Starting /dee2/code/volunteer_pipeline.sh SRR18274413 current disk space = 3057001398272 free memory = 1186744004 SRR18274413 SRAfilesize 9dc674a1b58f31ce4e837b6a2abf1196 SRR18274413.sra SRR18274413.sra file validated SRR18274413 is paired end SRR18274413 is conventional basespace SRR18274413 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 8.19625 2.0 2.0 2.0 2.0 32.0 2 31.1725 32.0 32.0 32.0 32.0 32.0 3 32.25375 32.0 32.0 32.0 32.0 37.0 4 35.18125 37.0 37.0 37.0 32.0 37.0 5 35.88875 37.0 37.0 37.0 32.0 37.0 6 37.81075 41.0 37.0 41.0 32.0 41.0 7 37.79525 41.0 37.0 41.0 32.0 41.0 8 37.158 41.0 37.0 41.0 27.0 41.0 9 37.331 41.0 37.0 41.0 27.0 41.0 10-14 37.398 41.0 37.0 41.0 29.0 41.0 15-19 37.869 41.0 37.0 41.0 28.0 41.0 20-24 37.542950000000005 41.0 37.0 41.0 27.0 41.0 25-29 37.2699 41.0 37.0 41.0 27.0 41.0 30-34 37.4015 41.0 37.0 41.0 27.0 41.0 35-39 37.43895 41.0 37.0 41.0 27.0 41.0 40-44 37.40145 41.0 37.0 41.0 27.0 41.0 45-49 37.2197 41.0 37.0 41.0 26.0 41.0 50-54 37.19085 41.0 37.0 41.0 27.0 41.0 55-59 36.7583 41.0 36.0 41.0 27.0 41.0 60-64 36.541399999999996 41.0 35.0 41.0 26.0 41.0 65-69 36.777750000000005 41.0 37.0 41.0 27.0 41.0 70-74 36.45705 41.0 36.0 41.0 25.0 41.0 75-79 36.5721 40.2 36.0 41.0 26.0 41.0 80-84 37.3559 41.0 37.0 41.0 28.0 41.0 85-89 36.910849999999996 41.0 37.0 41.0 26.0 41.0 90-94 36.9327 41.0 37.0 41.0 26.0 41.0 95-99 37.00895 41.0 37.0 41.0 26.0 41.0 100-104 36.323449999999994 41.0 36.0 41.0 24.0 41.0 105-109 35.646550000000005 40.2 32.0 41.0 22.0 41.0 110-114 35.7334 41.0 34.0 41.0 22.0 41.0 115-119 35.305 40.2 32.0 41.0 22.0 41.0 120-124 35.4591 41.0 32.0 41.0 22.0 41.0 125-129 34.77805 37.0 32.0 41.0 22.0 41.0 130-134 34.3284 37.0 32.0 41.0 22.0 41.0 135-139 33.726 37.0 30.0 41.0 20.0 41.0 140-144 33.01875 37.0 27.0 41.0 20.0 41.0 145-149 32.8631 37.0 27.0 41.0 20.0 41.0 150 32.5615 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 1.0 25 4.0 26 10.0 27 10.0 28 19.0 29 35.0 30 66.0 31 94.0 32 142.0 33 223.0 34 394.0 35 594.0 36 853.0 37 949.0 38 538.0 39 63.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 17.261904761904763 25.238095238095237 21.666666666666668 35.833333333333336 2 22.725 21.525 37.025000000000006 18.725 3 19.3 22.125 34.150000000000006 24.425 4 19.825 20.674999999999997 36.825 22.675 5 28.95 22.0 29.825000000000003 19.225 6 24.325 22.375 32.475 20.825 7 29.425 24.25 25.1 21.224999999999998 8 21.3 22.375 34.425 21.9 9 24.775 21.725 31.624999999999996 21.875 10-14 25.874999999999996 25.014999999999997 25.8 23.31 15-19 26.365 23.895 23.630000000000003 26.11 20-24 24.975 25.119999999999997 25.080000000000002 24.825 25-29 24.865000000000002 24.709999999999997 25.619999999999997 24.805 30-34 24.965 25.019999999999996 25.095 24.92 35-39 24.85 25.324999999999996 24.815 25.009999999999998 40-44 25.035 25.224999999999998 25.330000000000002 24.41 45-49 25.105 25.119999999999997 24.59 25.185000000000002 50-54 24.485 25.145 24.375 25.995 55-59 24.815 24.84 25.174999999999997 25.169999999999998 60-64 25.025 24.865000000000002 25.21 24.9 65-69 25.655 25.25 24.709999999999997 24.385 70-74 24.610000000000003 24.665 25.855 24.87 75-79 25.205 24.465 25.41 24.92 80-84 24.959999999999997 26.1 24.09 24.85 85-89 25.455 26.224999999999998 24.51 23.810000000000002 90-94 24.945 26.075 24.57 24.41 95-99 25.174999999999997 24.87 24.48 25.474999999999998 100-104 24.94 25.019999999999996 25.240000000000002 24.8 105-109 25.014999999999997 24.82 25.240000000000002 24.925 110-114 24.275 25.36 24.9 25.465 115-119 25.45 25.155 24.795 24.6 120-124 24.59 25.445 24.995 24.97 125-129 25.324999999999996 24.55 24.875 25.25 130-134 24.9 25.495 24.865000000000002 24.740000000000002 135-139 24.785 26.46 24.165 24.59 140-144 25.095 26.919999999999998 23.765 24.22 145-149 26.27 26.255 22.97 24.505 150 25.624999999999996 26.625 22.575 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 1.0 21 0.5 22 1.0 23 1.5 24 2.5 25 3.0 26 4.0 27 6.0 28 9.0 29 6.5 30 5.0 31 9.0 32 14.0 33 21.5 34 29.0 35 43.5 36 54.5 37 61.0 38 76.0 39 77.5 40 101.0 41 143.5 42 138.0 43 147.5 44 181.5 45 188.5 46 172.5 47 145.5 48 152.0 49 173.0 50 176.5 51 167.0 52 168.5 53 176.0 54 167.0 55 164.5 56 162.0 57 141.0 58 121.0 59 102.5 60 80.5 61 69.0 62 56.5 63 43.5 64 30.5 65 27.0 66 33.0 67 30.0 68 25.0 69 20.0 70 13.5 71 10.5 72 9.5 73 5.5 74 4.5 75 4.5 76 2.5 77 4.0 78 3.5 79 2.0 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 79.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.64785675529029 85.375 2 6.429734129137277 11.85 3 0.7867607162235486 2.175 4 0.02712967986977754 0.1 5 0.10851871947911015 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NTTTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGA 5 0.125 No Hit NCCCGCCTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTA 5 0.125 No Hit NATCGGAGGCGGGGCGCTGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGC 5 0.125 No Hit NTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1875 0.0 0.0 0.0 0.0 136-137 1.075 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGCG 10 0.0070870784 143.225 7 GGAAAGC 10 0.0070870784 143.225 6 TTTGTGT 25 9.1503485E-4 127.311104 1 TTGTGTT 35 0.0034781226 90.9365 1 TGTGTTT 40 0.0059021553 53.709377 2 GGAAGAG 25 5.349808E-4 28.645 140-144 CGGAAGA 30 0.0015511854 23.870832 140-144 AGATCGG 30 0.0015511854 23.870832 135-139 >>END_MODULE SRR18274413 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274413_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.0 2.0 2.0 2.0 2.0 2.0 2 30.49 32.0 32.0 32.0 27.0 32.0 3 25.9625 27.0 27.0 27.0 22.0 27.0 4 31.96375 37.0 27.0 37.0 22.0 37.0 5 34.565 37.0 37.0 37.0 27.0 37.0 6 37.29025 41.0 37.0 41.0 32.0 41.0 7 36.77175 41.0 37.0 41.0 27.0 41.0 8 36.65325 41.0 37.0 41.0 27.0 41.0 9 35.959 41.0 37.0 41.0 22.0 41.0 10-14 36.3268 40.2 37.0 41.0 27.0 41.0 15-19 35.98785 37.8 36.0 41.0 27.0 41.0 20-24 36.24580000000001 38.6 37.0 41.0 27.0 41.0 25-29 35.6962 37.8 34.0 41.0 23.0 41.0 30-34 35.6727 37.8 32.0 41.0 25.0 41.0 35-39 35.6635 37.0 32.0 41.0 25.0 41.0 40-44 35.64565 37.8 33.0 41.0 24.0 41.0 45-49 35.117999999999995 37.0 32.0 41.0 22.0 41.0 50-54 35.124649999999995 37.0 32.0 41.0 22.0 41.0 55-59 34.4371 37.0 32.0 41.0 22.0 41.0 60-64 34.776849999999996 37.0 32.0 41.0 22.0 41.0 65-69 34.26375 37.0 32.0 41.0 22.0 41.0 70-74 33.18125 37.0 28.0 41.0 20.0 41.0 75-79 32.51285 36.0 26.0 39.4 22.0 41.0 80-84 32.26365 37.0 26.0 41.0 18.0 41.0 85-89 32.4759 37.0 27.0 41.0 22.0 41.0 90-94 31.80385 37.0 25.0 41.0 12.0 41.0 95-99 31.147550000000003 35.0 24.0 40.2 12.0 41.0 100-104 29.863999999999997 32.0 22.0 40.2 12.0 41.0 105-109 29.265000000000004 32.0 22.0 39.4 12.0 41.0 110-114 28.847550000000002 31.0 22.0 37.8 12.0 41.0 115-119 27.667550000000006 28.0 22.0 37.0 12.0 41.0 120-124 27.75475 27.0 22.0 37.0 12.0 41.0 125-129 26.9344 28.0 18.0 37.0 12.0 41.0 130-134 26.768100000000004 27.0 22.0 37.0 12.0 41.0 135-139 26.375300000000003 27.0 18.0 37.0 12.0 41.0 140-144 25.90425 27.0 14.0 37.0 12.0 41.0 145-149 25.998700000000003 27.0 16.0 36.0 12.0 41.0 150 25.363 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 9.0 22 23.0 23 48.0 24 63.0 25 80.0 26 143.0 27 145.0 28 215.0 29 262.0 30 386.0 31 432.0 32 541.0 33 603.0 34 556.0 35 358.0 36 119.0 37 15.0 38 1.0 39 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 NaN NaN NaN NaN 2 21.275 22.325 37.675 18.725 3 22.025 21.4 33.074999999999996 23.5 4 20.225 20.674999999999997 37.15 21.95 5 31.574999999999996 20.275000000000002 29.325000000000003 18.825 6 22.8 21.525 34.75 20.925 7 27.125 22.775000000000002 29.349999999999998 20.75 8 20.1 20.424999999999997 39.025 20.45 9 25.25 21.224999999999998 31.6 21.925 10-14 26.174999999999997 23.815 26.56 23.45 15-19 25.509999999999998 23.810000000000002 25.28 25.4 20-24 24.39 23.565 26.884999999999998 25.16 25-29 24.15 24.725 25.779999999999998 25.345000000000002 30-34 24.955 25.44 25.4 24.205 35-39 25.040000000000003 25.595000000000002 24.89 24.474999999999998 40-44 24.745 25.64 24.32 25.295 45-49 24.67 24.490000000000002 24.945 25.895000000000003 50-54 25.09 24.7 24.635 25.575 55-59 24.665 24.41 25.2 25.724999999999998 60-64 24.490000000000002 23.51 24.995 27.005000000000003 65-69 24.4 24.175 25.75 25.674999999999997 70-74 24.89 24.135 25.435000000000002 25.540000000000003 75-79 24.165 24.41 26.015 25.41 80-84 24.44 24.529999999999998 25.124999999999996 25.905 85-89 24.97 25.069999999999997 24.27 25.69 90-94 24.87 25.115 24.575 25.44 95-99 25.174999999999997 24.245 24.89 25.69 100-104 25.955000000000002 23.56 24.905 25.580000000000002 105-109 24.765 23.215 25.335 26.685 110-114 24.54 23.599999999999998 25.580000000000002 26.279999999999998 115-119 24.525 23.655 25.205 26.615 120-124 25.105 23.71 24.27 26.915 125-129 25.540000000000003 23.66 24.845 25.955000000000002 130-134 24.625 23.255 25.264999999999997 26.855 135-139 24.975 22.97 24.355 27.700000000000003 140-144 25.645 23.369999999999997 23.974999999999998 27.01 145-149 26.200000000000003 23.385 23.674999999999997 26.740000000000002 150 26.224999999999998 23.7 23.3 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 2.5 26 2.5 27 2.5 28 6.0 29 7.5 30 11.5 31 17.0 32 14.5 33 15.5 34 22.5 35 41.0 36 51.0 37 58.0 38 81.0 39 95.5 40 109.0 41 123.5 42 127.0 43 155.0 44 203.5 45 204.5 46 166.0 47 141.0 48 152.0 49 164.5 50 163.0 51 162.0 52 163.5 53 182.5 54 176.5 55 159.0 56 154.0 57 138.0 58 119.5 59 100.0 60 83.5 61 64.5 62 51.5 63 46.5 64 37.0 65 32.5 66 34.0 67 26.5 68 22.5 69 23.5 70 17.5 71 13.5 72 10.5 73 7.0 74 4.0 75 3.5 76 4.5 77 4.5 78 3.0 79 1.0 80 1.0 81 1.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 100.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6712479384277 83.375 2 7.0643210555250135 12.85 3 1.017042330951072 2.775 4 0.21990104452996154 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027487630566245192 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NTTTGTGTTTGAGTCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.1625 0.0 0.0 0.0 0.0 136-137 0.7749999999999999 0.0 0.0 0.0 0.0 138 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTGT 35 2.4856672E-7 102.14285 2 TTGTGTT 50 2.0779444E-6 71.5 3 TGTGTTT 65 9.864467E-6 55.000004 4 GTGTTTG 70 1.5302952E-5 51.071426 5 TGTTTGA 70 1.5302952E-5 51.071426 6 CGGAAGA 35 0.0038330643 20.42857 140-144 >>END_MODULE Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425018 spots for SRR18274413.sra Written 1425018 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra Read 1425014 spots for SRR18274413.sra Written 1425014 spots for SRR18274413.sra SRR ids: ['SRR18274413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rks2x4v_ SRR18274413.sra spots: 28500284 blocks: [[1, 1425014], [1425015, 2850028], [2850029, 4275042], [4275043, 5700056], [5700057, 7125070], [7125071, 8550084], [8550085, 9975098], [9975099, 11400112], [11400113, 12825126], [12825127, 14250140], [14250141, 15675154], [15675155, 17100168], [17100169, 18525182], [18525183, 19950196], [19950197, 21375210], [21375211, 22800224], [22800225, 24225238], [24225239, 25650252], [25650253, 27075266], [27075267, 28500284]] SRR18274413 file size 10469827 SRR18274413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18274413 SRR18274413_1.fastq SRR18274413_2.fastq Input file: SRR18274413_1.fastq Paired file: SRR18274413_2.fastq trimmed: SRR18274413-trimmed-pair1.fastq, SRR18274413-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:55:27 2025 >> started Tue Feb 11 04:03:59 2025 >> done (512.439s) 28500284 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 28500279 (100.00%) read pairs available; of these: 5028433 (17.64%) trimmed read pairs available after processing 23471846 (82.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 6 0.00% 27 2 0.00% 28 2 0.00% 29 1 0.00% 30 6 0.00% 31 2 0.00% 32 4 0.00% 33 2 0.00% 34 3 0.00% 35 1 0.00% 36 6 0.00% 37 5 0.00% 38 7 0.00% 39 5 0.00% 40 7 0.00% 41 8 0.00% 42 6 0.00% 43 10 0.00% 44 5 0.00% 45 6 0.00% 46 5 0.00% 47 14 0.00% 48 13 0.00% 49 15 0.00% 50 12 0.00% 51 13 0.00% 52 8 0.00% 53 14 0.00% 54 12 0.00% 55 23 0.00% 56 16 0.00% 57 20 0.00% 58 16 0.00% 59 25 0.00% 60 14 0.00% 61 20 0.00% 62 22 0.00% 63 26 0.00% 64 22 0.00% 65 17 0.00% 66 19 0.00% 67 22 0.00% 68 23 0.00% 69 29 0.00% 70 18 0.00% 71 24 0.00% 72 19 0.00% 73 23 0.00% 74 22 0.00% 75 20 0.00% 76 30 0.00% 77 23 0.00% 78 31 0.00% 79 17 0.00% 80 20 0.00% 81 32 0.00% 82 21 0.00% 83 37 0.00% 84 28 0.00% 85 32 0.00% 86 33 0.00% 87 30 0.00% 88 37 0.00% 89 28 0.00% 90 37 0.00% 91 36 0.00% 92 21 0.00% 93 37 0.00% 94 37 0.00% 95 21 0.00% 96 41 0.00% 97 47 0.00% 98 41 0.00% 99 55 0.00% 100 41 0.00% 101 47 0.00% 102 57 0.00% 103 64 0.00% 104 55 0.00% 105 52 0.00% 106 68 0.00% 107 83 0.00% 108 74 0.00% 109 80 0.00% 110 71 0.00% 111 94 0.00% 112 108 0.00% 113 118 0.00% 114 153 0.00% 115 147 0.00% 116 121 0.00% 117 161 0.00% 118 178 0.00% 119 213 0.00% 120 220 0.00% 121 290 0.00% 122 272 0.00% 123 352 0.00% 124 347 0.00% 125 386 0.00% 126 415 0.00% 127 476 0.00% 128 482 0.00% 129 491 0.00% 130 473 0.00% 131 504 0.00% 132 522 0.00% 133 4377 0.02% 134 102672 0.36% 135 106296 0.37% 136 110552 0.39% 137 116555 0.41% 138 118311 0.42% 139 124471 0.44% 140 126639 0.44% 141 131878 0.46% 142 134296 0.47% 143 139380 0.49% 144 140519 0.49% 145 143376 0.50% 146 145289 0.51% 147 162328 0.57% 148 297202 1.04% 149 2915656 10.23% 150 23471846 82.36% 28500279 reads passed initial QC criterion=sequence-density sequence-density=6.07 sequence-density-rank=1 fanout-score=1.02 fanout-score-rank=46 prefix-density=2.45 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.62 sequence-density-rank=23 fanout-score=45.91 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=24.3 sequence=CTCAAACACAAA criterion=sequence-density sequence-density=6.28 sequence-density-rank=1 fanout-score=1.17 fanout-score-rank=45 prefix-density=3.60 prefix-fanout=1.2 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=41 fanout-score=37.65 fanout-score-rank=1 prefix-density=3.21 prefix-fanout=1.1 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATGGGTTACTTCAGCGCCGTAGCGCCTGGTACTCGAACATTGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAACAGGGACACCGTGCGTCCTTGAACCGATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTAT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR18274413 SRR18274413_1.fastq SRR18274413_2.fastq Input file: SRR18274413_1.fastq Paired file: SRR18274413_2.fastq trimmed: SRR18274413-trimmed-pair1.fastq, SRR18274413-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:14:01 2025 >> started Tue Feb 11 04:20:35 2025 >> done (394.352s) 20357342 read pairs processed; of these: 311896 ( 1.53%) short read pairs filtered out after trimming by size control 156823 ( 0.77%) empty read pairs filtered out after trimming by size control 19888623 (97.70%) read pairs available; of these: 19028 ( 0.10%) trimmed read pairs available after processing 19869595 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 6 0.00% 31 1 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 3 0.00% 37 4 0.00% 38 5 0.00% 39 4 0.00% 40 6 0.00% 41 6 0.00% 42 4 0.00% 43 8 0.00% 44 4 0.00% 45 4 0.00% 46 2 0.00% 47 11 0.00% 48 8 0.00% 49 8 0.00% 50 7 0.00% 51 11 0.00% 52 7 0.00% 53 11 0.00% 54 9 0.00% 55 19 0.00% 56 13 0.00% 57 15 0.00% 58 14 0.00% 59 20 0.00% 60 10 0.00% 61 14 0.00% 62 12 0.00% 63 21 0.00% 64 15 0.00% 65 12 0.00% 66 15 0.00% 67 14 0.00% 68 16 0.00% 69 20 0.00% 70 13 0.00% 71 14 0.00% 72 16 0.00% 73 13 0.00% 74 18 0.00% 75 14 0.00% 76 20 0.00% 77 18 0.00% 78 25 0.00% 79 7 0.00% 80 12 0.00% 81 17 0.00% 82 18 0.00% 83 23 0.00% 84 21 0.00% 85 20 0.00% 86 19 0.00% 87 23 0.00% 88 26 0.00% 89 20 0.00% 90 28 0.00% 91 28 0.00% 92 13 0.00% 93 19 0.00% 94 26 0.00% 95 18 0.00% 96 31 0.00% 97 37 0.00% 98 27 0.00% 99 34 0.00% 100 29 0.00% 101 30 0.00% 102 46 0.00% 103 44 0.00% 104 41 0.00% 105 33 0.00% 106 50 0.00% 107 68 0.00% 108 55 0.00% 109 58 0.00% 110 53 0.00% 111 66 0.00% 112 71 0.00% 113 76 0.00% 114 100 0.00% 115 100 0.00% 116 82 0.00% 117 112 0.00% 118 124 0.00% 119 161 0.00% 120 149 0.00% 121 189 0.00% 122 206 0.00% 123 248 0.00% 124 256 0.00% 125 267 0.00% 126 286 0.00% 127 325 0.00% 128 338 0.00% 129 337 0.00% 130 320 0.00% 131 344 0.00% 132 456 0.00% 133 3180 0.02% 134 71775 0.36% 135 74384 0.37% 136 77138 0.39% 137 81256 0.41% 138 82613 0.42% 139 85921 0.43% 140 88035 0.44% 141 91345 0.46% 142 93717 0.47% 143 96920 0.49% 144 97518 0.49% 145 100028 0.50% 146 106087 0.53% 147 117833 0.59% 148 212892 1.07% 149 2021249 10.16% 150 16380614 82.36% criterion=sequence-density sequence-density=4.77 sequence-density-rank=1 fanout-score=1.02 fanout-score-rank=46 prefix-density=2.22 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.52 sequence-density-rank=26 fanout-score=46.54 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=24.3 sequence=CTCAAACACAAA criterion=sequence-density sequence-density=4.67 sequence-density-rank=1 fanout-score=1.17 fanout-score-rank=44 prefix-density=3.22 prefix-fanout=1.2 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=39 fanout-score=34.79 fanout-score-rank=1 prefix-density=2.91 prefix-fanout=1.1 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATGGGTTACTTCAGCGCCGTAGCGCCTGGTACTCGAACATTGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAACAGGGACACCGTGCGTCCTTGAACCGATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTAT SRR18274413 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:45:45 Started mapping on | Feb 11 04:46:00 Finished on | Feb 11 06:02:23 Mapping speed, Million of reads per hour | 22.02 Number of input reads | 28031560 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12017977 Uniquely mapped reads % | 42.87% Average mapped length | 279.27 Number of splices: Total | 4409946 Number of splices: Annotated (sjdb) | 4202405 Number of splices: GT/AG | 4265313 Number of splices: GC/AG | 61794 Number of splices: AT/AC | 7844 Number of splices: Non-canonical | 74995 Mismatch rate per base, % | 1.47% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.04% Insertion average length | 4.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1239748 % of reads mapped to multiple loci | 4.42% Number of reads mapped to too many loci | 6632931 % of reads mapped to too many loci | 23.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.44% % of reads unmapped: other | 14.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14773835 14773835 14773835 N_multimapping 1239748 1239748 1239748 N_noFeature 5075958 8419458 8481179 N_ambiguous 272530 40865 38714 UnstrandedReadsAssigned:6669489 PositiveStrandReadsAssigned:3557654 NegativeStrandReadsAssigned:3498084 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR18274413 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18274413-trimmed-pair1.fastq SRR18274413-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,031,560 reads, 18,707,150 reads pseudoaligned [quant] estimated average fragment length: 198.736 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR18274413.ke.tsv 34699 SRR18274413.se.tsv 87100 total ==> SRR18274413.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.26 329 3.10733 Potri.005G024800.1.v4.1 1035 837.264 61 1.25254 Potri.004G059700.1.v4.1 961 763.27 50 1.1262 Potri.007G009000.2.v4.1 1416 1218.26 0 0 Potri.003G141000.2.v4.1 2943 2745.26 626 3.92027 Potri.016G087400.1.v4.1 270 88.6136 387.628 75.204 Potri.015G069301.1.v4.1 564 366.391 0 0 Potri.010G195200.1.v4.1 1773 1575.26 0 0 Potri.012G127500.1.v4.1 977 779.264 1190 26.2536 ==> SRR18274413.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 34 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR18274413 completed mapping pipeline successfully