685 45-49 22.11 28.660000000000004 27.134999999999998 22.095000000000002 50-54 21.59 28.825 27.26 22.325 55-59 21.59 29.26 26.695 22.455 60-64 22.25 28.605000000000004 27.18 21.965 65-69 21.955 28.27 27.755000000000003 22.02 70-74 22.29 28.625 26.995 22.09 75-79 22.09 28.199999999999996 27.834999999999997 21.875 80-84 21.59 27.975 27.96 22.475 85-89 22.61 28.675 26.46 22.255 90-94 22.25 28.299999999999997 27.18 22.27 95-99 22.384999999999998 27.62 27.91 22.085 100-104 22.195 27.98 27.63 22.195 105-109 22.095000000000002 28.155 27.439999999999998 22.31 110-114 22.525000000000002 27.765 27.700000000000003 22.009999999999998 115-119 21.78 28.505000000000003 27.975 21.740000000000002 120-124 22.31 27.775 27.975 21.94 125-129 21.895 27.810000000000002 27.855 22.439999999999998 130-134 22.884999999999998 27.834999999999997 27.305 21.975 135-139 22.41 27.91 27.715 21.965 140-144 23.05 28.1 27.175 21.675 145-149 22.939999999999998 27.735 26.884999999999998 22.439999999999998 150 21.275 28.125 27.750000000000004 22.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 1.0 25 3.0 26 5.5 27 8.0 28 10.0 29 17.5 30 30.0 31 33.5 32 34.5 33 38.5 34 54.0 35 71.5 36 89.5 37 113.0 38 133.5 39 161.0 40 202.0 41 236.5 42 244.0 43 247.0 44 256.0 45 260.0 46 256.5 47 244.5 48 217.0 49 203.5 50 184.0 51 145.0 52 112.5 53 83.5 54 68.0 55 57.0 56 42.0 57 31.0 58 23.5 59 20.5 60 18.0 61 9.0 62 5.0 63 8.0 64 8.0 65 2.5 66 2.5 67 3.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93858984078847 97.875 2 1.0361384887541065 2.0500000000000003 3 0.025271670457417232 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTGGG 10 0.006973645 144.0 6 AGCCCTG 10 0.006973645 144.0 4 GCCCTGG 10 0.006973645 144.0 5 >>END_MODULE SRR18272733 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272733_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.004 37.0 36.0 37.0 35.0 38.0 2 35.4405 37.0 36.0 37.0 33.0 38.0 3 36.08025 37.0 36.0 37.0 35.0 38.0 4 36.06275 37.0 36.0 37.0 35.0 38.0 5 35.9285 37.0 36.0 37.0 34.0 38.0 6 35.9455 37.0 36.0 37.0 34.0 38.0 7 35.91975 37.0 36.0 37.0 34.0 38.0 8 36.0445 37.0 36.0 37.0 35.0 38.0 9 36.07125 37.0 36.0 37.0 35.0 38.0 10-14 35.92685 37.0 36.0 37.0 34.2 38.0 15-19 35.9351 37.0 36.0 37.0 34.4 38.0 20-24 35.9289 37.0 36.0 37.0 34.2 38.0 25-29 35.89375 37.0 36.0 37.0 34.2 38.0 30-34 35.8608 37.0 36.0 37.0 34.0 38.0 35-39 35.83669999999999 37.0 36.0 37.0 34.0 38.0 40-44 35.7457 37.0 36.0 37.0 33.8 38.0 45-49 35.7116 37.0 36.0 37.0 33.8 38.0 50-54 35.61805 37.0 36.0 37.0 33.4 38.0 55-59 35.563900000000004 37.0 36.0 37.0 33.4 38.0 60-64 35.50465 37.0 36.0 37.0 33.0 38.0 65-69 35.428399999999996 37.0 36.0 37.0 32.6 38.0 70-74 35.337300000000006 37.0 36.0 37.0 32.4 38.0 75-79 35.1674 37.0 35.4 37.0 31.8 38.0 80-84 35.184799999999996 37.0 35.8 37.0 31.6 38.0 85-89 34.95915 37.0 35.2 37.0 30.8 38.0 90-94 35.04055 37.0 35.0 37.0 31.2 38.0 95-99 34.7734 37.0 35.0 37.0 30.4 38.0 100-104 34.68515 37.0 35.0 37.0 29.6 38.0 105-109 34.5693 37.0 35.0 37.0 29.2 38.0 110-114 34.36985 37.0 35.0 37.0 28.0 37.8 115-119 34.2738 36.8 35.0 37.0 28.0 37.6 120-124 34.0152 36.6 35.0 37.0 26.4 37.2 125-129 33.8456 36.0 34.2 37.0 25.8 37.2 130-134 33.626650000000005 36.0 34.2 37.0 24.6 37.4 135-139 33.1606 36.0 34.0 37.0 22.6 37.0 140-144 33.1676 36.0 34.0 37.0 22.6 37.0 145-149 33.032000000000004 36.0 33.6 37.0 22.0 37.0 150 32.79575 36.0 33.0 37.0 21.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 21.0 28 73.0 29 88.0 30 128.0 31 162.0 32 212.0 33 329.0 34 469.0 35 780.0 36 1209.0 37 525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.45 17.075000000000003 12.675 37.8 2 18.175 23.849999999999998 43.875 14.099999999999998 3 15.975 27.700000000000003 31.724999999999998 24.6 4 20.0 36.9 24.375 18.725 5 19.6 36.525 25.650000000000002 18.224999999999998 6 15.2 35.099999999999994 28.549999999999997 21.15 7 14.825 14.399999999999999 46.375 24.4 8 18.95 20.625 29.349999999999998 31.075000000000003 9 19.075 21.7 31.05 28.175 10-14 20.445 29.34 26.645000000000003 23.57 15-19 20.77 28.549999999999997 27.589999999999996 23.09 20-24 20.73 28.74 27.51 23.02 25-29 21.349999999999998 29.03 27.534999999999997 22.085 30-34 21.275 28.499999999999996 27.46 22.765 35-39 21.275 28.835 27.51 22.38 40-44 21.88 28.705000000000002 27.224999999999998 22.189999999999998 45-49 22.355 27.939999999999998 27.63 22.075 50-54 21.765 27.884999999999998 27.425 22.925 55-59 22.185 28.68 27.26 21.875 60-64 21.88 28.875 27.71 21.535 65-69 21.995 28.005000000000003 27.145000000000003 22.855 70-74 22.07 27.85 27.485 22.595000000000002 75-79 22.215 27.615000000000002 27.485 22.685 80-84 21.375 27.915 27.815 22.895 85-89 21.61 28.075 27.3 23.015 90-94 21.705 27.58 27.755000000000003 22.96 95-99 21.69 27.315 27.994999999999997 23.0 100-104 21.865000000000002 28.165000000000003 27.465 22.505 105-109 21.725 27.694999999999997 27.955000000000002 22.625 110-114 22.145 27.405 28.12 22.33 115-119 22.245 27.555000000000003 27.384999999999998 22.814999999999998 120-124 21.795 27.775 27.55 22.88 125-129 22.435 27.26 27.72 22.585 130-134 22.686134306715335 27.546377318865943 27.76638831941597 22.001100055002752 135-139 23.06 27.265 27.735 21.94 140-144 23.605 27.115000000000002 27.33 21.95 145-149 23.16 26.855 27.355 22.63 150 23.280820205051263 27.631907976994246 26.18154538634659 22.9057264316079 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 2.0 25 4.5 26 8.0 27 10.0 28 12.5 29 17.0 30 23.0 31 24.0 32 31.0 33 49.0 34 61.0 35 76.5 36 96.0 37 111.0 38 130.5 39 159.0 40 177.5 41 194.5 42 227.0 43 248.5 44 258.0 45 256.5 46 246.0 47 243.0 48 227.5 49 206.0 50 193.5 51 156.0 52 120.5 53 102.0 54 83.5 55 61.0 56 37.5 57 28.5 58 25.5 59 19.5 60 14.0 61 13.5 62 13.0 63 8.5 64 4.0 65 3.5 66 2.0 67 2.5 68 2.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68287740628166 97.39999999999999 2 1.3171225937183384 2.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090496 spots for SRR18272733.sra Written 1090496 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra Read 1090488 spots for SRR18272733.sra Written 1090488 spots for SRR18272733.sra SRR ids: ['SRR18272733.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3r2agaf8 SRR18272733.sra spots: 21809768 blocks: [[1, 1090488], [1090489, 2180976], [2180977, 3271464], [3271465, 4361952], [4361953, 5452440], [5452441, 6542928], [6542929, 7633416], [7633417, 8723904], [8723905, 9814392], [9814393, 10904880], [10904881, 11995368], [11995369, 13085856], [13085857, 14176344], [14176345, 15266832], [15266833, 16357320], [16357321, 17447808], [17447809, 18538296], [18538297, 19628784], [19628785, 20719272], [20719273, 21809768]] SRR18272733 file size 7763139 SRR18272733 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18272733 SRR18272733_1.fastq SRR18272733_2.fastq Input file: SRR18272733_1.fastq Paired file: SRR18272733_2.fastq trimmed: SRR18272733-trimmed-pair1.fastq, SRR18272733-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:57:57 2025 >> started Tue Feb 11 05:07:54 2025 >> done (597.057s) 21809768 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21809768 (100.00%) read pairs available; of these: 1182508 ( 5.42%) trimmed read pairs available after processing 20627260 (94.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 140 1 0.00% 141 3 0.00% 142 21 0.00% 143 14 0.00% 144 13 0.00% 145 10 0.00% 146 22 0.00% 147 211 0.00% 148 10320 0.05% 149 1171893 5.37% 150 20627260 94.58% 21809768 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=63.65 fanout-score-rank=6 prefix-density=0.62 prefix-fanout=29.2 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=387.09 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=29.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=63.12 fanout-score-rank=10 prefix-density=0.64 prefix-fanout=29.8 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=385.79 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=29.5 sequence=TCTTCTTCTTCCT SRR18272733 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 06:24:35 Started mapping on | Feb 11 06:24:52 Finished on | Feb 11 07:33:16 Mapping speed, Million of reads per hour | 19.13 Number of input reads | 21809768 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20844938 Uniquely mapped reads % | 95.58% Average mapped length | 298.28 Number of splices: Total | 20413001 Number of splices: Annotated (sjdb) | 20112540 Number of splices: GT/AG | 20079171 Number of splices: GC/AG | 271789 Number of splices: AT/AC | 19989 Number of splices: Non-canonical | 42052 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512331 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 1422 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 452499 452499 452499 N_multimapping 512331 512331 512331 N_noFeature 431421 10387594 10754567 N_ambiguous 250803 60960 56367 UnstrandedReadsAssigned:20162714 PositiveStrandReadsAssigned:10396384 NegativeStrandReadsAssigned:10034004 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18272733 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18272733-trimmed-pair1.fastq SRR18272733-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,809,768 reads, 20,692,377 reads pseudoaligned [quant] estimated average fragment length: 253.139 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR18272733.ke.tsv 34699 SRR18272733.se.tsv 87100 total ==> SRR18272733.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.86 1197 26.4143 Potri.005G024800.1.v4.1 1035 782.861 185 9.20849 Potri.004G059700.1.v4.1 961 708.878 191 10.4994 Potri.007G009000.2.v4.1 1416 1163.86 0 0 Potri.003G141000.2.v4.1 2943 2690.86 910 13.1781 Potri.016G087400.1.v4.1 270 64.9212 1331 798.9 Potri.015G069301.1.v4.1 564 313.057 0 0 Potri.010G195200.1.v4.1 1773 1520.86 47 1.20423 Potri.012G127500.1.v4.1 977 724.878 18710 1005.8 ==> SRR18272733.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 781 Potri.001G233950.v4.1 10 Potri.001G122700.v4.1 541 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 95 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR18272733 completed mapping pipeline successfully