Starting /dee2/code/volunteer_pipeline.sh SRR18274414 current disk space = 3056962101248 free memory = 1059584416 SRR18274414 SRAfilesize c447118e6766bc8621468b306dc8b096 SRR18274414.sra SRR18274414.sra file validated SRR18274414 is paired end SRR18274414 is conventional basespace SRR18274414 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274414_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 16.64875 2.0 2.0 32.0 2.0 32.0 2 31.3825 32.0 32.0 32.0 32.0 32.0 3 33.1 32.0 32.0 37.0 32.0 37.0 4 35.37375 37.0 37.0 37.0 32.0 37.0 5 36.0375 37.0 37.0 37.0 37.0 37.0 6 38.19425 41.0 37.0 41.0 32.0 41.0 7 38.268 41.0 37.0 41.0 32.0 41.0 8 37.338 41.0 37.0 41.0 27.0 41.0 9 37.53325 41.0 37.0 41.0 27.0 41.0 10-14 37.8952 41.0 37.0 41.0 30.0 41.0 15-19 37.95845 41.0 37.0 41.0 28.0 41.0 20-24 37.7451 41.0 37.0 41.0 27.0 41.0 25-29 37.644600000000004 41.0 37.0 41.0 27.0 41.0 30-34 37.7949 41.0 37.0 41.0 28.0 41.0 35-39 37.933749999999996 41.0 37.0 41.0 30.0 41.0 40-44 37.907050000000005 41.0 37.0 41.0 31.0 41.0 45-49 37.813 41.0 37.0 41.0 29.0 41.0 50-54 37.785199999999996 41.0 37.0 41.0 28.0 41.0 55-59 37.189949999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.315 41.0 37.0 41.0 27.0 41.0 65-69 37.402049999999996 41.0 37.0 41.0 28.0 41.0 70-74 36.976299999999995 41.0 37.0 41.0 27.0 41.0 75-79 37.155950000000004 41.0 36.0 41.0 27.0 41.0 80-84 37.82625 41.0 37.0 41.0 31.0 41.0 85-89 37.600049999999996 41.0 37.0 41.0 30.0 41.0 90-94 37.713899999999995 41.0 37.0 41.0 30.0 41.0 95-99 37.6116 41.0 37.0 41.0 29.0 41.0 100-104 37.08775 41.0 37.0 41.0 26.0 41.0 105-109 36.679 41.0 37.0 41.0 26.0 41.0 110-114 36.5665 41.0 37.0 41.0 26.0 41.0 115-119 36.3472 41.0 37.0 41.0 23.0 41.0 120-124 36.437149999999995 41.0 37.0 41.0 26.0 41.0 125-129 35.80885 41.0 33.0 41.0 22.0 41.0 130-134 35.367599999999996 41.0 32.0 41.0 22.0 41.0 135-139 34.92115 39.4 31.0 41.0 22.0 41.0 140-144 34.018449999999994 37.0 30.0 41.0 22.0 41.0 145-149 34.127849999999995 37.0 30.0 41.0 22.0 41.0 150 34.0235 37.0 27.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality fail #Tile Base Mean 1101 1 -14.53846153846154 1101 2 -0.04534083802376543 1101 3 -1.3746091307066877 1101 4 -0.11632270168855285 1101 5 0.03721075672295626 1101 6 -0.44540337711069355 1101 7 -0.5771106941838653 1101 8 0.33677298311445014 1101 9 0.21232020012507746 1101 10-14 0.18784240150093723 1101 15-19 0.24046278924328135 1101 20-24 -0.07181988742964052 1101 25-29 0.14405253283301533 1101 30-34 -0.19185741088179498 1101 35-39 0.1585115697310826 1101 40-44 -0.15877423389618173 1101 45-49 -0.056585365853649705 1101 50-54 -0.3261038148842985 1101 55-59 -0.43807379612258046 1101 60-64 -0.22015009380863404 1101 65-69 -0.3378736710444059 1101 70-74 0.14944340212633023 1101 75-79 0.21719824890556083 1101 80-84 0.15113195747342445 1101 85-89 -0.36863039399624853 1101 90-94 -0.4224765478424004 1101 95-99 -0.06762976860537862 1101 100-104 -0.6382363977485923 1101 105-109 -0.5592995622263928 1101 110-114 -0.45651031894934846 1101 115-119 -0.07633520950594175 1101 120-124 -0.08667917448405404 1101 125-129 -0.15040650406503886 1101 130-134 -0.20321450906816807 1101 135-139 -0.37647279549717894 1101 140-144 -0.16240150093808836 1101 145-149 -0.1924077548467764 1101 150 -0.4170731707317046 1102 1 14.538461538461537 1102 2 0.045340838023761876 1102 3 1.3746091307066948 1102 4 0.11632270168855285 1102 5 -0.037210756722949156 1102 6 0.44540337711069355 1102 7 0.5771106941838653 1102 8 -0.33677298311444304 1102 9 -0.21232020012508457 1102 10-14 -0.18784240150093723 1102 15-19 -0.24046278924328135 1102 20-24 0.07181988742964762 1102 25-29 -0.14405253283302244 1102 30-34 0.19185741088180208 1102 35-39 -0.1585115697310826 1102 40-44 0.15877423389618883 1102 45-49 0.05658536585365681 1102 50-54 0.3261038148842985 1102 55-59 0.43807379612258046 1102 60-64 0.22015009380863404 1102 65-69 0.3378736710443988 1102 70-74 -0.14944340212633023 1102 75-79 -0.21719824890556794 1102 80-84 -0.15113195747341734 1102 85-89 0.36863039399624853 1102 90-94 0.4224765478424004 1102 95-99 0.06762976860537862 1102 100-104 0.6382363977485923 1102 105-109 0.5592995622263928 1102 110-114 0.45651031894934846 1102 115-119 0.07633520950594175 1102 120-124 0.08667917448405404 1102 125-129 0.15040650406503886 1102 130-134 0.20321450906816807 1102 135-139 0.37647279549718604 1102 140-144 0.16240150093808836 1102 145-149 0.19240775484678352 1102 150 0.4170731707317117 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 5.0 25 7.0 26 4.0 27 13.0 28 15.0 29 22.0 30 31.0 31 57.0 32 93.0 33 157.0 34 268.0 35 438.0 36 647.0 37 981.0 38 916.0 39 335.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.209104552276138 22.611305652826413 18.659329664832416 40.52026013006503 2 21.975 20.474999999999998 38.4 19.15 3 20.68534267133567 21.310655327663834 34.54227113556778 23.461730865432717 4 20.575 19.15 37.8 22.475 5 32.324999999999996 18.975 28.125 20.575 6 22.35 20.3 35.475 21.875 7 32.875 21.825 25.2 20.1 8 21.475 21.575 36.275 20.674999999999997 9 25.7 19.625 33.35 21.325 10-14 27.04 23.919999999999998 24.525 24.515 15-19 27.055 23.31 22.830000000000002 26.805 20-24 25.765 23.45 24.495 26.290000000000003 25-29 25.259999999999998 23.585 25.040000000000003 26.115 30-34 26.415 24.035 24.11 25.44 35-39 25.665 24.555 23.955000000000002 25.825 40-44 26.46 24.315 23.535 25.69 45-49 26.169999999999998 24.135 23.575 26.119999999999997 50-54 25.779999999999998 24.37 23.47 26.38 55-59 25.385 23.89 24.404999999999998 26.32 60-64 25.47 23.69 24.41 26.43 65-69 25.81 24.5 23.87 25.82 70-74 25.724999999999998 24.565 24.37 25.34 75-79 24.81 24.425 25.145 25.619999999999997 80-84 25.679999999999996 24.63 23.865 25.825 85-89 25.605 24.875 24.12 25.4 90-94 26.21 24.905 23.56 25.324999999999996 95-99 25.955000000000002 24.355 24.015 25.674999999999997 100-104 26.284999999999997 23.615 24.0 26.1 105-109 25.855 23.669999999999998 24.9 25.575 110-114 25.52 24.315 25.185000000000002 24.98 115-119 25.919999999999998 24.295 24.395 25.39 120-124 26.07 24.54 23.105 26.284999999999997 125-129 26.025 24.47 23.815 25.69 130-134 24.92 25.505 24.349999999999998 25.224999999999998 135-139 25.19 26.125 23.075000000000003 25.61 140-144 26.090000000000003 27.1 22.495 24.315 145-149 27.85 26.939999999999998 20.885 24.325 150 27.950000000000003 26.75 19.75 25.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 0.5 27 1.0 28 2.0 29 2.5 30 6.5 31 7.0 32 3.0 33 4.0 34 12.0 35 26.0 36 32.5 37 34.5 38 47.0 39 58.5 40 70.0 41 90.0 42 115.5 43 149.5 44 192.5 45 206.0 46 177.0 47 152.5 48 154.5 49 165.5 50 164.5 51 173.0 52 180.0 53 180.0 54 178.5 55 176.0 56 177.0 57 160.5 58 135.5 59 115.5 60 86.0 61 69.5 62 73.5 63 62.0 64 42.0 65 31.0 66 34.5 67 39.0 68 41.0 69 37.5 70 27.0 71 23.0 72 18.5 73 10.0 74 7.5 75 7.0 76 11.0 77 11.5 78 5.0 79 3.5 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 50.025 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.85 #Duplication Level Percentage of deduplicated Percentage of total 1 89.44850872256612 79.475 2 8.835115362971301 15.7 3 1.4631401238041641 3.9 4 0.22509848058525606 0.8 5 0.028137310073157007 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.4125 0.0 0.0 0.0 0.0 136-137 2.225 0.0 0.0 0.0 0.0 138 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTTG 15 1.1267617E-5 255.22221 1 CTTTGTG 40 5.6170335E-4 95.708336 1 ACTTTGT 25 9.06517E-4 86.1375 2 TTTGTGT 35 3.188973E-5 82.03572 2 GTGTTTG 50 1.8667046E-4 57.425 5 TTGTGTT 50 1.8667046E-4 57.425 3 TGTGTTT 50 1.8667046E-4 57.425 4 TTTGAGG 40 0.0058474327 53.835938 8 GTTTGAG 70 1.495124E-5 51.272324 7 TGTTTGA 65 6.818814E-4 44.173077 6 GAAGAGC 20 0.0062311976 28.7125 140-144 GGAAGAG 25 5.276611E-4 28.7125 140-144 AGATCGG 30 0.0015300678 23.927084 135-139 >>END_MODULE SRR18274414 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274414_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 15.6875 2.0 2.0 32.0 2.0 32.0 2 30.2225 32.0 32.0 32.0 27.0 32.0 3 28.76875 27.0 27.0 37.0 27.0 37.0 4 32.9625 37.0 27.0 37.0 27.0 37.0 5 34.39375 37.0 37.0 37.0 27.0 37.0 6 36.653 41.0 37.0 41.0 27.0 41.0 7 35.51825 37.0 32.0 41.0 22.0 41.0 8 36.372 41.0 37.0 41.0 27.0 41.0 9 35.97 41.0 37.0 41.0 27.0 41.0 10-14 35.0282 37.0 32.0 41.0 22.0 41.0 15-19 35.89705 38.6 34.0 41.0 24.0 41.0 20-24 35.3639 37.0 34.0 41.0 24.0 41.0 25-29 35.17385 37.8 33.0 41.0 23.0 41.0 30-34 35.83370000000001 40.2 34.0 41.0 25.0 41.0 35-39 34.942099999999996 38.6 32.0 41.0 24.0 41.0 40-44 35.61355 37.8 32.0 41.0 25.0 41.0 45-49 35.21855 37.0 32.0 41.0 22.0 41.0 50-54 35.2721 37.0 32.0 41.0 22.0 41.0 55-59 34.84185 37.0 32.0 41.0 22.0 41.0 60-64 35.05225 37.0 32.0 41.0 22.0 41.0 65-69 34.56385 37.0 32.0 41.0 22.0 41.0 70-74 34.01755000000001 37.0 32.0 41.0 22.0 41.0 75-79 33.096199999999996 37.0 29.0 40.2 22.0 41.0 80-84 33.36605 37.0 30.0 41.0 20.0 41.0 85-89 33.16705 37.0 27.0 41.0 22.0 41.0 90-94 32.7167 37.0 27.0 41.0 14.0 41.0 95-99 32.3645 37.0 26.0 41.0 12.0 41.0 100-104 31.506800000000005 33.0 26.0 41.0 12.0 41.0 105-109 30.611649999999997 32.0 22.0 41.0 12.0 41.0 110-114 30.096750000000004 32.0 22.0 40.2 12.0 41.0 115-119 28.929899999999996 32.0 22.0 37.0 12.0 41.0 120-124 28.652749999999997 31.0 22.0 37.0 12.0 41.0 125-129 28.2717 28.0 22.0 37.0 12.0 41.0 130-134 28.190049999999996 29.0 22.0 37.0 12.0 41.0 135-139 27.2849 27.0 22.0 37.0 12.0 41.0 140-144 26.7138 27.0 20.0 37.0 12.0 41.0 145-149 26.379399999999997 27.0 18.0 37.0 12.0 41.0 150 25.6485 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality fail #Tile Base Mean 1101 1 -13.423076923076923 1101 2 0.12132582864290242 1101 3 -2.7851782363977513 1101 4 -0.6138211382113781 1101 5 0.43652282676672627 1101 6 0.0983739837398403 1101 7 0.24083802376485153 1101 8 -0.45784865540962727 1101 9 -0.3102564102564145 1101 10-14 0.4336710444027503 1101 15-19 0.09472170106315758 1101 20-24 0.20276422764227675 1101 25-29 0.5489430894308924 1101 30-34 0.558198874296437 1101 35-39 0.43661038148842835 1101 40-44 0.3809255784865542 1101 45-49 -0.018511569731082034 1101 50-54 0.39053158223890705 1101 55-59 -0.38031269543465385 1101 60-64 0.2661913696060054 1101 65-69 0.013320825515954482 1101 70-74 -0.2857035647279531 1101 75-79 -0.30072545340838275 1101 80-84 -0.5212757973733559 1101 85-89 -0.00595372107567016 1101 90-94 -0.3317573483427054 1101 95-99 -0.5161475922451544 1101 100-104 -0.14265165728579987 1101 105-109 -0.36866791744840555 1101 110-114 -0.345265791119445 1101 115-119 -0.5735459662288953 1101 120-124 -0.6771232020012512 1101 125-129 -0.35677298311444616 1101 130-134 -0.5534709193245781 1101 135-139 -0.8412132582864302 1101 140-144 -0.7343714821763605 1101 145-149 -0.28348968105066064 1101 150 0.1976235146966836 1102 1 13.423076923076923 1102 2 -0.12132582864290242 1102 3 2.7851782363977478 1102 4 0.6138211382113852 1102 5 -0.4365228267667334 1102 6 -0.09837398373983319 1102 7 -0.24083802376485153 1102 8 0.4578486554096344 1102 9 0.3102564102564074 1102 10-14 -0.4336710444027503 1102 15-19 -0.09472170106315758 1102 20-24 -0.20276422764228386 1102 25-29 -0.5489430894308924 1102 30-34 -0.558198874296437 1102 35-39 -0.43661038148842835 1102 40-44 -0.3809255784865542 1102 45-49 0.01851156973108914 1102 50-54 -0.39053158223889994 1102 55-59 0.38031269543464674 1102 60-64 -0.2661913696060054 1102 65-69 -0.013320825515947377 1102 70-74 0.2857035647279531 1102 75-79 0.30072545340837564 1102 80-84 0.521275797373363 1102 85-89 0.00595372107567016 1102 90-94 0.33175734834271253 1102 95-99 0.5161475922451473 1102 100-104 0.14265165728580342 1102 105-109 0.36866791744840555 1102 110-114 0.34526579111944855 1102 115-119 0.5735459662288953 1102 120-124 0.6771232020012476 1102 125-129 0.3567729831144426 1102 130-134 0.5534709193245781 1102 135-139 0.8412132582864302 1102 140-144 0.7343714821763605 1102 145-149 0.2834896810506571 1102 150 -0.19762351469668715 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 14.0 23 28.0 24 48.0 25 70.0 26 83.0 27 134.0 28 153.0 29 201.0 30 298.0 31 431.0 32 577.0 33 689.0 34 633.0 35 440.0 36 176.0 37 22.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.557278639319659 23.56178089044522 23.461730865432717 38.419209604802404 2 19.5 20.724999999999998 41.85 17.925 3 23.45 20.599999999999998 33.175 22.775000000000002 4 20.575 18.35 39.775 21.3 5 35.6 18.05 28.000000000000004 18.35 6 20.974999999999998 19.15 40.5 19.375 7 31.075000000000003 20.4 29.299999999999997 19.225 8 20.225 18.325 42.575 18.875 9 27.85 19.1 33.4 19.650000000000002 10-14 26.965 23.23 26.415 23.39 15-19 28.000000000000004 22.295 23.724999999999998 25.979999999999997 20-24 25.465 23.135 25.85 25.55 25-29 24.77 23.5 25.669999999999998 26.06 30-34 26.419999999999998 23.674999999999997 24.125 25.779999999999998 35-39 25.759999999999998 24.54 24.39 25.31 40-44 26.26 24.54 23.74 25.46 45-49 25.555 24.05 24.325 26.07 50-54 24.975 24.875 24.135 26.015 55-59 25.679999999999996 23.77 24.415 26.135 60-64 25.22 22.79 25.285000000000004 26.705000000000002 65-69 25.45 24.12 24.145 26.284999999999997 70-74 25.430000000000003 23.72 24.834999999999997 26.015 75-79 25.330000000000002 23.585 25.1 25.985000000000003 80-84 25.085 23.72 24.6 26.595000000000002 85-89 25.979999999999997 24.525 23.275000000000002 26.22 90-94 25.790000000000003 24.385 23.835 25.990000000000002 95-99 25.619999999999997 23.505000000000003 23.82 27.055 100-104 26.334999999999997 22.345000000000002 23.82 27.500000000000004 105-109 25.180000000000003 22.165000000000003 25.224999999999998 27.43 110-114 24.89 22.85 25.430000000000003 26.83 115-119 25.135 23.015 24.635 27.215 120-124 25.72 23.169999999999998 23.82 27.29 125-129 26.884999999999998 22.45 23.494999999999997 27.169999999999998 130-134 26.105 22.145 24.54 27.21 135-139 25.72 23.47 23.22 27.589999999999996 140-144 27.24 23.68 22.095000000000002 26.985 145-149 28.33 23.544999999999998 21.16 26.965 150 27.200000000000003 21.15 22.400000000000002 29.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.0 28 2.0 29 3.5 30 5.5 31 6.5 32 4.5 33 7.5 34 17.0 35 20.5 36 27.0 37 40.5 38 42.5 39 51.0 40 78.0 41 96.5 42 114.5 43 155.0 44 195.0 45 194.5 46 180.5 47 161.0 48 151.0 49 169.5 50 162.5 51 169.5 52 202.5 53 197.5 54 174.5 55 165.5 56 155.5 57 143.5 58 129.5 59 126.0 60 111.0 61 83.0 62 67.0 63 51.5 64 35.5 65 32.0 66 37.0 67 40.0 68 40.0 69 29.0 70 25.0 71 24.0 72 14.0 73 8.0 74 9.0 75 6.5 76 5.5 77 6.5 78 5.0 79 4.5 80 2.5 81 0.5 82 0.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 50.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.71240395170143 83.55 2 7.189901207464325 13.100000000000001 3 0.8781558726673985 2.4 4 0.13721185510428102 0.5 5 0.054884742041712405 0.25 6 0.0 0.0 7 0.0 0.0 8 0.027442371020856202 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGACGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGC 8 0.2 No Hit CTTTGTGTTTGATGGGGCGGCACATCTGTTAAAAGATAACGCAGGTGTCC 5 0.125 No Hit NTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138 2.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGGG 10 0.0070373793 143.5625 6 CTTTGTG 55 1.562606E-5 92.808075 1 TTTGTGT 65 1.1896191E-9 77.30289 2 TTGTGTT 75 3.6980055E-9 66.995834 3 TGTGTTT 95 2.3967004E-8 53.730995 1 GTGTTTG 100 3.592686E-8 50.246876 5 TTTGAGG 45 0.009317066 47.854168 5 TGTTTGA 110 7.615927E-8 45.678978 6 GGAAGAG 25 5.276611E-4 28.7125 140-144 AGATCGG 30 0.0015300678 23.927084 135-139 >>END_MODULE Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145436 spots for SRR18274414.sra Written 1145436 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra Read 1145435 spots for SRR18274414.sra Written 1145435 spots for SRR18274414.sra SRR ids: ['SRR18274414.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c2gxmsfg SRR18274414.sra spots: 22908701 blocks: [[1, 1145435], [1145436, 2290870], [2290871, 3436305], [3436306, 4581740], [4581741, 5727175], [5727176, 6872610], [6872611, 8018045], [8018046, 9163480], [9163481, 10308915], [10308916, 11454350], [11454351, 12599785], [12599786, 13745220], [13745221, 14890655], [14890656, 16036090], [16036091, 17181525], [17181526, 18326960], [18326961, 19472395], [19472396, 20617830], [20617831, 21763265], [21763266, 22908701]] SRR18274414 file size 8413515 SRR18274414 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18274414 SRR18274414_1.fastq SRR18274414_2.fastq Input file: SRR18274414_1.fastq Paired file: SRR18274414_2.fastq trimmed: SRR18274414-trimmed-pair1.fastq, SRR18274414-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:05:03 2025 >> started Tue Feb 11 03:11:15 2025 >> done (372.506s) 22908701 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 22908699 (100.00%) read pairs available; of these: 5492661 (23.98%) trimmed read pairs available after processing 17416038 (76.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 3 0.00% 30 3 0.00% 31 5 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 3 0.00% 36 1 0.00% 37 8 0.00% 38 9 0.00% 39 5 0.00% 40 7 0.00% 41 10 0.00% 42 7 0.00% 43 8 0.00% 44 6 0.00% 45 3 0.00% 46 20 0.00% 47 15 0.00% 48 20 0.00% 49 16 0.00% 50 13 0.00% 51 18 0.00% 52 14 0.00% 53 22 0.00% 54 19 0.00% 55 13 0.00% 56 19 0.00% 57 14 0.00% 58 27 0.00% 59 23 0.00% 60 27 0.00% 61 33 0.00% 62 22 0.00% 63 34 0.00% 64 22 0.00% 65 21 0.00% 66 31 0.00% 67 27 0.00% 68 42 0.00% 69 32 0.00% 70 28 0.00% 71 28 0.00% 72 40 0.00% 73 26 0.00% 74 21 0.00% 75 22 0.00% 76 28 0.00% 77 39 0.00% 78 21 0.00% 79 29 0.00% 80 21 0.00% 81 33 0.00% 82 34 0.00% 83 29 0.00% 84 37 0.00% 85 27 0.00% 86 42 0.00% 87 46 0.00% 88 37 0.00% 89 32 0.00% 90 42 0.00% 91 54 0.00% 92 52 0.00% 93 52 0.00% 94 53 0.00% 95 62 0.00% 96 61 0.00% 97 81 0.00% 98 113 0.00% 99 110 0.00% 100 93 0.00% 101 102 0.00% 102 104 0.00% 103 132 0.00% 104 145 0.00% 105 173 0.00% 106 172 0.00% 107 165 0.00% 108 199 0.00% 109 191 0.00% 110 186 0.00% 111 207 0.00% 112 233 0.00% 113 250 0.00% 114 301 0.00% 115 328 0.00% 116 358 0.00% 117 370 0.00% 118 408 0.00% 119 499 0.00% 120 511 0.00% 121 608 0.00% 122 601 0.00% 123 728 0.00% 124 851 0.00% 125 872 0.00% 126 928 0.00% 127 961 0.00% 128 896 0.00% 129 1039 0.00% 130 978 0.00% 131 904 0.00% 132 985 0.00% 133 8134 0.04% 134 179737 0.78% 135 184979 0.81% 136 189029 0.83% 137 194732 0.85% 138 196639 0.86% 139 200788 0.88% 140 200027 0.87% 141 205083 0.90% 142 204428 0.89% 143 211208 0.92% 144 207099 0.90% 145 211415 0.92% 146 211782 0.92% 147 226735 0.99% 148 320431 1.40% 149 2323004 10.14% 150 17416038 76.02% 22908699 reads passed initial QC criterion=sequence-density sequence-density=7.21 sequence-density-rank=1 fanout-score=1.01 fanout-score-rank=42 prefix-density=2.55 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.81 sequence-density-rank=18 fanout-score=109.99 fanout-score-rank=1 prefix-density=3.47 prefix-fanout=25.5 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=7.99 sequence-density-rank=1 fanout-score=1.13 fanout-score-rank=43 prefix-density=4.25 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=42 fanout-score=79.86 fanout-score-rank=1 prefix-density=5.18 prefix-fanout=1.0 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATGGGTTACTTCAGCGCCGTAGCGCCTGGTACTCGAACATTGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAACAGGGACACCGTGCGTCCTTGAACCGATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR18274414 SRR18274414_1.fastq SRR18274414_2.fastq Input file: SRR18274414_1.fastq Paired file: SRR18274414_2.fastq trimmed: SRR18274414-trimmed-pair1.fastq, SRR18274414-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:19:28 2025 >> started Tue Feb 11 03:23:50 2025 >> done (262.500s) 17181524 read pairs processed; of these: 387761 ( 2.26%) short read pairs filtered out after trimming by size control 144667 ( 0.84%) empty read pairs filtered out after trimming by size control 16649096 (96.90%) read pairs available; of these: 20043 ( 0.12%) trimmed read pairs available after processing 16629053 (99.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 3 0.00% 30 2 0.00% 31 4 0.00% 32 1 0.00% 33 1 0.00% 34 1 0.00% 35 2 0.00% 36 1 0.00% 37 6 0.00% 38 8 0.00% 39 4 0.00% 40 5 0.00% 41 7 0.00% 42 5 0.00% 43 5 0.00% 44 3 0.00% 45 2 0.00% 46 15 0.00% 47 8 0.00% 48 15 0.00% 49 12 0.00% 50 10 0.00% 51 13 0.00% 52 8 0.00% 53 14 0.00% 54 15 0.00% 55 11 0.00% 56 15 0.00% 57 12 0.00% 58 24 0.00% 59 20 0.00% 60 21 0.00% 61 24 0.00% 62 14 0.00% 63 22 0.00% 64 14 0.00% 65 17 0.00% 66 24 0.00% 67 23 0.00% 68 32 0.00% 69 24 0.00% 70 23 0.00% 71 21 0.00% 72 30 0.00% 73 18 0.00% 74 13 0.00% 75 19 0.00% 76 24 0.00% 77 32 0.00% 78 17 0.00% 79 23 0.00% 80 16 0.00% 81 27 0.00% 82 21 0.00% 83 24 0.00% 84 24 0.00% 85 23 0.00% 86 31 0.00% 87 36 0.00% 88 26 0.00% 89 24 0.00% 90 33 0.00% 91 33 0.00% 92 37 0.00% 93 37 0.00% 94 37 0.00% 95 39 0.00% 96 45 0.00% 97 63 0.00% 98 75 0.00% 99 82 0.00% 100 66 0.00% 101 69 0.00% 102 72 0.00% 103 102 0.00% 104 110 0.00% 105 121 0.00% 106 128 0.00% 107 115 0.00% 108 143 0.00% 109 143 0.00% 110 133 0.00% 111 156 0.00% 112 175 0.00% 113 192 0.00% 114 209 0.00% 115 225 0.00% 116 265 0.00% 117 282 0.00% 118 288 0.00% 119 376 0.00% 120 355 0.00% 121 447 0.00% 122 462 0.00% 123 552 0.00% 124 625 0.00% 125 645 0.00% 126 693 0.00% 127 723 0.00% 128 675 0.00% 129 750 0.00% 130 717 0.00% 131 636 0.00% 132 896 0.01% 133 6079 0.04% 134 131532 0.79% 135 135654 0.81% 136 138817 0.83% 137 142493 0.86% 138 144090 0.87% 139 145035 0.87% 140 145594 0.87% 141 149936 0.90% 142 150185 0.90% 143 154949 0.93% 144 150491 0.90% 145 153816 0.92% 146 160265 0.96% 147 169947 1.02% 148 238034 1.43% 149 1676837 10.07% 150 12642370 75.93% criterion=sequence-density sequence-density=5.83 sequence-density-rank=1 fanout-score=1.01 fanout-score-rank=42 prefix-density=2.38 prefix-fanout=1.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.79 sequence-density-rank=16 fanout-score=107.17 fanout-score-rank=1 prefix-density=3.23 prefix-fanout=26.3 sequence=TCAAACACAAAGTTACCTAAACTATAGAAG criterion=sequence-density sequence-density=5.94 sequence-density-rank=1 fanout-score=1.14 fanout-score-rank=43 prefix-density=3.92 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=41 fanout-score=77.67 fanout-score-rank=1 prefix-density=4.83 prefix-fanout=1.0 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATGGGTTACTTCAGCGCCGTAGCGCCTGGTACTCGAACATTGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAACAGGGACACCGTGCGTCCTTGAACCGATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTA SRR18274414 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:38:07 Started mapping on | Feb 11 03:38:24 Finished on | Feb 11 05:09:46 Mapping speed, Million of reads per hour | 14.69 Number of input reads | 22376271 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 5243521 Uniquely mapped reads % | 23.43% Average mapped length | 286.39 Number of splices: Total | 1529712 Number of splices: Annotated (sjdb) | 1371358 Number of splices: GT/AG | 1439160 Number of splices: GC/AG | 22012 Number of splices: AT/AC | 3069 Number of splices: Non-canonical | 65471 Mismatch rate per base, % | 1.61% Deletion rate per base | 0.01% Deletion average length | 1.98 Insertion rate per base | 0.06% Insertion average length | 4.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 947220 % of reads mapped to multiple loci | 4.23% Number of reads mapped to too many loci | 8323785 % of reads mapped to too many loci | 37.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.50% % of reads unmapped: other | 26.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 16185530 16185530 16185530 N_multimapping 947220 947220 947220 N_noFeature 2656943 3889113 3897424 N_ambiguous 133704 10067 9863 UnstrandedReadsAssigned:2452874 PositiveStrandReadsAssigned:1344341 NegativeStrandReadsAssigned:1336234 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18274414 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18274414-trimmed-pair1.fastq SRR18274414-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,376,271 reads, 16,176,354 reads pseudoaligned [quant] estimated average fragment length: 193.164 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 995 rounds 52401 SRR18274414.ke.tsv 34699 SRR18274414.se.tsv 87100 total ==> SRR18274414.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.84 107 1.32186 Potri.005G024800.1.v4.1 1035 842.836 66 1.7663 Potri.004G059700.1.v4.1 961 768.836 8 0.234704 Potri.007G009000.2.v4.1 1416 1223.84 0 0 Potri.003G141000.2.v4.1 2943 2750.84 73.5445 0.603046 Potri.016G087400.1.v4.1 270 91.6688 113 27.8049 Potri.015G069301.1.v4.1 564 371.895 0 0 Potri.010G195200.1.v4.1 1773 1580.84 0 0 Potri.012G127500.1.v4.1 977 784.836 470 13.5078 ==> SRR18274414.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 18 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR18274414 completed mapping pipeline successfully