Starting /dee2/code/volunteer_pipeline.sh SRR18274415 current disk space = 3057024090112 free memory = 1151149392 SRR18274415 SRAfilesize de61d56468b14b597927f9fe8e29b5f3 SRR18274415.sra SRR18274415.sra file validated SRR18274415 is paired end SRR18274415 is conventional basespace SRR18274415 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2525 32.0 32.0 32.0 32.0 32.0 2 30.39125 32.0 32.0 32.0 32.0 32.0 3 35.06375 37.0 32.0 37.0 32.0 37.0 4 35.9725 37.0 37.0 37.0 32.0 37.0 5 36.0175 37.0 37.0 37.0 32.0 37.0 6 39.3705 41.0 41.0 41.0 37.0 41.0 7 39.60775 41.0 41.0 41.0 37.0 41.0 8 39.546 41.0 41.0 41.0 37.0 41.0 9 39.66675 41.0 41.0 41.0 37.0 41.0 10-14 39.654399999999995 41.0 41.0 41.0 37.0 41.0 15-19 39.645799999999994 41.0 41.0 41.0 37.0 41.0 20-24 39.4419 41.0 41.0 41.0 37.0 41.0 25-29 39.323249999999994 41.0 41.0 41.0 37.0 41.0 30-34 39.29259999999999 41.0 41.0 41.0 37.0 41.0 35-39 39.17015 41.0 41.0 41.0 37.0 41.0 40-44 38.9163 41.0 41.0 41.0 35.0 41.0 45-49 38.9717 41.0 41.0 41.0 36.0 41.0 50-54 39.0214 41.0 41.0 41.0 36.0 41.0 55-59 38.9371 41.0 41.0 41.0 36.0 41.0 60-64 38.83045 41.0 41.0 41.0 33.0 41.0 65-69 38.713100000000004 41.0 41.0 41.0 32.0 41.0 70-74 38.5977 41.0 41.0 41.0 32.0 41.0 75-79 38.5109 41.0 40.2 41.0 33.0 41.0 80-84 38.7575 41.0 41.0 41.0 32.0 41.0 85-89 39.01115 41.0 41.0 41.0 36.0 41.0 90-94 38.93375 41.0 41.0 41.0 34.0 41.0 95-99 38.84689999999999 41.0 41.0 41.0 32.0 41.0 100-104 38.63605 41.0 41.0 41.0 32.0 41.0 105-109 38.717600000000004 41.0 41.0 41.0 32.0 41.0 110-114 38.48155 41.0 41.0 41.0 32.0 41.0 115-119 38.37085 41.0 41.0 41.0 32.0 41.0 120-124 38.37355 41.0 41.0 41.0 32.0 41.0 125-129 38.25595 41.0 41.0 41.0 32.0 41.0 130-134 37.7855 41.0 37.0 41.0 30.0 41.0 135-139 37.936800000000005 41.0 39.4 41.0 31.0 41.0 140-144 37.59439999999999 41.0 37.0 41.0 27.0 41.0 145-149 37.47875 41.0 37.0 41.0 27.0 41.0 150 37.4115 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.4755639097744364 1101 2 -1.2869674185463644 1101 3 0.5350877192982466 1101 4 -0.08395989974937379 1101 5 0.03884711779448935 1101 6 -0.02280701754386172 1101 7 0.21065162907268586 1101 8 -0.05300751879699561 1101 9 0.029573934837095806 1101 10-14 0.13614035087719145 1101 15-19 -0.12157894736841968 1101 20-24 -0.09278195488722218 1101 25-29 -0.1292731829573981 1101 30-34 -0.19370927318295372 1101 35-39 -0.2312030075187934 1101 40-44 -0.4394486215538862 1101 45-49 -0.34172932330827166 1101 50-54 -0.22167919799498748 1101 55-59 -0.2714035087719253 1101 60-64 -0.3667167919799468 1101 65-69 -0.29706766917293237 1101 70-74 -0.10834586466165774 1101 75-79 -0.017142857142857792 1101 80-84 -0.23716791979949647 1101 85-89 -0.13110275689223272 1101 90-94 -0.06052631578947398 1101 95-99 -0.18503759398495845 1101 100-104 -0.21784461152881818 1101 105-109 -0.19030075187969686 1101 110-114 -0.29293233082707104 1101 115-119 -0.11273182957393146 1101 120-124 -0.047894736842103214 1101 125-129 -0.2100751879699274 1101 130-134 -0.5773684210526326 1101 135-139 -0.29997493734335734 1101 140-144 -0.36426065162906696 1101 145-149 -0.23300751879698822 1101 150 -0.5640350877192972 1102 1 -0.4755639097744364 1102 2 1.286967418546368 1102 3 -0.5350877192982466 1102 4 0.08395989974937379 1102 5 -0.038847117794482244 1102 6 0.02280701754386172 1102 7 -0.21065162907267876 1102 8 0.053007518796988506 1102 9 -0.0295739348370887 1102 10-14 -0.13614035087719145 1102 15-19 0.12157894736841968 1102 20-24 0.09278195488721508 1102 25-29 0.1292731829574052 1102 30-34 0.19370927318295372 1102 35-39 0.23120300751880052 1102 40-44 0.4394486215538862 1102 45-49 0.34172932330827166 1102 50-54 0.22167919799498748 1102 55-59 0.2714035087719324 1102 60-64 0.3667167919799468 1102 65-69 0.29706766917293237 1102 70-74 0.10834586466165064 1102 75-79 0.017142857142850687 1102 80-84 0.23716791979949647 1102 85-89 0.1311027568922256 1102 90-94 0.06052631578947398 1102 95-99 0.18503759398496555 1102 100-104 0.21784461152881818 1102 105-109 0.19030075187970397 1102 110-114 0.29293233082707104 1102 115-119 0.11273182957393857 1102 120-124 0.04789473684209611 1102 125-129 0.2100751879699274 1102 130-134 0.5773684210526255 1102 135-139 0.29997493734335734 1102 140-144 0.36426065162907406 1102 145-149 0.23300751879699533 1102 150 0.5640350877192972 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 7.0 19 10.0 20 9.0 21 13.0 22 18.0 23 16.0 24 20.0 25 15.0 26 20.0 27 27.0 28 38.0 29 30.0 30 45.0 31 34.0 32 60.0 33 68.0 34 100.0 35 92.0 36 136.0 37 172.0 38 235.0 39 407.0 40 2426.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 18.707397121938904 26.483211310275184 16.334259025498614 38.4751325422873 2 21.548821548821547 23.6985236985237 35.92333592333593 18.82931882931883 3 18.475 26.224999999999998 29.65 25.650000000000002 4 21.45 24.125 28.599999999999998 25.825 5 25.85 23.799999999999997 26.775 23.575 6 23.1 26.224999999999998 27.250000000000004 23.425 7 24.5 26.55 24.975 23.974999999999998 8 19.875 23.225 31.0 25.900000000000002 9 22.7 23.05 30.125 24.125 10-14 23.674999999999997 25.669999999999998 25.685000000000002 24.97 15-19 25.430000000000003 24.985 24.785 24.8 20-24 24.025 24.745 25.905 25.324999999999996 25-29 24.375 24.64 25.435000000000002 25.55 30-34 24.545 25.605 24.51 25.34 35-39 24.505 25.069999999999997 24.855 25.569999999999997 40-44 24.115000000000002 25.615 24.745 25.525 45-49 24.97 24.81 25.014999999999997 25.205 50-54 24.425 25.224999999999998 25.16 25.19 55-59 24.01740174017402 24.62246224622462 25.91259125912591 25.447544754475448 60-64 24.222422242224223 24.852485248524854 25.412541254125415 25.512551255125516 65-69 24.732473247324734 26.122612261226124 24.292429242924293 24.852485248524854 70-74 25.045 24.495 24.995 25.465 75-79 24.740000000000002 24.34 24.925 25.995 80-84 24.855 25.055 24.98 25.11 85-89 24.654999999999998 25.124999999999996 24.79 25.430000000000003 90-94 24.845 25.145 25.009999999999998 25.0 95-99 24.62 25.55 24.91 24.92 100-104 24.893734060109015 25.183777566634998 25.118767815172276 24.803720558083715 105-109 24.47 25.290000000000003 24.654999999999998 25.585 110-114 24.86248624862486 25.01750175017502 25.72757275727573 24.392439243924393 115-119 25.251312828207052 24.981245311327832 24.96124031007752 24.8062015503876 120-124 24.762428728618584 25.527658297489246 24.792437731319396 24.917475242572774 125-129 25.205 24.905 24.82 25.069999999999997 130-134 24.77 24.905 25.395 24.93 135-139 25.115 25.555 24.86 24.47 140-144 24.7 26.939999999999998 24.474999999999998 23.885 145-149 25.39 26.490000000000002 24.865000000000002 23.255 150 26.424999999999997 27.200000000000003 23.325000000000003 23.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.0 2 2.0 3 2.0 4 1.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 1.0 17 2.5 18 2.0 19 1.0 20 1.0 21 1.0 22 2.0 23 4.5 24 6.0 25 5.5 26 2.5 27 4.5 28 8.0 29 6.5 30 9.5 31 12.5 32 17.0 33 21.0 34 31.0 35 45.0 36 55.0 37 56.0 38 53.5 39 65.5 40 88.5 41 111.5 42 131.5 43 145.0 44 192.5 45 225.0 46 196.5 47 168.0 48 158.0 49 161.5 50 159.5 51 148.5 52 157.0 53 167.5 54 153.0 55 133.5 56 126.5 57 128.0 58 107.0 59 90.0 60 82.0 61 69.5 62 74.0 63 62.5 64 40.0 65 35.5 66 32.0 67 37.0 68 36.0 69 30.5 70 24.0 71 15.0 72 15.0 73 17.0 74 12.0 75 8.0 76 9.0 77 11.0 78 10.5 79 3.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 3.4750000000000005 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.01 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.01 115-119 0.025 120-124 0.03 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 87.83588558220168 76.0 2 9.679283444091304 16.75 3 1.7913897717422709 4.65 4 0.49118751805836464 1.7000000000000002 5 0.17336030049118753 0.75 6 0.028893383415197923 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACA 6 0.15 No Hit ATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAAT 5 0.125 No Hit TAACTAGCTATGCGGAGGTGACCCTCCGCGGCCAGCTTCTTAGAGGGACT 5 0.125 No Hit CTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCC 5 0.125 No Hit ATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAA 5 0.125 No Hit CCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACATTGTCAGGTGGG 5 0.125 No Hit CTCTTCCCGAGGCCCCCGCCGACGTCTCCGGACTCCCTAACGTTGCCGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18274415 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274415_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.71375 32.0 12.0 32.0 2.0 32.0 2 30.72875 32.0 32.0 32.0 32.0 32.0 3 33.21875 37.0 32.0 37.0 27.0 37.0 4 34.4175 37.0 32.0 37.0 32.0 37.0 5 34.67 37.0 37.0 37.0 32.0 37.0 6 37.69925 41.0 37.0 41.0 32.0 41.0 7 37.98075 41.0 37.0 41.0 32.0 41.0 8 38.391 41.0 37.0 41.0 32.0 41.0 9 37.90775 41.0 37.0 41.0 27.0 41.0 10-14 38.323750000000004 41.0 41.0 41.0 32.0 41.0 15-19 38.132850000000005 41.0 38.6 41.0 31.0 41.0 20-24 38.10065 41.0 40.2 41.0 30.0 41.0 25-29 38.0568 41.0 38.6 41.0 30.0 41.0 30-34 37.88645 41.0 37.8 41.0 28.0 41.0 35-39 37.810050000000004 41.0 37.0 41.0 27.0 41.0 40-44 37.8613 41.0 37.8 41.0 27.0 41.0 45-49 37.867 41.0 38.6 41.0 28.0 41.0 50-54 37.84425 41.0 37.0 41.0 27.0 41.0 55-59 37.558749999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.44355 41.0 37.0 41.0 27.0 41.0 65-69 37.83375 41.0 38.6 41.0 29.0 41.0 70-74 38.4371 41.0 41.0 41.0 32.0 41.0 75-79 37.75945 41.0 38.6 41.0 30.0 41.0 80-84 38.07695 41.0 41.0 41.0 31.0 41.0 85-89 37.878750000000004 41.0 40.2 41.0 28.0 41.0 90-94 38.09935 41.0 41.0 41.0 32.0 41.0 95-99 38.2034 41.0 41.0 41.0 32.0 41.0 100-104 37.8628 41.0 38.6 41.0 29.0 41.0 105-109 38.11579999999999 41.0 40.2 41.0 32.0 41.0 110-114 37.922250000000005 41.0 37.8 41.0 30.0 41.0 115-119 37.7405 41.0 37.0 41.0 27.0 41.0 120-124 37.16685 41.0 37.0 41.0 26.0 41.0 125-129 36.94064999999999 41.0 37.0 41.0 26.0 41.0 130-134 37.1157 41.0 37.0 41.0 27.0 41.0 135-139 36.821000000000005 41.0 37.0 41.0 26.0 41.0 140-144 36.46745 41.0 37.0 41.0 23.0 41.0 145-149 35.924400000000006 41.0 33.0 41.0 22.0 41.0 150 35.87775 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 -5.936090225563909 1101 2 0.008145363408523565 1101 3 -0.5187969924812066 1101 4 -0.2092731829573964 1101 5 -0.29949874686717237 1101 6 -0.6884711779448622 1101 7 -0.5200501253132828 1101 8 -0.12243107769423744 1101 9 -0.550501253132829 1101 10-14 -0.20528822055138107 1101 15-19 -0.08969924812030428 1101 20-24 -0.1752380952380932 1101 25-29 -0.37974937343358306 1101 30-34 -0.17619047619047734 1101 35-39 0.09819548872180661 1101 40-44 -0.2433583959899721 1101 45-49 -0.6243107769423517 1101 50-54 -0.09353383458647357 1101 55-59 0.06684210526315582 1101 60-64 -0.11050125313283843 1101 65-69 -0.2089223057644105 1101 70-74 -0.047944862155389956 1101 75-79 -0.5255889724310734 1101 80-84 -0.08957393483709097 1101 85-89 -0.4106265664160418 1101 90-94 -0.1743358395990029 1101 95-99 0.01794486215538882 1101 100-104 -0.1696240601503689 1101 105-109 -0.1504010025062641 1101 110-114 -0.013182957393489403 1101 115-119 0.035488721804512124 1101 120-124 -0.34506265664160196 1101 125-129 -0.4441854636591458 1101 130-134 -0.060576441102760725 1101 135-139 -0.4186967418546317 1101 140-144 -0.30496240601503644 1101 145-149 -0.6894235588972393 1101 150 -0.26604010025062763 1102 1 5.9360902255639125 1102 2 -0.008145363408520012 1102 3 0.5187969924811995 1102 4 0.20927318295738928 1102 5 0.29949874686716527 1102 6 0.6884711779448622 1102 7 0.5200501253132828 1102 8 0.12243107769423034 1102 9 0.5505012531328362 1102 10-14 0.20528822055138107 1102 15-19 0.08969924812030428 1102 20-24 0.1752380952380861 1102 25-29 0.37974937343358306 1102 30-34 0.17619047619047734 1102 35-39 -0.0981954887217995 1102 40-44 0.24335839598997921 1102 45-49 0.6243107769423517 1102 50-54 0.09353383458646647 1102 55-59 -0.06684210526315582 1102 60-64 0.11050125313283132 1102 65-69 0.2089223057644105 1102 70-74 0.047944862155389956 1102 75-79 0.5255889724310805 1102 80-84 0.08957393483709097 1102 85-89 0.4106265664160418 1102 90-94 0.1743358395989958 1102 95-99 -0.01794486215538882 1102 100-104 0.169624060150376 1102 105-109 0.1504010025062641 1102 110-114 0.013182957393482297 1102 115-119 -0.035488721804512124 1102 120-124 0.34506265664160907 1102 125-129 0.4441854636591529 1102 130-134 0.06057644110275362 1102 135-139 0.4186967418546388 1102 140-144 0.30496240601504354 1102 145-149 0.6894235588972464 1102 150 0.26604010025062763 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 3.0 17 7.0 18 12.0 19 17.0 20 8.0 21 19.0 22 18.0 23 25.0 24 23.0 25 46.0 26 46.0 27 53.0 28 38.0 29 61.0 30 77.0 31 81.0 32 86.0 33 93.0 34 101.0 35 130.0 36 176.0 37 193.0 38 285.0 39 537.0 40 1863.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.588253670727898 26.991565135895033 15.588878475476415 39.831302717900655 2 21.975 23.75 36.075 18.2 3 19.900000000000002 26.474999999999998 29.025000000000002 24.6 4 21.25 25.25 28.65 24.85 5 26.224999999999998 23.95 26.125 23.7 6 21.9 26.875 26.5 24.725 7 24.825 26.075 27.0 22.1 8 20.125 23.175 32.125 24.575 9 22.275 22.475 30.8 24.45 10-14 23.28 25.47 26.415 24.834999999999997 15-19 24.125 25.314999999999998 25.240000000000002 25.319999999999997 20-24 24.08 24.8 25.645 25.474999999999998 25-29 23.905 24.86 26.1 25.135 30-34 25.240000000000002 24.834999999999997 24.895 25.03 35-39 25.074999999999996 25.505 24.36 25.06 40-44 24.295 25.064999999999998 25.314999999999998 25.324999999999996 45-49 24.505 24.86 25.224999999999998 25.41 50-54 24.517258629314657 25.202601300650322 25.047523761880942 25.23261630815408 55-59 24.64 24.335 25.455 25.569999999999997 60-64 25.009999999999998 24.32 25.05 25.619999999999997 65-69 24.775 24.535 25.674999999999997 25.014999999999997 70-74 25.224999999999998 24.52 25.21 25.045 75-79 25.19 24.865000000000002 25.4 24.545 80-84 25.105 24.845 25.09 24.959999999999997 85-89 25.069999999999997 25.080000000000002 25.025 24.825 90-94 25.430000000000003 24.955 25.0 24.615000000000002 95-99 24.72 24.92 25.275 25.085 100-104 25.06 24.759999999999998 25.355 24.825 105-109 25.380000000000003 24.865000000000002 25.069999999999997 24.685000000000002 110-114 24.990000000000002 24.875 25.27 24.865000000000002 115-119 25.0 24.805 25.430000000000003 24.765 120-124 25.025 25.085 24.985 24.905 125-129 25.6 24.755 25.445 24.2 130-134 25.180000000000003 25.0 25.064999999999998 24.755 135-139 24.654999999999998 24.855 25.474999999999998 25.014999999999997 140-144 25.185000000000002 25.545 25.080000000000002 24.19 145-149 25.505 26.465 24.38 23.65 150 26.55 27.500000000000004 22.275 23.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 1.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.5 11 2.0 12 0.5 13 0.5 14 1.0 15 1.0 16 2.0 17 3.0 18 2.5 19 2.5 20 2.5 21 2.5 22 4.0 23 3.0 24 3.5 25 3.5 26 4.0 27 8.5 28 9.0 29 6.5 30 11.5 31 15.0 32 12.5 33 24.5 34 35.5 35 42.5 36 42.0 37 42.5 38 64.5 39 85.0 40 99.5 41 123.0 42 138.0 43 149.0 44 178.0 45 189.0 46 184.0 47 174.0 48 170.0 49 178.5 50 172.5 51 163.5 52 156.5 53 159.0 54 157.5 55 129.5 56 115.5 57 113.0 58 106.0 59 105.0 60 92.0 61 59.0 62 46.0 63 57.5 64 47.5 65 30.5 66 29.0 67 29.0 68 32.0 69 34.0 70 29.0 71 22.0 72 18.5 73 19.0 74 12.0 75 7.0 76 9.0 77 10.0 78 7.5 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.05 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.01981287837094 83.6 2 6.411667583929555 11.65 3 1.2383048981838194 3.375 4 0.2201430930104568 0.8 5 0.0550357732526142 0.25 6 0.0275178866263071 0.15 7 0.0275178866263071 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGA 7 0.17500000000000002 No Hit ATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAA 6 0.15 No Hit CTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCTCTTTTTGGACCCAAG 5 0.125 No Hit CTTTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACTT 10 0.0029273056 191.66667 1 ATTAAGC 10 0.0070099696 143.75 3 TGAAGGC 10 0.0070099696 143.75 8 TTGAAGG 10 0.0070099696 143.75 7 GAGATCG 35 1.2691408E-4 24.642857 140-144 >>END_MODULE Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra Read 1238976 spots for SRR18274415.sra Written 1238976 spots for SRR18274415.sra SRR ids: ['SRR18274415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ozcqd_yi SRR18274415.sra spots: 24779520 blocks: [[1, 1238976], [1238977, 2477952], [2477953, 3716928], [3716929, 4955904], [4955905, 6194880], [6194881, 7433856], [7433857, 8672832], [8672833, 9911808], [9911809, 11150784], [11150785, 12389760], [12389761, 13628736], [13628737, 14867712], [14867713, 16106688], [16106689, 17345664], [17345665, 18584640], [18584641, 19823616], [19823617, 21062592], [21062593, 22301568], [22301569, 23540544], [23540545, 24779520]] SRR18274415 file size 9101082 SRR18274415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18274415 SRR18274415_1.fastq SRR18274415_2.fastq Input file: SRR18274415_1.fastq Paired file: SRR18274415_2.fastq trimmed: SRR18274415-trimmed-pair1.fastq, SRR18274415-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 02:28:45 2025 >> started Tue Feb 11 02:35:53 2025 >> done (428.725s) 24779520 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 24779520 (100.00%) read pairs available; of these: 3620628 (14.61%) trimmed read pairs available after processing 21158892 (85.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 1 0.00% 57 0 0.00% 58 1 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 1 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 1 0.00% 89 0 0.00% 90 2 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 1 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 1 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 1 0.00% 111 0 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 1 0.00% 118 0 0.00% 119 1 0.00% 120 0 0.00% 121 2 0.00% 122 1 0.00% 123 4 0.00% 124 0 0.00% 125 4 0.00% 126 3 0.00% 127 5 0.00% 128 5 0.00% 129 4 0.00% 130 6 0.00% 131 2 0.00% 132 4 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 0 0.00% 137 4 0.00% 138 23 0.00% 139 146 0.00% 140 3087 0.01% 141 328581 1.33% 142 330713 1.33% 143 332930 1.34% 144 334412 1.35% 145 339795 1.37% 146 341366 1.38% 147 347446 1.40% 148 382367 1.54% 149 879702 3.55% 150 21158892 85.39% 24779520 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=1.38 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=163.95 fanout-score-rank=1 prefix-density=2.62 prefix-fanout=1.4 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=1.64 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=44 prefix-density=1.59 prefix-fanout=2.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=46 fanout-score=117.84 fanout-score-rank=1 prefix-density=2.52 prefix-fanout=1.4 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT SRR18274415 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 02:59:12 Started mapping on | Feb 11 02:59:30 Finished on | Feb 11 04:24:19 Mapping speed, Million of reads per hour | 17.53 Number of input reads | 24779520 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 5584313 Uniquely mapped reads % | 22.54% Average mapped length | 282.88 Number of splices: Total | 3046926 Number of splices: Annotated (sjdb) | 2936958 Number of splices: GT/AG | 2959719 Number of splices: GC/AG | 44016 Number of splices: AT/AC | 3449 Number of splices: Non-canonical | 39742 Mismatch rate per base, % | 0.65% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 3.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 650793 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 12553017 % of reads mapped to too many loci | 50.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.71% % of reads unmapped: other | 12.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 18544414 18544414 18544414 N_multimapping 650793 650793 650793 N_noFeature 1726677 3613761 3644319 N_ambiguous 87093 16981 17377 UnstrandedReadsAssigned:3770543 PositiveStrandReadsAssigned:1953571 NegativeStrandReadsAssigned:1922617 Dataset is classified unstranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR18274415 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18274415-trimmed-pair1.fastq SRR18274415-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,779,520 reads, 20,166,209 reads pseudoaligned [quant] estimated average fragment length: 183.272 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR18274415.ke.tsv 34699 SRR18274415.se.tsv 87100 total ==> SRR18274415.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1835.73 211 3.67326 Potri.005G024800.1.v4.1 1035 852.728 3 0.112432 Potri.004G059700.1.v4.1 961 778.728 8 0.328309 Potri.007G009000.2.v4.1 1416 1233.73 0 0 Potri.003G141000.2.v4.1 2943 2760.73 163.076 1.88775 Potri.016G087400.1.v4.1 270 94.6484 327 110.411 Potri.015G069301.1.v4.1 564 381.784 0 0 Potri.010G195200.1.v4.1 1773 1590.73 0 0 Potri.012G127500.1.v4.1 977 794.728 1433 57.6243 ==> SRR18274415.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 28 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR18274415 completed mapping pipeline successfully