Starting /dee2/code/volunteer_pipeline.sh SRR18274416 current disk space = 3056966152192 free memory = 1463257452 SRR18274416 SRAfilesize e2414be8183393271c3d969ebc28b62a SRR18274416.sra SRR18274416.sra file validated SRR18274416 is paired end SRR18274416 is conventional basespace SRR18274416 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.235 32.0 32.0 32.0 32.0 32.0 2 30.47625 32.0 32.0 32.0 32.0 32.0 3 34.795 37.0 32.0 37.0 32.0 37.0 4 35.81 37.0 37.0 37.0 32.0 37.0 5 35.94375 37.0 37.0 37.0 32.0 37.0 6 39.33975 41.0 41.0 41.0 37.0 41.0 7 39.504 41.0 41.0 41.0 37.0 41.0 8 39.42625 41.0 41.0 41.0 37.0 41.0 9 39.56825 41.0 41.0 41.0 37.0 41.0 10-14 39.551849999999995 41.0 41.0 41.0 37.0 41.0 15-19 39.553250000000006 41.0 41.0 41.0 37.0 41.0 20-24 39.3726 41.0 41.0 41.0 37.0 41.0 25-29 39.2744 41.0 41.0 41.0 37.0 41.0 30-34 39.21615 41.0 41.0 41.0 37.0 41.0 35-39 39.089800000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.005100000000006 41.0 41.0 41.0 36.0 41.0 45-49 38.899899999999995 41.0 41.0 41.0 35.0 41.0 50-54 38.931799999999996 41.0 41.0 41.0 34.0 41.0 55-59 38.846149999999994 41.0 41.0 41.0 32.0 41.0 60-64 38.8009 41.0 41.0 41.0 32.0 41.0 65-69 38.63195 41.0 41.0 41.0 32.0 41.0 70-74 38.60525 41.0 41.0 41.0 32.0 41.0 75-79 38.4156 41.0 40.2 41.0 32.0 41.0 80-84 38.75555 41.0 41.0 41.0 32.0 41.0 85-89 38.940200000000004 41.0 41.0 41.0 33.0 41.0 90-94 38.8141 41.0 41.0 41.0 32.0 41.0 95-99 38.77275000000001 41.0 41.0 41.0 32.0 41.0 100-104 38.53295 41.0 41.0 41.0 32.0 41.0 105-109 38.58075 41.0 41.0 41.0 32.0 41.0 110-114 38.425850000000004 41.0 41.0 41.0 32.0 41.0 115-119 38.269 41.0 41.0 41.0 32.0 41.0 120-124 38.26055 41.0 41.0 41.0 32.0 41.0 125-129 38.19425 41.0 40.2 41.0 32.0 41.0 130-134 37.6101 41.0 37.0 41.0 28.0 41.0 135-139 37.6783 41.0 37.0 41.0 29.0 41.0 140-144 37.316500000000005 41.0 37.0 41.0 27.0 41.0 145-149 37.2093 41.0 37.0 41.0 27.0 41.0 150 37.14075 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.23179314565483367 1101 2 -0.797633618931048 1101 3 -0.15580375356996967 1101 4 -0.10964912280702066 1101 5 -0.14866381068951284 1101 6 -0.05411056711546536 1101 7 -0.17370461036311724 1101 8 -0.11255609955120605 1101 9 -0.08124235006120273 1101 10-14 -0.16796205630355132 1101 15-19 -0.07055283557731684 1101 20-24 -0.25247858017135627 1101 25-29 -0.22837617299062174 1101 30-34 -0.23546511627906597 1101 35-39 -0.167972256221951 1101 40-44 -0.3068441452468349 1101 45-49 -0.25370257037943134 1101 50-54 -0.23959608323133352 1101 55-59 -0.31396368829049237 1101 60-64 -0.3685638514891849 1101 65-69 -0.25012239902081035 1101 70-74 -0.22224602203182542 1101 75-79 -0.48329253365972846 1101 80-84 -0.5640452876376969 1101 85-89 -0.2436658506731959 1101 90-94 -0.07400040799673491 1101 95-99 -0.1478682170542598 1101 100-104 -0.5624745002039973 1101 105-109 -0.4424826601387224 1101 110-114 -0.2590881272949801 1101 115-119 -0.4263871889024884 1101 120-124 -0.43226234190126434 1101 125-129 -0.6449714402284812 1101 130-134 -1.0342615259077945 1101 135-139 -0.7364749082007336 1101 140-144 -0.7267747858017088 1101 145-149 -0.31551407588739266 1101 150 -0.3602101183190527 1102 1 0.23179314565483722 1102 2 0.797633618931048 1102 3 0.15580375356997678 1102 4 0.10964912280701355 1102 5 0.14866381068951284 1102 6 0.05411056711546536 1102 7 0.17370461036311724 1102 8 0.11255609955119894 1102 9 0.08124235006119562 1102 10-14 0.16796205630354422 1102 15-19 0.07055283557731684 1102 20-24 0.25247858017135627 1102 25-29 0.22837617299062174 1102 30-34 0.23546511627906597 1102 35-39 0.167972256221951 1102 40-44 0.306844145246842 1102 45-49 0.25370257037943844 1102 50-54 0.23959608323133352 1102 55-59 0.31396368829049237 1102 60-64 0.368563851489192 1102 65-69 0.25012239902081035 1102 70-74 0.22224602203183252 1102 75-79 0.48329253365972846 1102 80-84 0.5640452876376969 1102 85-89 0.2436658506731959 1102 90-94 0.0740004079967278 1102 95-99 0.1478682170542598 1102 100-104 0.5624745002039973 1102 105-109 0.4424826601387153 1102 110-114 0.2590881272949801 1102 115-119 0.4263871889024813 1102 120-124 0.43226234190126434 1102 125-129 0.6449714402284741 1102 130-134 1.0342615259077945 1102 135-139 0.7364749082007265 1102 140-144 0.7267747858017088 1102 145-149 0.31551407588739266 1102 150 0.3602101183190527 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 7.0 19 5.0 20 5.0 21 14.0 22 11.0 23 9.0 24 19.0 25 22.0 26 23.0 27 28.0 28 34.0 29 40.0 30 43.0 31 53.0 32 75.0 33 78.0 34 81.0 35 122.0 36 171.0 37 171.0 38 270.0 39 403.0 40 2314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.08238851095994 27.3116654069035 17.05719324766944 38.54875283446712 2 22.457408363448632 23.33505420753743 35.6995353639649 18.508002065049045 3 19.375 26.674999999999997 29.5 24.45 4 22.525000000000002 23.775 28.575 25.124999999999996 5 26.8 25.224999999999998 26.1 21.875 6 22.95 25.924999999999997 26.5 24.625 7 23.925 26.1 26.724999999999998 23.25 8 19.650000000000002 23.875 30.75 25.724999999999998 9 22.25 22.3 30.55 24.9 10-14 23.885 24.86 26.325 24.93 15-19 24.235 25.335 25.135 25.295 20-24 24.099999999999998 24.2 26.035000000000004 25.665 25-29 23.96 25.14 25.555 25.345000000000002 30-34 24.255 24.875 25.074999999999996 25.795 35-39 24.8112405620281 25.146257312865643 24.776238811940594 25.26626331316566 40-44 24.86 24.25 25.605 25.285000000000004 45-49 25.064999999999998 24.785 24.67 25.480000000000004 50-54 24.43 25.03 25.330000000000002 25.21 55-59 24.751237561878096 24.65623281164058 25.73628681434072 24.856242812140607 60-64 24.797479747974798 24.337433743374337 25.512551255125516 25.352535253525353 65-69 24.8162408120406 25.261263063153155 24.331216560828043 25.591279563978198 70-74 24.805 25.195 24.34 25.66 75-79 25.259999999999998 24.165 24.915000000000003 25.66 80-84 25.014999999999997 24.685000000000002 24.575 25.724999999999998 85-89 25.185000000000002 24.69 24.959999999999997 25.165 90-94 25.09 24.745 24.985 25.180000000000003 95-99 24.845 25.005 25.34 24.81 100-104 25.08376256438466 24.56868530279542 24.978746812021804 25.36880532079812 105-109 24.95 24.95 24.97 25.130000000000003 110-114 25.44627231361568 24.501225061253063 24.921246062303116 25.131256562828142 115-119 24.95373380683239 25.22382833991897 25.198819586855397 24.623618266393237 120-124 25.067520256076826 24.69740922276683 24.992497749324798 25.24257277183155 125-129 25.919999999999998 25.0 24.84 24.240000000000002 130-134 24.66 24.79 25.965 24.585 135-139 24.955 25.419999999999998 25.255 24.37 140-144 25.119999999999997 26.255 24.565 24.060000000000002 145-149 25.83 26.615 23.59 23.965 150 25.874999999999996 27.125 24.975 22.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.0 2 3.5 3 3.5 4 2.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.5 17 0.5 18 1.0 19 1.5 20 0.5 21 1.0 22 2.0 23 5.5 24 5.5 25 2.0 26 2.5 27 5.0 28 7.5 29 9.5 30 8.5 31 10.0 32 11.5 33 9.0 34 24.5 35 38.0 36 44.5 37 50.5 38 52.0 39 70.0 40 87.5 41 118.5 42 138.5 43 152.5 44 185.5 45 199.0 46 180.5 47 158.5 48 160.0 49 168.0 50 180.0 51 185.5 52 171.0 53 170.0 54 154.0 55 131.5 56 131.5 57 127.5 58 104.0 59 97.5 60 99.5 61 72.5 62 54.5 63 53.0 64 48.0 65 39.0 66 36.0 67 40.5 68 38.0 69 28.0 70 25.0 71 17.5 72 12.5 73 12.0 74 10.0 75 6.0 76 7.0 77 8.5 78 7.0 79 2.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 3.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.01 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.005 115-119 0.034999999999999996 120-124 0.03 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.65 #Duplication Level Percentage of deduplicated Percentage of total 1 87.56567425569177 75.0 2 9.165207238762404 15.7 3 2.5977816695855225 6.675000000000001 4 0.37945125510799765 1.3 5 0.20431990659661414 0.8750000000000001 6 0.08756567425569177 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGA 6 0.15 No Hit AATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCG 6 0.15 No Hit TTTAACGTTATTTTACTTATTCCGTGAATCGGAGGCGGGGCGCTGCCCCT 6 0.15 No Hit CTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCAC 5 0.125 No Hit TGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAA 5 0.125 No Hit CTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAA 5 0.125 No Hit CATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCC 5 0.125 No Hit CGGAGGCGGGGCGCTGCCCCTCTTTTTGGACCCAAGGCCGCTTCGGCGGC 5 0.125 No Hit CCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCA 5 0.125 No Hit CTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTGT 10 0.0064673126 147.6282 2 AGATCGG 20 0.006152281 28.787498 140-144 >>END_MODULE SRR18274416 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274416_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.92 32.0 12.0 32.0 2.0 32.0 2 30.45625 32.0 32.0 32.0 27.0 32.0 3 32.6525 32.0 32.0 37.0 27.0 37.0 4 34.1775 37.0 32.0 37.0 27.0 37.0 5 34.4425 37.0 37.0 37.0 27.0 37.0 6 37.2505 41.0 37.0 41.0 32.0 41.0 7 37.61475 41.0 37.0 41.0 32.0 41.0 8 37.99 41.0 37.0 41.0 32.0 41.0 9 37.665 41.0 37.0 41.0 27.0 41.0 10-14 38.0548 41.0 38.6 41.0 31.0 41.0 15-19 37.860850000000006 41.0 38.6 41.0 28.0 41.0 20-24 37.76515 41.0 37.0 41.0 28.0 41.0 25-29 37.7927 41.0 37.8 41.0 28.0 41.0 30-34 37.619699999999995 41.0 37.0 41.0 27.0 41.0 35-39 37.62975 41.0 37.0 41.0 27.0 41.0 40-44 37.53375 41.0 37.0 41.0 27.0 41.0 45-49 37.621449999999996 41.0 37.0 41.0 27.0 41.0 50-54 37.62835 41.0 37.0 41.0 27.0 41.0 55-59 37.4093 41.0 37.0 41.0 27.0 41.0 60-64 37.2025 41.0 37.0 41.0 27.0 41.0 65-69 37.483000000000004 41.0 37.0 41.0 27.0 41.0 70-74 38.184850000000004 41.0 40.2 41.0 31.0 41.0 75-79 37.465900000000005 41.0 37.8 41.0 28.0 41.0 80-84 38.01705 41.0 38.6 41.0 30.0 41.0 85-89 37.86245 41.0 37.8 41.0 29.0 41.0 90-94 37.884750000000004 41.0 37.0 41.0 29.0 41.0 95-99 37.9765 41.0 38.6 41.0 32.0 41.0 100-104 37.7215 41.0 37.0 41.0 27.0 41.0 105-109 37.769549999999995 41.0 37.0 41.0 28.0 41.0 110-114 37.71685 41.0 37.0 41.0 29.0 41.0 115-119 37.38765 41.0 37.0 41.0 27.0 41.0 120-124 36.80155 41.0 37.0 41.0 26.0 41.0 125-129 36.7226 41.0 37.0 41.0 24.0 41.0 130-134 36.8983 41.0 37.0 41.0 26.0 41.0 135-139 36.52595 41.0 37.0 41.0 23.0 41.0 140-144 36.111850000000004 41.0 35.0 41.0 22.0 41.0 145-149 35.67595 41.0 32.0 41.0 22.0 41.0 150 35.7025 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -4.832721338229291 1101 2 0.0020399836801274773 1101 3 -1.1393308853529156 1101 4 -0.2685128518971851 1101 5 0.1601387188902521 1101 6 -0.35990412076703393 1101 7 -0.5515605875153042 1101 8 -0.1295899632802957 1101 9 -0.5481436148510852 1101 10-14 -0.20430436556507914 1101 15-19 -0.19889840881273813 1101 20-24 -0.36299469604242773 1101 25-29 -0.4261933904528803 1101 30-34 -0.2672072623418984 1101 35-39 0.06107711138310634 1101 40-44 -0.19874541003672164 1101 45-49 -0.43452672378621315 1101 50-54 -0.07887596899225002 1101 55-59 -0.25360057119543455 1101 60-64 -0.29583843329253057 1101 65-69 -0.40499796001632404 1101 70-74 -0.3710934312525467 1101 75-79 -0.6244492044063676 1101 80-84 -0.6302529579763387 1101 85-89 -0.7884026927784547 1101 90-94 -0.12188902488780684 1101 95-99 0.019614443084449817 1101 100-104 -0.25432476540186855 1101 105-109 -0.34254385964912615 1101 110-114 -0.5347511219910217 1101 115-119 -0.5154018767849848 1101 120-124 -0.7440534475724192 1101 125-129 -0.4277335781313738 1101 130-134 0.040718074255408965 1101 135-139 -0.3533047735618169 1101 140-144 -0.4452366381068984 1101 145-149 -0.6076907384740835 1101 150 0.19237046103631172 1102 1 4.832721338229295 1102 2 -0.00203998368013103 1102 3 1.1393308853529192 1102 4 0.2685128518971851 1102 5 -0.160138718890245 1102 6 0.35990412076703393 1102 7 0.5515605875152971 1102 8 0.1295899632802957 1102 9 0.5481436148510781 1102 10-14 0.20430436556507914 1102 15-19 0.19889840881273102 1102 20-24 0.36299469604242773 1102 25-29 0.4261933904528803 1102 30-34 0.2672072623419055 1102 35-39 -0.06107711138311345 1102 40-44 0.19874541003671453 1102 45-49 0.43452672378621315 1102 50-54 0.07887596899224292 1102 55-59 0.25360057119542745 1102 60-64 0.2958384332925377 1102 65-69 0.40499796001632404 1102 70-74 0.3710934312525538 1102 75-79 0.6244492044063676 1102 80-84 0.6302529579763387 1102 85-89 0.7884026927784547 1102 90-94 0.12188902488780684 1102 95-99 -0.019614443084456923 1102 100-104 0.25432476540187565 1102 105-109 0.34254385964911904 1102 110-114 0.5347511219910288 1102 115-119 0.5154018767849848 1102 120-124 0.7440534475724192 1102 125-129 0.4277335781313738 1102 130-134 -0.040718074255408965 1102 135-139 0.3533047735618098 1102 140-144 0.4452366381068913 1102 145-149 0.6076907384740906 1102 150 -0.19237046103631172 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 2.0 17 4.0 18 7.0 19 14.0 20 17.0 21 28.0 22 22.0 23 34.0 24 39.0 25 36.0 26 41.0 27 52.0 28 60.0 29 53.0 30 69.0 31 89.0 32 101.0 33 112.0 34 113.0 35 151.0 36 156.0 37 210.0 38 332.0 39 511.0 40 1744.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.86635944700461 27.311827956989248 16.497695852534562 39.324116743471585 2 21.5 23.525 36.625 18.35 3 19.825 26.650000000000002 28.349999999999998 25.174999999999997 4 22.3 24.975 29.349999999999998 23.375 5 24.7 25.95 26.150000000000002 23.200000000000003 6 23.075000000000003 27.200000000000003 26.1 23.625 7 23.7 27.55 25.775 22.975 8 20.575 22.7 31.125000000000004 25.6 9 21.875 23.325000000000003 30.975 23.825 10-14 23.555 25.865 25.785000000000004 24.795 15-19 23.925 25.679999999999996 25.419999999999998 24.975 20-24 23.625 25.415 25.845000000000002 25.115 25-29 24.07 24.705 26.174999999999997 25.05 30-34 24.34 24.775 25.095 25.790000000000003 35-39 25.1 24.92 24.85 25.130000000000003 40-44 24.990000000000002 25.290000000000003 24.665 25.055 45-49 24.65 25.330000000000002 24.945 25.074999999999996 50-54 24.375844298794217 25.18637114124181 25.021263821483963 25.416520738480013 55-59 24.745 24.68 25.1 25.474999999999998 60-64 24.795 24.345 25.435000000000002 25.424999999999997 65-69 24.93 25.16 24.725 25.185000000000002 70-74 24.990000000000002 24.51 25.259999999999998 25.240000000000002 75-79 24.665 24.87 24.58 25.885 80-84 24.775 24.48 25.064999999999998 25.679999999999996 85-89 24.104999999999997 25.169999999999998 25.124999999999996 25.6 90-94 25.47 24.785 24.905 24.84 95-99 25.009999999999998 24.9 25.305 24.785 100-104 25.045 25.61 24.62 24.725 105-109 24.575 25.335 24.84 25.25 110-114 25.419999999999998 24.535 25.424999999999997 24.62 115-119 25.09 25.679999999999996 24.45 24.779999999999998 120-124 25.595000000000002 24.15 24.77 25.485000000000003 125-129 25.705 24.535 24.88 24.88 130-134 25.135 24.46 25.6 24.805 135-139 24.42 25.345000000000002 25.014999999999997 25.22 140-144 26.08 25.955000000000002 24.279999999999998 23.685000000000002 145-149 25.869999999999997 26.275 24.39 23.465 150 26.525 27.825 23.175 22.475 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.5 2 2.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 2.0 14 1.5 15 0.0 16 0.5 17 1.5 18 2.0 19 1.0 20 1.0 21 2.0 22 3.0 23 4.0 24 4.5 25 7.0 26 7.0 27 6.0 28 5.0 29 8.0 30 12.0 31 12.0 32 13.5 33 17.5 34 30.5 35 43.5 36 45.5 37 46.0 38 59.5 39 77.0 40 87.5 41 118.5 42 146.0 43 168.0 44 194.0 45 195.0 46 172.5 47 162.5 48 165.5 49 173.0 50 174.5 51 170.5 52 161.0 53 151.0 54 153.5 55 144.5 56 127.5 57 121.0 58 105.5 59 91.5 60 89.0 61 66.5 62 57.5 63 58.0 64 44.5 65 32.0 66 24.5 67 35.5 68 42.0 69 30.0 70 22.0 71 15.5 72 12.5 73 9.5 74 10.0 75 8.0 76 8.0 77 13.0 78 9.0 79 3.0 80 1.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.065 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.11915367483296 81.825 2 6.987750556792872 12.55 3 1.447661469933185 3.9 4 0.33407572383073497 1.2 5 0.08351893095768374 0.375 6 0.027839643652561245 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCC 6 0.15 No Hit CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACT 5 0.125 No Hit CCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCAAAGATTAC 5 0.125 No Hit ATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0015123422 23.975 115-119 >>END_MODULE Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148810 spots for SRR18274416.sra Written 1148810 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra Read 1148802 spots for SRR18274416.sra Written 1148802 spots for SRR18274416.sra SRR ids: ['SRR18274416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__db4ryn_ SRR18274416.sra spots: 22976048 blocks: [[1, 1148802], [1148803, 2297604], [2297605, 3446406], [3446407, 4595208], [4595209, 5744010], [5744011, 6892812], [6892813, 8041614], [8041615, 9190416], [9190417, 10339218], [10339219, 11488020], [11488021, 12636822], [12636823, 13785624], [13785625, 14934426], [14934427, 16083228], [16083229, 17232030], [17232031, 18380832], [18380833, 19529634], [19529635, 20678436], [20678437, 21827238], [21827239, 22976048]] SRR18274416 file size 8437910 SRR18274416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18274416 SRR18274416_1.fastq SRR18274416_2.fastq Input file: SRR18274416_1.fastq Paired file: SRR18274416_2.fastq trimmed: SRR18274416-trimmed-pair1.fastq, SRR18274416-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:42:55 2025 >> started Tue Feb 11 03:49:52 2025 >> done (417.330s) 22976048 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 22976048 (100.00%) read pairs available; of these: 3100522 (13.49%) trimmed read pairs available after processing 19875526 (86.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 1 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 1 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 1 0.00% 87 0 0.00% 88 0 0.00% 89 1 0.00% 90 0 0.00% 91 0 0.00% 92 1 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 1 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 1 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 0 0.00% 111 1 0.00% 112 0 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 1 0.00% 118 0 0.00% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 1 0.00% 124 2 0.00% 125 3 0.00% 126 2 0.00% 127 2 0.00% 128 1 0.00% 129 1 0.00% 130 4 0.00% 131 2 0.00% 132 0 0.00% 133 0 0.00% 134 0 0.00% 135 2 0.00% 136 2 0.00% 137 3 0.00% 138 19 0.00% 139 122 0.00% 140 2576 0.01% 141 274535 1.19% 142 275642 1.20% 143 279059 1.21% 144 279250 1.22% 145 285114 1.24% 146 286360 1.25% 147 293647 1.28% 148 326850 1.42% 149 797312 3.47% 150 19875526 86.51% 22976048 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=1.43 fanout-score-rank=43 prefix-density=0.18 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=141.91 fanout-score-rank=1 prefix-density=2.78 prefix-fanout=1.4 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=1.42 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=43 prefix-density=1.34 prefix-fanout=2.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=45 fanout-score=119.94 fanout-score-rank=1 prefix-density=2.69 prefix-fanout=1.4 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT SRR18274416 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:59:55 Started mapping on | Feb 11 04:00:25 Finished on | Feb 11 04:31:04 Mapping speed, Million of reads per hour | 44.98 Number of input reads | 22976048 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 5532189 Uniquely mapped reads % | 24.08% Average mapped length | 287.97 Number of splices: Total | 2865173 Number of splices: Annotated (sjdb) | 2770082 Number of splices: GT/AG | 2793927 Number of splices: GC/AG | 41740 Number of splices: AT/AC | 3527 Number of splices: Non-canonical | 25979 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 2.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 737318 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 11604278 % of reads mapped to too many loci | 50.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.06% % of reads unmapped: other | 13.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 16706541 16706541 16706541 N_multimapping 737318 737318 737318 N_noFeature 1830526 3660972 3647650 N_ambiguous 77837 11991 11883 UnstrandedReadsAssigned:3623826 PositiveStrandReadsAssigned:1859226 NegativeStrandReadsAssigned:1872656 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18274416 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18274416-trimmed-pair1.fastq SRR18274416-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,976,048 reads, 18,539,651 reads pseudoaligned [quant] estimated average fragment length: 190.101 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR18274416.ke.tsv 34699 SRR18274416.se.tsv 87100 total ==> SRR18274416.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.9 104 1.94646 Potri.005G024800.1.v4.1 1035 845.899 36 1.45676 Potri.004G059700.1.v4.1 961 771.905 2 0.0886889 Potri.007G009000.2.v4.1 1416 1226.9 0 0 Potri.003G141000.2.v4.1 2943 2753.9 105.327 1.30916 Potri.016G087400.1.v4.1 270 89.5035 136 52.0118 Potri.015G069301.1.v4.1 564 374.972 0 0 Potri.010G195200.1.v4.1 1773 1583.9 2 0.043222 Potri.012G127500.1.v4.1 977 787.905 1310 56.9116 ==> SRR18274416.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 47 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR18274416 completed mapping pipeline successfully