Starting /dee2/code/volunteer_pipeline.sh SRR18272734 current disk space = 3056951132160 free memory = 1352995752 SRR18272734 SRAfilesize a0a976452fdbd0f9687c655c1dd1e07f SRR18272734.sra SRR18272734.sra file validated SRR18272734 is paired end SRR18272734 is conventional basespace SRR18272734 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272734_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44725 37.0 37.0 37.0 35.0 38.0 2 35.83425 37.0 36.0 37.0 34.0 38.0 3 36.3295 37.0 36.0 37.0 35.0 38.0 4 36.39725 37.0 37.0 37.0 35.0 38.0 5 36.4135 37.0 37.0 37.0 35.0 38.0 6 36.41825 37.0 37.0 37.0 35.0 38.0 7 36.4105 37.0 37.0 37.0 35.0 38.0 8 36.46675 37.0 37.0 37.0 35.0 38.0 9 36.42375 37.0 37.0 37.0 35.0 38.0 10-14 36.40480000000001 37.0 36.4 37.0 35.0 38.0 15-19 36.39485 37.0 36.4 37.0 35.0 38.0 20-24 36.38585 37.0 36.4 37.0 35.0 38.0 25-29 36.3575 37.0 36.6 37.0 35.0 38.0 30-34 36.324200000000005 37.0 36.0 37.0 35.0 38.0 35-39 36.371050000000004 37.0 36.2 37.0 35.0 38.0 40-44 36.290350000000004 37.0 36.0 37.0 35.0 38.0 45-49 36.31660000000001 37.0 36.0 37.0 35.0 38.0 50-54 36.32125 37.0 36.0 37.0 35.0 38.0 55-59 36.215250000000005 37.0 36.0 37.0 35.0 38.0 60-64 36.244299999999996 37.0 36.0 37.0 35.0 38.0 65-69 36.18365 37.0 36.0 37.0 35.0 38.0 70-74 36.1725 37.0 36.0 37.0 35.0 38.0 75-79 36.1118 37.0 36.0 37.0 35.0 38.0 80-84 36.100049999999996 37.0 36.0 37.0 35.0 38.0 85-89 36.059850000000004 37.0 36.0 37.0 34.8 38.0 90-94 35.9594 37.0 36.0 37.0 34.4 38.0 95-99 35.91775 37.0 36.0 37.0 34.2 38.0 100-104 35.8625 37.0 36.0 37.0 34.0 38.0 105-109 35.83265 37.0 36.0 37.0 34.0 38.0 110-114 35.774950000000004 37.0 36.0 37.0 34.0 38.0 115-119 35.65735 37.0 36.0 37.0 33.6 38.0 120-124 35.56995 37.0 36.0 37.0 33.0 38.0 125-129 35.417500000000004 37.0 36.0 37.0 32.6 38.0 130-134 35.29925 37.0 36.0 37.0 32.4 38.0 135-139 35.3142 37.0 36.0 37.0 31.8 38.0 140-144 35.10365 37.0 36.0 37.0 31.4 38.0 145-149 34.95335 37.0 35.8 37.0 30.4 38.0 150 34.99875 37.0 36.0 37.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 6.0 28 22.0 29 33.0 30 52.0 31 61.0 32 77.0 33 174.0 34 280.0 35 600.0 36 1648.0 37 1046.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5 15.45 13.825000000000001 34.225 2 16.925 24.925 42.775 15.375 3 17.474999999999998 28.575 29.575000000000003 24.375 4 21.525 35.15 25.05 18.275 5 20.45 35.775 26.075 17.7 6 16.625 35.425000000000004 28.125 19.825 7 15.425 14.725 47.55 22.3 8 19.900000000000002 21.925 26.55 31.624999999999996 9 19.525000000000002 23.3 29.799999999999997 27.375 10-14 20.75 29.79 26.540000000000003 22.919999999999998 15-19 21.58 28.189999999999998 27.71 22.52 20-24 21.65 28.549999999999997 27.52 22.28 25-29 21.349999999999998 28.925 27.67 22.055 30-34 21.265 28.9 27.665 22.17 35-39 22.075 28.395 27.375 22.155 40-44 21.759999999999998 28.765 27.05 22.425 45-49 22.189999999999998 28.835 27.38 21.595 50-54 21.93 27.765 27.82 22.485 55-59 22.009999999999998 28.725 27.185 22.08 60-64 22.18 28.13 28.025 21.665 65-69 21.615000000000002 29.09 27.0 22.295 70-74 22.17 27.634999999999998 28.015 22.18 75-79 22.24 28.365000000000002 27.315 22.08 80-84 21.955 28.4 27.389999999999997 22.255 85-89 22.314999999999998 28.265 28.105000000000004 21.315 90-94 22.405 28.110000000000003 27.650000000000002 21.834999999999997 95-99 22.189999999999998 28.110000000000003 27.415 22.285 100-104 22.14 28.225 27.675 21.959999999999997 105-109 22.45 28.505000000000003 27.215 21.83 110-114 22.49 27.905 27.58 22.025 115-119 22.42 28.199999999999996 27.634999999999998 21.745 120-124 22.29 27.665 27.800000000000004 22.245 125-129 23.175 28.03 26.995 21.8 130-134 22.35 27.67 28.01 21.97 135-139 21.795 27.73 28.1 22.375 140-144 23.0 27.51 27.450000000000003 22.040000000000003 145-149 23.015 27.38 27.24 22.365 150 24.75 26.05 27.0 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 4.0 24 6.0 25 6.0 26 10.0 27 11.5 28 14.0 29 20.5 30 24.5 31 29.0 32 36.0 33 51.5 34 65.5 35 77.5 36 82.0 37 99.0 38 134.5 39 162.0 40 175.0 41 199.5 42 236.5 43 261.5 44 275.5 45 260.0 46 251.5 47 251.5 48 226.5 49 185.5 50 164.5 51 147.5 52 117.5 53 100.5 54 74.0 55 49.5 56 39.0 57 32.0 58 28.0 59 21.0 60 16.5 61 15.5 62 11.0 63 6.5 64 5.0 65 4.5 66 3.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91331817033105 97.85000000000001 2 1.0866818296689411 2.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAA 10 0.006973645 144.0 3 >>END_MODULE SRR18272734 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18272734_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.22075 37.0 36.0 37.0 35.0 38.0 2 35.72225 37.0 36.0 37.0 34.0 38.0 3 36.2825 37.0 36.0 37.0 35.0 38.0 4 36.25925 37.0 36.0 37.0 35.0 38.0 5 36.12225 37.0 36.0 37.0 35.0 38.0 6 36.18025 37.0 36.0 37.0 35.0 38.0 7 36.03475 37.0 36.0 37.0 35.0 38.0 8 36.1435 37.0 36.0 37.0 35.0 38.0 9 36.25825 37.0 36.0 37.0 35.0 38.0 10-14 36.094049999999996 37.0 36.0 37.0 34.6 38.0 15-19 36.0989 37.0 36.0 37.0 34.8 38.0 20-24 36.10725 37.0 36.0 37.0 34.6 38.0 25-29 36.06595 37.0 36.0 37.0 35.0 38.0 30-34 36.02515000000001 37.0 36.0 37.0 34.6 38.0 35-39 35.9779 37.0 36.0 37.0 34.2 38.0 40-44 35.9339 37.0 36.0 37.0 34.0 38.0 45-49 35.90345 37.0 36.0 37.0 34.0 38.0 50-54 35.89185 37.0 36.0 37.0 34.0 38.0 55-59 35.7586 37.0 36.0 37.0 33.8 38.0 60-64 35.7156 37.0 36.0 37.0 33.8 38.0 65-69 35.65365 37.0 36.0 37.0 33.4 38.0 70-74 35.5779 37.0 36.0 37.0 33.0 38.0 75-79 35.4414 37.0 36.0 37.0 32.8 38.0 80-84 35.4022 37.0 36.0 37.0 32.6 38.0 85-89 35.248900000000006 37.0 35.8 37.0 31.6 38.0 90-94 35.23615 37.0 36.0 37.0 31.8 38.0 95-99 35.0486 37.0 35.4 37.0 31.0 38.0 100-104 34.961749999999995 37.0 35.2 37.0 30.6 38.0 105-109 34.829150000000006 37.0 35.0 37.0 30.0 38.0 110-114 34.655499999999996 37.0 35.0 37.0 29.6 38.0 115-119 34.519499999999994 37.0 35.0 37.0 28.8 38.0 120-124 34.236399999999996 37.0 35.0 37.0 27.4 38.0 125-129 34.08389999999999 36.8 35.0 37.0 26.8 38.0 130-134 33.93055 36.6 34.8 37.0 26.0 38.0 135-139 33.521249999999995 36.0 34.0 37.0 23.8 38.0 140-144 33.51245 36.2 34.0 37.0 24.2 38.0 145-149 33.312799999999996 36.0 33.8 37.0 22.6 38.0 150 33.19825 36.0 34.0 37.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 19.0 28 60.0 29 86.0 30 111.0 31 155.0 32 150.0 33 281.0 34 406.0 35 739.0 36 1353.0 37 637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.375 15.75 15.55 35.325 2 17.349999999999998 23.849999999999998 43.225 15.575 3 17.1 27.200000000000003 31.674999999999997 24.025 4 21.625 35.275 25.5 17.599999999999998 5 20.724999999999998 34.575 26.450000000000003 18.25 6 15.625 35.9 27.1 21.375 7 14.899999999999999 15.35 45.275 24.474999999999998 8 18.275 22.75 28.025 30.95 9 21.075 22.375 28.425 28.125 10-14 21.59 28.694999999999997 26.334999999999997 23.380000000000003 15-19 21.205 28.185 27.615000000000002 22.994999999999997 20-24 21.375 28.110000000000003 27.72 22.795 25-29 21.349999999999998 29.160000000000004 27.565 21.925 30-34 21.45 28.26 27.810000000000002 22.48 35-39 21.435000000000002 28.060000000000002 27.57 22.935 40-44 20.835 28.860000000000003 27.644999999999996 22.66 45-49 21.625 28.244999999999997 28.025 22.105 50-54 21.125 28.915000000000003 27.18 22.78 55-59 21.955 28.7 27.52 21.825 60-64 21.884999999999998 28.12 27.57 22.425 65-69 21.945 28.720000000000002 27.075 22.259999999999998 70-74 21.605 28.68 27.474999999999998 22.24 75-79 21.785 27.775 27.83 22.61 80-84 21.625 27.91 27.345000000000002 23.119999999999997 85-89 22.295 27.67 27.834999999999997 22.2 90-94 22.09 27.950000000000003 27.655 22.305 95-99 21.595 28.32 27.950000000000003 22.134999999999998 100-104 22.445 27.49 27.334999999999997 22.73 105-109 22.314999999999998 27.794999999999998 27.694999999999997 22.195 110-114 22.1 27.515 27.36 23.025000000000002 115-119 22.555 27.455000000000002 27.705000000000002 22.285 120-124 22.59 27.96 27.265 22.185 125-129 22.64 27.825 27.060000000000002 22.475 130-134 22.86 27.235 27.634999999999998 22.27 135-139 22.67 27.455000000000002 27.215 22.66 140-144 23.141157057852894 27.50637531876594 27.141357067853395 22.211110555527778 145-149 23.145 27.375 27.589999999999996 21.89 150 22.575 26.5 27.400000000000002 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.0 25 4.0 26 7.0 27 8.5 28 9.0 29 14.5 30 19.0 31 30.0 32 49.0 33 56.5 34 61.5 35 75.5 36 95.0 37 111.5 38 121.0 39 141.0 40 179.5 41 202.5 42 221.0 43 257.5 44 275.5 45 272.0 46 254.0 47 230.5 48 226.5 49 208.0 50 180.0 51 149.5 52 111.0 53 94.5 54 78.5 55 59.0 56 47.0 57 32.0 58 23.0 59 19.5 60 15.0 61 10.5 62 8.0 63 6.0 64 5.5 65 7.0 66 3.0 67 3.5 68 3.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.605476673428 97.225 2 1.3691683569979716 2.7 3 0.02535496957403651 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAACAT 10 0.006973645 144.0 1 >>END_MODULE Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101442 spots for SRR18272734.sra Written 1101442 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra Read 1101423 spots for SRR18272734.sra Written 1101423 spots for SRR18272734.sra SRR ids: ['SRR18272734.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qp9b9fe_ SRR18272734.sra spots: 22028479 blocks: [[1, 1101423], [1101424, 2202846], [2202847, 3304269], [3304270, 4405692], [4405693, 5507115], [5507116, 6608538], [6608539, 7709961], [7709962, 8811384], [8811385, 9912807], [9912808, 11014230], [11014231, 12115653], [12115654, 13217076], [13217077, 14318499], [14318500, 15419922], [15419923, 16521345], [16521346, 17622768], [17622769, 18724191], [18724192, 19825614], [19825615, 20927037], [20927038, 22028479]] SRR18272734 file size 7841098 SRR18272734 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18272734 SRR18272734_1.fastq SRR18272734_2.fastq Input file: SRR18272734_1.fastq Paired file: SRR18272734_2.fastq trimmed: SRR18272734-trimmed-pair1.fastq, SRR18272734-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:35:36 2025 >> started Tue Feb 11 04:41:59 2025 >> done (382.762s) 22028479 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 22028479 (100.00%) read pairs available; of these: 1153919 ( 5.24%) trimmed read pairs available after processing 20874560 (94.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 141 3 0.00% 142 28 0.00% 143 23 0.00% 144 20 0.00% 145 13 0.00% 146 23 0.00% 147 190 0.00% 148 9707 0.04% 149 1143912 5.19% 150 20874560 94.76% 22028479 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=70.39 fanout-score-rank=4 prefix-density=1.31 prefix-fanout=32.8 sequence=AAGTCGGAGGCCAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=330.81 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=31.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=70.40 fanout-score-rank=6 prefix-density=1.39 prefix-fanout=32.7 sequence=AAGTCGGATCGTAGCCATGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=342.60 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=30.6 sequence=CTTCTTCTTCTT SRR18272734 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:51:08 Started mapping on | Feb 11 04:51:22 Finished on | Feb 11 05:32:51 Mapping speed, Million of reads per hour | 31.86 Number of input reads | 22028479 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20953240 Uniquely mapped reads % | 95.12% Average mapped length | 297.95 Number of splices: Total | 20386456 Number of splices: Annotated (sjdb) | 20083329 Number of splices: GT/AG | 20051541 Number of splices: GC/AG | 270848 Number of splices: AT/AC | 20485 Number of splices: Non-canonical | 43582 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 523533 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 3153 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551706 551706 551706 N_multimapping 523533 523533 523533 N_noFeature 436925 10433705 10824033 N_ambiguous 253505 63428 58371 UnstrandedReadsAssigned:20262810 PositiveStrandReadsAssigned:10456107 NegativeStrandReadsAssigned:10070836 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18272734 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18272734-trimmed-pair1.fastq SRR18272734-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,028,479 reads, 20,962,511 reads pseudoaligned [quant] estimated average fragment length: 242.406 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR18272734.ke.tsv 34699 SRR18272734.se.tsv 87100 total ==> SRR18272734.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.59 869 18.9883 Potri.005G024800.1.v4.1 1035 793.594 155 7.58209 Potri.004G059700.1.v4.1 961 719.594 141 7.60654 Potri.007G009000.2.v4.1 1416 1174.59 0 0 Potri.003G141000.2.v4.1 2943 2701.59 795.218 11.4267 Potri.016G087400.1.v4.1 270 71.7287 1411 763.641 Potri.015G069301.1.v4.1 564 323.617 0 0 Potri.010G195200.1.v4.1 1773 1531.59 68 1.72354 Potri.012G127500.1.v4.1 977 735.594 20147 1063.23 ==> SRR18272734.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 499 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 638 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 121 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR18272734 completed mapping pipeline successfully