Starting /dee2/code/volunteer_pipeline.sh SRR18274412 current disk space = 3054915694592 free memory = 1459004688 SRR18274412 SRAfilesize 388e5e5b93d2d5c14231700193d1c3d7 SRR18274412.sra SRR18274412.sra file validated SRR18274412 is paired end SRR18274412 is conventional basespace SRR18274412 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.245 32.0 32.0 32.0 32.0 32.0 2 31.27125 32.0 32.0 32.0 32.0 32.0 3 34.7725 37.0 32.0 37.0 32.0 37.0 4 35.355 37.0 37.0 37.0 32.0 37.0 5 35.985 37.0 37.0 37.0 37.0 37.0 6 38.276 41.0 37.0 41.0 32.0 41.0 7 38.0895 41.0 37.0 41.0 32.0 41.0 8 37.27175 41.0 37.0 41.0 27.0 41.0 9 36.88925 41.0 37.0 41.0 27.0 41.0 10-14 37.1899 41.0 37.0 41.0 27.0 41.0 15-19 37.402049999999996 41.0 37.0 41.0 27.0 41.0 20-24 37.111599999999996 41.0 37.0 41.0 27.0 41.0 25-29 36.799949999999995 41.0 37.0 41.0 27.0 41.0 30-34 37.06075 41.0 37.0 41.0 27.0 41.0 35-39 37.058749999999996 41.0 37.0 41.0 27.0 41.0 40-44 37.1852 41.0 37.0 41.0 27.0 41.0 45-49 37.0617 41.0 37.0 41.0 27.0 41.0 50-54 36.9781 41.0 37.0 41.0 27.0 41.0 55-59 36.392399999999995 41.0 34.0 41.0 27.0 41.0 60-64 36.360400000000006 41.0 36.0 41.0 27.0 41.0 65-69 36.7039 41.0 37.0 41.0 27.0 41.0 70-74 36.55645 41.0 37.0 41.0 25.0 41.0 75-79 36.371500000000005 40.2 36.0 41.0 25.0 41.0 80-84 36.995050000000006 41.0 37.0 41.0 26.0 41.0 85-89 37.09775 41.0 37.0 41.0 27.0 41.0 90-94 36.96975 41.0 37.0 41.0 27.0 41.0 95-99 36.79195 41.0 37.0 41.0 26.0 41.0 100-104 36.465650000000004 41.0 37.0 41.0 22.0 41.0 105-109 36.2339 41.0 36.0 41.0 22.0 41.0 110-114 35.92155 41.0 35.0 41.0 22.0 41.0 115-119 35.74795 41.0 34.0 41.0 22.0 41.0 120-124 35.3584 40.2 32.0 41.0 22.0 41.0 125-129 35.0976 40.2 32.0 41.0 22.0 41.0 130-134 34.48355 37.0 32.0 41.0 22.0 41.0 135-139 34.0557 37.0 30.0 41.0 22.0 41.0 140-144 33.34715 37.0 27.0 41.0 22.0 41.0 145-149 33.1836 37.0 27.0 41.0 20.0 41.0 150 33.021 37.0 27.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.18840104849278916 1101 2 0.17012803710051472 1101 3 0.2151174513559866 1101 4 -0.22330880129045028 1101 5 -0.15487952414557782 1101 6 0.2923681822764408 1101 7 -0.8449440467789131 1101 8 0.08965117451356264 1101 9 -0.2966528883960109 1101 10-14 -0.46323218066336835 1101 15-19 -0.08543704002419616 1101 20-24 0.4474291763282565 1101 25-29 -0.22061195685048318 1101 30-34 -0.339580602883359 1101 35-39 -0.5352807742715981 1101 40-44 -0.2842272406492583 1101 45-49 -0.5380078636959382 1101 50-54 -0.05344288738784542 1101 55-59 0.08714084081056939 1101 60-64 -0.2463857243673715 1101 65-69 -0.3169926403871344 1101 70-74 -0.06822764391571923 1101 75-79 0.35070571630204483 1101 80-84 -0.5491228954531735 1101 85-89 -0.045090230870044934 1101 90-94 -0.20453170682528565 1101 95-99 -0.2424942030446644 1101 100-104 -0.4917380784353256 1101 105-109 -0.2667960479887057 1101 110-114 0.003498336525858292 1101 115-119 -0.2916019760056443 1101 120-124 -0.3724468192358117 1101 125-129 -0.058030043351145366 1101 130-134 -0.11519306381691763 1101 135-139 -0.3422320798467595 1101 140-144 -0.12516886782941583 1101 145-149 -0.1687922169573497 1101 150 0.053987297106566245 1102 1 -0.1884010484927927 1102 2 -0.17012803710051472 1102 3 -0.21511745135597948 1102 4 0.22330880129045028 1102 5 0.15487952414557782 1102 6 -0.2923681822764408 1102 7 0.844944046778906 1102 8 -0.08965117451355553 1102 9 0.2966528883960038 1102 10-14 0.46323218066336835 1102 15-19 0.08543704002419616 1102 20-24 -0.4474291763282636 1102 25-29 0.22061195685048318 1102 30-34 0.339580602883359 1102 35-39 0.5352807742715981 1102 40-44 0.2842272406492583 1102 45-49 0.5380078636959453 1102 50-54 0.05344288738783831 1102 55-59 -0.08714084081056228 1102 60-64 0.2463857243673786 1102 65-69 0.3169926403871415 1102 70-74 0.06822764391571923 1102 75-79 -0.35070571630205194 1102 80-84 0.5491228954531664 1102 85-89 0.045090230870044934 1102 90-94 0.20453170682529276 1102 95-99 0.2424942030446644 1102 100-104 0.4917380784353256 1102 105-109 0.2667960479887128 1102 110-114 -0.003498336525858292 1102 115-119 0.2916019760056443 1102 120-124 0.3724468192358046 1102 125-129 0.058030043351145366 1102 130-134 0.11519306381691763 1102 135-139 0.3422320798467595 1102 140-144 0.12516886782941583 1102 145-149 0.1687922169573568 1102 150 -0.05398729710655914 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 9.0 25 10.0 26 19.0 27 23.0 28 28.0 29 47.0 30 69.0 31 102.0 32 146.0 33 205.0 34 293.0 35 490.0 36 693.0 37 925.0 38 736.0 39 198.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.27906976744186 26.406601650412604 14.853713428357091 42.460615153788446 2 21.099999999999998 21.349999999999998 36.75 20.8 3 17.992992992992992 23.973973973973976 31.78178178178178 26.25125125125125 4 19.950000000000003 23.150000000000002 32.9 24.0 5 27.575 22.85 28.449999999999996 21.125 6 23.35 23.799999999999997 30.2 22.650000000000002 7 29.5 25.474999999999998 24.9 20.125 8 19.825 21.95 34.625 23.599999999999998 9 21.6 21.05 34.375 22.975 10-14 24.47 24.97 26.355 24.205 15-19 24.84 24.765 24.635 25.759999999999998 20-24 24.525 25.595000000000002 25.44 24.44 25-29 23.915 25.319999999999997 25.6 25.165 30-34 24.72 25.14 24.965 25.174999999999997 35-39 24.87 24.965 24.805 25.36 40-44 25.045 25.45 24.7 24.805 45-49 24.575 25.230000000000004 24.625 25.569999999999997 50-54 25.185000000000002 24.915000000000003 24.345 25.555 55-59 24.235 24.610000000000003 25.5 25.655 60-64 24.37 24.775 25.4 25.455 65-69 25.19 25.575 24.55 24.685000000000002 70-74 25.185000000000002 24.595 25.335 24.884999999999998 75-79 24.635 25.235000000000003 25.424999999999997 24.705 80-84 24.81 25.240000000000002 24.755 25.195 85-89 25.121256062803138 25.401270063503173 23.85619280964048 25.621281064053203 90-94 25.635 25.245 24.555 24.565 95-99 25.224999999999998 24.759999999999998 24.9 25.115 100-104 25.009999999999998 25.05 24.825 25.115 105-109 24.765 25.41 24.915000000000003 24.91 110-114 24.695 25.045 25.5 24.759999999999998 115-119 24.975 25.509999999999998 25.03 24.485 120-124 24.545 25.4 24.6 25.455 125-129 25.31 25.715 24.365000000000002 24.610000000000003 130-134 24.834999999999997 24.75 25.285000000000004 25.130000000000003 135-139 24.555 25.585 25.095 24.765 140-144 24.5 26.58 24.625 24.295 145-149 26.384999999999998 25.424999999999997 23.549999999999997 24.64 150 26.224999999999998 26.025 22.125 25.624999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 2.5 21 3.0 22 1.5 23 1.0 24 1.0 25 2.5 26 4.0 27 4.0 28 6.5 29 9.0 30 10.5 31 14.0 32 18.0 33 20.5 34 27.5 35 42.0 36 50.0 37 56.5 38 62.5 39 81.0 40 97.5 41 107.5 42 120.5 43 137.5 44 164.0 45 176.0 46 166.5 47 163.5 48 160.5 49 161.0 50 173.5 51 166.0 52 169.0 53 183.5 54 169.5 55 172.5 56 177.5 57 150.5 58 121.5 59 117.0 60 108.0 61 73.5 62 57.0 63 54.0 64 40.0 65 19.5 66 17.0 67 25.5 68 26.5 69 21.5 70 19.5 71 14.5 72 8.5 73 7.0 74 5.5 75 5.0 76 6.0 77 7.5 78 5.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.85 #Duplication Level Percentage of deduplicated Percentage of total 1 88.75924871940808 77.97500000000001 2 9.19180421172453 16.150000000000002 3 1.6789982925441094 4.425 4 0.3130335799658509 1.0999999999999999 5 0.028457598178713718 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.028457598178713718 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGGGTCCAAAAAGAGGGGCAGCGCCCCGCCTCCGATTCACGGAATAAG 9 0.22499999999999998 No Hit TGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.5875 0.0 0.0 0.0 0.0 138 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18274412 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274412_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.92 32.0 32.0 32.0 27.0 32.0 2 30.0775 32.0 32.0 32.0 27.0 32.0 3 31.12375 37.0 27.0 37.0 22.0 37.0 4 33.495 37.0 32.0 37.0 27.0 37.0 5 35.04875 37.0 37.0 37.0 27.0 37.0 6 37.2745 41.0 37.0 41.0 27.0 41.0 7 36.96925 41.0 37.0 41.0 27.0 41.0 8 37.49375 41.0 37.0 41.0 27.0 41.0 9 36.8465 41.0 37.0 41.0 27.0 41.0 10-14 36.4163 41.0 37.0 41.0 27.0 41.0 15-19 35.58495 37.0 33.0 41.0 24.0 41.0 20-24 36.1165 39.4 37.0 41.0 27.0 41.0 25-29 35.8636 38.6 34.0 41.0 26.0 41.0 30-34 35.83605 39.4 35.0 41.0 26.0 41.0 35-39 35.7201 39.4 32.0 41.0 25.0 41.0 40-44 35.799749999999996 40.2 33.0 41.0 24.0 41.0 45-49 34.939800000000005 37.0 32.0 41.0 22.0 41.0 50-54 34.8647 37.0 32.0 41.0 22.0 41.0 55-59 34.48469999999999 37.0 32.0 41.0 22.0 41.0 60-64 34.405649999999994 37.0 32.0 41.0 22.0 41.0 65-69 34.19375 37.0 32.0 41.0 22.0 41.0 70-74 33.799249999999994 37.0 30.0 41.0 22.0 41.0 75-79 32.9618 37.0 27.0 40.2 22.0 41.0 80-84 32.999199999999995 37.0 28.0 41.0 22.0 41.0 85-89 33.08125 37.0 27.0 41.0 22.0 41.0 90-94 32.2957 37.0 27.0 41.0 12.0 41.0 95-99 32.0392 37.0 27.0 41.0 12.0 41.0 100-104 31.051 32.0 23.0 41.0 12.0 41.0 105-109 30.00865 32.0 22.0 41.0 12.0 41.0 110-114 29.787050000000004 32.0 22.0 40.2 12.0 41.0 115-119 28.950049999999997 32.0 22.0 37.0 12.0 41.0 120-124 28.407049999999998 31.0 22.0 37.0 12.0 41.0 125-129 28.301799999999997 29.0 22.0 37.0 12.0 41.0 130-134 27.868450000000003 27.0 22.0 37.0 12.0 41.0 135-139 27.14345 27.0 22.0 37.0 12.0 41.0 140-144 26.676750000000006 27.0 22.0 37.0 12.0 41.0 145-149 26.45625 27.0 18.0 37.0 12.0 41.0 150 25.77775 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.09791813690896234 1101 2 0.15487952414558137 1101 3 -0.13698457505796924 1101 4 -0.3618056255670936 1101 5 0.26729004940013823 1101 6 -0.047333400544410154 1101 7 -0.5008317370702642 1101 8 -0.29546829317471435 1101 9 -0.47073797761871106 1101 10-14 -0.05141143260409109 1101 15-19 -0.2999596733541665 1101 20-24 -0.43191854017541687 1101 25-29 0.2191400342776504 1101 30-34 0.13829015021674707 1101 35-39 -0.05804012501260303 1101 40-44 -0.06347918136908248 1101 45-49 0.04983365258594574 1101 50-54 0.04028127835467643 1101 55-59 -0.023157576368589616 1101 60-64 -0.08615787881842607 1101 65-69 0.13017945357395178 1101 70-74 -0.4115989515072158 1101 75-79 0.0898578485734447 1101 80-84 0.08595624558927284 1101 85-89 -0.35060994051819705 1101 90-94 -0.7786167960479915 1101 95-99 -0.5362738179251991 1101 100-104 -0.006774876499644478 1101 105-109 -0.8294686964411788 1101 110-114 -0.41433612259299935 1101 115-119 -0.7201935678999938 1101 120-124 -0.37868232684746417 1101 125-129 -0.6266710353866287 1101 130-134 -0.34124911785462686 1101 135-139 -0.4468192358100609 1101 140-144 -0.5176177033975193 1101 145-149 -0.8298417179151123 1101 150 -1.5525254561951805 1102 1 -0.09791813690896234 1102 2 -0.15487952414557782 1102 3 0.13698457505796924 1102 4 0.3618056255670936 1102 5 -0.26729004940014534 1102 6 0.047333400544410154 1102 7 0.5008317370702713 1102 8 0.29546829317471435 1102 9 0.47073797761871106 1102 10-14 0.051411432604098195 1102 15-19 0.2999596733541665 1102 20-24 0.43191854017542397 1102 25-29 -0.21914003427764328 1102 30-34 -0.13829015021675417 1102 35-39 0.05804012501260303 1102 40-44 0.06347918136908959 1102 45-49 -0.04983365258595285 1102 50-54 -0.04028127835467643 1102 55-59 0.023157576368589616 1102 60-64 0.08615787881843318 1102 65-69 -0.13017945357395178 1102 70-74 0.4115989515072087 1102 75-79 -0.0898578485734518 1102 80-84 -0.08595624558927994 1102 85-89 0.35060994051819705 1102 90-94 0.7786167960479915 1102 95-99 0.536273817925192 1102 100-104 0.006774876499644478 1102 105-109 0.8294686964411753 1102 110-114 0.4143361225930029 1102 115-119 0.7201935678999902 1102 120-124 0.37868232684746417 1102 125-129 0.6266710353866323 1102 130-134 0.3412491178546233 1102 135-139 0.4468192358100609 1102 140-144 0.5176177033975229 1102 145-149 0.8298417179151123 1102 150 1.552525456195184 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 17.0 23 42.0 24 49.0 25 86.0 26 109.0 27 121.0 28 169.0 29 203.0 30 256.0 31 355.0 32 518.0 33 615.0 34 621.0 35 526.0 36 251.0 37 53.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.775 26.575 16.1 41.55 2 20.549999999999997 22.25 37.4 19.8 3 19.525000000000002 24.375 31.275 24.825 4 20.525 22.675 33.35 23.45 5 28.449999999999996 23.525 27.250000000000004 20.775 6 22.875 23.724999999999998 30.425 22.975 7 26.174999999999997 24.375 26.650000000000002 22.8 8 20.025000000000002 21.075 35.9 23.0 9 23.974999999999998 21.05 32.4 22.575 10-14 24.85 24.6 26.290000000000003 24.26 15-19 24.81 24.585 25.165 25.44 20-24 24.265 24.185000000000002 25.965 25.585 25-29 24.01 24.295 25.935000000000002 25.759999999999998 30-34 24.55 24.77 25.369999999999997 25.31 35-39 24.044999999999998 24.610000000000003 25.865 25.480000000000004 40-44 24.52 24.94 25.61 24.93 45-49 25.040000000000003 24.83 24.915000000000003 25.215 50-54 24.595 24.465 25.34 25.6 55-59 23.845 24.795 25.679999999999996 25.679999999999996 60-64 25.185000000000002 23.715 25.72 25.380000000000003 65-69 24.87 24.14 25.685000000000002 25.305 70-74 24.98 24.44 25.3 25.28 75-79 24.26 23.855 25.805 26.08 80-84 24.77 24.455 25.230000000000004 25.545 85-89 24.895 24.675 24.845 25.585 90-94 24.915000000000003 24.755 24.65 25.679999999999996 95-99 24.42 24.169999999999998 25.535000000000004 25.874999999999996 100-104 25.545 24.265 24.64 25.55 105-109 24.93 23.935000000000002 24.81 26.325 110-114 25.040000000000003 23.655 24.935 26.369999999999997 115-119 25.485000000000003 22.745 25.405 26.365 120-124 25.224999999999998 23.45 25.169999999999998 26.155 125-129 25.685000000000002 23.189999999999998 25.224999999999998 25.900000000000002 130-134 25.119999999999997 23.285 25.474999999999998 26.119999999999997 135-139 25.195 23.535 24.645 26.625 140-144 26.13 23.5 24.38 25.990000000000002 145-149 25.695 23.61 24.32 26.375 150 27.224999999999998 22.05 24.075 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 2.0 24 2.0 25 2.5 26 3.0 27 7.0 28 9.0 29 9.0 30 12.5 31 17.5 32 16.0 33 19.0 34 26.0 35 36.5 36 50.0 37 55.5 38 64.5 39 70.0 40 83.5 41 100.0 42 111.0 43 139.5 44 172.0 45 191.5 46 188.0 47 167.0 48 151.0 49 156.0 50 181.5 51 178.5 52 160.0 53 169.0 54 167.0 55 153.5 56 164.0 57 158.5 58 134.0 59 122.5 60 111.5 61 89.5 62 66.0 63 53.0 64 42.0 65 32.0 66 23.0 67 20.5 68 23.0 69 19.5 70 13.0 71 9.0 72 8.0 73 7.0 74 6.0 75 3.5 76 2.0 77 5.5 78 4.0 79 1.5 80 1.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.47486033519553 80.975 2 7.877094972067039 14.099999999999998 3 1.1452513966480447 3.075 4 0.4748603351955307 1.7000000000000002 5 0.0 0.0 6 0.027932960893854747 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.55 0.0 0.0 0.0 0.0 138 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.006139246 28.8 55-59 >>END_MODULE Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524799 spots for SRR18274412.sra Written 1524799 spots for SRR18274412.sra Read 1524816 spots for SRR18274412.sra Written 1524816 spots for SRR18274412.sra SRR ids: ['SRR18274412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0s6sqly6 SRR18274412.sra spots: 30495997 blocks: [[1, 1524799], [1524800, 3049598], [3049599, 4574397], [4574398, 6099196], [6099197, 7623995], [7623996, 9148794], [9148795, 10673593], [10673594, 12198392], [12198393, 13723191], [13723192, 15247990], [15247991, 16772789], [16772790, 18297588], [18297589, 19822387], [19822388, 21347186], [21347187, 22871985], [22871986, 24396784], [24396785, 25921583], [25921584, 27446382], [27446383, 28971181], [28971182, 30495997]] SRR18274412 file size 11204260 SRR18274412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18274412 SRR18274412_1.fastq SRR18274412_2.fastq Input file: SRR18274412_1.fastq Paired file: SRR18274412_2.fastq trimmed: SRR18274412-trimmed-pair1.fastq, SRR18274412-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:40:41 2025 >> started Tue Feb 11 07:41:20 2025 >> done (38.938s) 30495997 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 30495993 (100.00%) read pairs available; of these: 4706451 (15.43%) trimmed read pairs available after processing 25789542 (84.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 0 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 3 0.00% 26 2 0.00% 27 7 0.00% 28 5 0.00% 29 3 0.00% 30 4 0.00% 31 7 0.00% 32 5 0.00% 33 6 0.00% 34 7 0.00% 35 10 0.00% 36 14 0.00% 37 13 0.00% 38 10 0.00% 39 15 0.00% 40 15 0.00% 41 17 0.00% 42 14 0.00% 43 31 0.00% 44 26 0.00% 45 30 0.00% 46 32 0.00% 47 23 0.00% 48 33 0.00% 49 28 0.00% 50 40 0.00% 51 26 0.00% 52 36 0.00% 53 45 0.00% 54 31 0.00% 55 63 0.00% 56 52 0.00% 57 42 0.00% 58 41 0.00% 59 54 0.00% 60 51 0.00% 61 51 0.00% 62 70 0.00% 63 54 0.00% 64 36 0.00% 65 51 0.00% 66 69 0.00% 67 66 0.00% 68 64 0.00% 69 52 0.00% 70 60 0.00% 71 59 0.00% 72 69 0.00% 73 49 0.00% 74 54 0.00% 75 65 0.00% 76 62 0.00% 77 57 0.00% 78 67 0.00% 79 62 0.00% 80 56 0.00% 81 70 0.00% 82 67 0.00% 83 56 0.00% 84 73 0.00% 85 55 0.00% 86 68 0.00% 87 63 0.00% 88 63 0.00% 89 53 0.00% 90 64 0.00% 91 85 0.00% 92 77 0.00% 93 60 0.00% 94 86 0.00% 95 76 0.00% 96 83 0.00% 97 84 0.00% 98 100 0.00% 99 86 0.00% 100 88 0.00% 101 82 0.00% 102 76 0.00% 103 106 0.00% 104 109 0.00% 105 120 0.00% 106 96 0.00% 107 91 0.00% 108 106 0.00% 109 102 0.00% 110 109 0.00% 111 121 0.00% 112 116 0.00% 113 135 0.00% 114 153 0.00% 115 181 0.00% 116 175 0.00% 117 178 0.00% 118 240 0.00% 119 249 0.00% 120 260 0.00% 121 287 0.00% 122 294 0.00% 123 338 0.00% 124 380 0.00% 125 399 0.00% 126 400 0.00% 127 438 0.00% 128 466 0.00% 129 471 0.00% 130 471 0.00% 131 461 0.00% 132 461 0.00% 133 3337 0.01% 134 89495 0.29% 135 94185 0.31% 136 96524 0.32% 137 100533 0.33% 138 104136 0.34% 139 106853 0.35% 140 109179 0.36% 141 113146 0.37% 142 114739 0.38% 143 119010 0.39% 144 119278 0.39% 145 122922 0.40% 146 126377 0.41% 147 140346 0.46% 148 259658 0.85% 149 2875575 9.43% 150 25789542 84.57% 30495993 reads passed initial QC criterion=sequence-density sequence-density=3.06 sequence-density-rank=1 fanout-score=1.03 fanout-score-rank=44 prefix-density=1.23 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.32 sequence-density-rank=28 fanout-score=60.48 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=22.5 sequence=TCAAACACAAAGTTACCTAAACTATAGAA criterion=sequence-density sequence-density=3.62 sequence-density-rank=1 fanout-score=1.44 fanout-score-rank=45 prefix-density=2.36 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=40 fanout-score=37.17 fanout-score-rank=1 prefix-density=3.27 prefix-fanout=1.1 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATGGGTTACTTCAGCGCCGTAGCGCCTGGTACTCGAACATTGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAACAGGGACACCGTGCGTCCTTGAACCGATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR18274412 SRR18274412_1.fastq SRR18274412_2.fastq Input file: SRR18274412_1.fastq Paired file: SRR18274412_2.fastq trimmed: SRR18274412-trimmed-pair1.fastq, SRR18274412-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:44:08 2025 >> started Tue Feb 11 07:44:23 2025 >> done (15.884s) 15247997 read pairs processed; of these: 104229 ( 0.68%) short read pairs filtered out after trimming by size control 65970 ( 0.43%) empty read pairs filtered out after trimming by size control 15077798 (98.88%) read pairs available; of these: 16949 ( 0.11%) trimmed read pairs available after processing 15060849 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 6 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 3 0.00% 33 1 0.00% 34 7 0.00% 35 4 0.00% 36 9 0.00% 37 8 0.00% 38 7 0.00% 39 10 0.00% 40 9 0.00% 41 7 0.00% 42 7 0.00% 43 15 0.00% 44 13 0.00% 45 14 0.00% 46 16 0.00% 47 12 0.00% 48 17 0.00% 49 12 0.00% 50 26 0.00% 51 14 0.00% 52 16 0.00% 53 25 0.00% 54 21 0.00% 55 25 0.00% 56 31 0.00% 57 22 0.00% 58 20 0.00% 59 29 0.00% 60 24 0.00% 61 32 0.00% 62 40 0.00% 63 26 0.00% 64 21 0.00% 65 27 0.00% 66 29 0.00% 67 38 0.00% 68 34 0.00% 69 26 0.00% 70 30 0.00% 71 29 0.00% 72 29 0.00% 73 24 0.00% 74 27 0.00% 75 36 0.00% 76 33 0.00% 77 33 0.00% 78 37 0.00% 79 32 0.00% 80 23 0.00% 81 40 0.00% 82 32 0.00% 83 27 0.00% 84 36 0.00% 85 27 0.00% 86 32 0.00% 87 32 0.00% 88 31 0.00% 89 16 0.00% 90 34 0.00% 91 36 0.00% 92 34 0.00% 93 26 0.00% 94 41 0.00% 95 44 0.00% 96 36 0.00% 97 38 0.00% 98 54 0.00% 99 45 0.00% 100 40 0.00% 101 42 0.00% 102 34 0.00% 103 54 0.00% 104 55 0.00% 105 53 0.00% 106 45 0.00% 107 36 0.00% 108 48 0.00% 109 49 0.00% 110 52 0.00% 111 61 0.00% 112 55 0.00% 113 71 0.00% 114 74 0.00% 115 86 0.00% 116 89 0.00% 117 80 0.00% 118 109 0.00% 119 115 0.00% 120 124 0.00% 121 145 0.00% 122 147 0.00% 123 171 0.00% 124 176 0.00% 125 189 0.00% 126 199 0.00% 127 233 0.00% 128 239 0.00% 129 226 0.00% 130 243 0.00% 131 231 0.00% 132 271 0.00% 133 1660 0.01% 134 44087 0.29% 135 46607 0.31% 136 47519 0.32% 137 49619 0.33% 138 51559 0.34% 139 52533 0.35% 140 53988 0.36% 141 55952 0.37% 142 57131 0.38% 143 58724 0.39% 144 58957 0.39% 145 61276 0.41% 146 67132 0.45% 147 74046 0.49% 148 133033 0.88% 149 1406971 9.33% 150 12751447 84.57% criterion=sequence-density sequence-density=2.45 sequence-density-rank=1 fanout-score=1.04 fanout-score-rank=42 prefix-density=1.15 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.29 sequence-density-rank=27 fanout-score=58.98 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=22.5 sequence=TCAAACACAAAGTTACCTAAACTATAGAA criterion=sequence-density sequence-density=2.80 sequence-density-rank=1 fanout-score=1.41 fanout-score-rank=44 prefix-density=2.06 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=39 fanout-score=37.34 fanout-score-rank=1 prefix-density=3.11 prefix-fanout=1.1 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATGGGTTACTTCAGCGCCGTAGCGCCTGGTACTCGAACATTGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAACAGGGACACCGTGCGTCCTTGAACCGATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTA SRR18274412 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:46:29 Started mapping on | Feb 11 07:46:30 Finished on | Feb 11 08:00:48 Mapping speed, Million of reads per hour | 127.24 Number of input reads | 30325794 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12378827 Uniquely mapped reads % | 40.82% Average mapped length | 279.92 Number of splices: Total | 4470273 Number of splices: Annotated (sjdb) | 4289327 Number of splices: GT/AG | 4334310 Number of splices: GC/AG | 62204 Number of splices: AT/AC | 11461 Number of splices: Non-canonical | 62298 Mismatch rate per base, % | 1.45% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.05% Insertion average length | 4.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1410813 % of reads mapped to multiple loci | 4.65% Number of reads mapped to too many loci | 8219298 % of reads mapped to too many loci | 27.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.42% % of reads unmapped: other | 17.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 16536154 16536154 16536154 N_multimapping 1410813 1410813 1410813 N_noFeature 5222216 8678197 8720488 N_ambiguous 280232 40160 38079 UnstrandedReadsAssigned:6876379 PositiveStrandReadsAssigned:3660470 NegativeStrandReadsAssigned:3620260 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR18274412 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18274412-trimmed-pair1.fastq SRR18274412-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,325,794 reads, 21,494,733 reads pseudoaligned [quant] estimated average fragment length: 208.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR18274412.ke.tsv 34699 SRR18274412.se.tsv 87100 total ==> SRR18274412.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.41 337 3.12147 Potri.005G024800.1.v4.1 1035 827.411 105 2.12801 Potri.004G059700.1.v4.1 961 753.411 2 0.0445148 Potri.007G009000.2.v4.1 1416 1208.41 0 0 Potri.003G141000.2.v4.1 2943 2735.41 226.13 1.38625 Potri.016G087400.1.v4.1 270 83.4257 335 67.3366 Potri.015G069301.1.v4.1 564 356.59 0 0 Potri.010G195200.1.v4.1 1773 1565.41 1 0.0107122 Potri.012G127500.1.v4.1 977 769.411 1712 37.3123 ==> SRR18274412.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 23 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR18274412 completed mapping pipeline successfully