Starting /dee2/code/volunteer_pipeline.sh SRR18274417 current disk space = 3056978239488 free memory = 1578491100 SRR18274417 SRAfilesize fec894887d689b615dfafee7efa00afb SRR18274417.sra SRR18274417.sra file validated SRR18274417 is paired end SRR18274417 is conventional basespace SRR18274417 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27125 32.0 32.0 32.0 32.0 32.0 2 30.33625 32.0 32.0 32.0 32.0 32.0 3 35.045 37.0 32.0 37.0 32.0 37.0 4 35.75375 37.0 37.0 37.0 32.0 37.0 5 36.02 37.0 37.0 37.0 32.0 37.0 6 39.375 41.0 41.0 41.0 37.0 41.0 7 39.498 41.0 41.0 41.0 37.0 41.0 8 39.57975 41.0 41.0 41.0 37.0 41.0 9 39.698 41.0 41.0 41.0 37.0 41.0 10-14 39.69345 41.0 41.0 41.0 37.0 41.0 15-19 39.65665 41.0 41.0 41.0 37.0 41.0 20-24 39.49465 41.0 41.0 41.0 37.0 41.0 25-29 39.4191 41.0 41.0 41.0 37.0 41.0 30-34 39.3874 41.0 41.0 41.0 37.0 41.0 35-39 39.28805 41.0 41.0 41.0 37.0 41.0 40-44 39.17875 41.0 41.0 41.0 37.0 41.0 45-49 39.08295 41.0 41.0 41.0 36.0 41.0 50-54 39.144850000000005 41.0 41.0 41.0 37.0 41.0 55-59 39.003949999999996 41.0 41.0 41.0 37.0 41.0 60-64 38.937599999999996 41.0 41.0 41.0 34.0 41.0 65-69 38.8471 41.0 41.0 41.0 32.0 41.0 70-74 38.743849999999995 41.0 41.0 41.0 32.0 41.0 75-79 38.75625 41.0 40.2 41.0 34.0 41.0 80-84 38.9765 41.0 41.0 41.0 35.0 41.0 85-89 39.11815 41.0 41.0 41.0 37.0 41.0 90-94 39.009 41.0 41.0 41.0 34.0 41.0 95-99 38.985 41.0 41.0 41.0 36.0 41.0 100-104 38.761750000000006 41.0 41.0 41.0 32.0 41.0 105-109 38.8437 41.0 41.0 41.0 32.0 41.0 110-114 38.65315 41.0 41.0 41.0 32.0 41.0 115-119 38.610699999999994 41.0 41.0 41.0 32.0 41.0 120-124 38.5272 41.0 41.0 41.0 32.0 41.0 125-129 38.472500000000004 41.0 41.0 41.0 32.0 41.0 130-134 38.00834999999999 41.0 39.4 41.0 31.0 41.0 135-139 38.1427 41.0 40.2 41.0 31.0 41.0 140-144 37.89495000000001 41.0 37.0 41.0 28.0 41.0 145-149 37.7333 41.0 37.0 41.0 28.0 41.0 150 37.5365 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.26009930038366136 1101 2 -1.064281952907546 1101 3 -0.033727024248349835 1101 4 0.5163118433260578 1101 5 0.20881917801349204 1101 6 0.34727550841294885 1101 7 0.62471476215552 1101 8 0.20004262895258051 1101 9 0.36796308834223623 1101 10-14 0.32357381077759584 1101 15-19 0.3864991599588734 1101 20-24 0.4256751673813284 1101 25-29 0.37130319215627594 1101 30-34 0.23779182025627676 1101 35-39 0.10164246846711222 1101 40-44 0.15798791343814855 1101 45-49 0.36062840091275916 1101 50-54 0.18387121041149612 1101 55-59 0.14391534391533867 1101 60-64 0.20575490859851442 1101 65-69 0.07896637327917233 1101 70-74 0.19151433085082203 1101 75-79 0.1062664560294877 1101 80-84 0.19272047945033677 1101 85-89 0.10498507986660144 1101 90-94 0.16472579553148137 1101 95-99 0.14328092479751575 1101 100-104 0.1948268512249527 1101 105-109 0.20655984352666934 1101 110-114 0.1990145189197321 1101 115-119 0.26793299731689046 1101 120-124 0.20760299907219348 1101 125-129 0.2836731111612636 1101 130-134 -0.0864139020537138 1101 135-139 -0.0143057749692872 1101 140-144 0.04342636475337969 1101 145-149 0.3172597106246471 1101 150 0.15425411870909755 1102 1 -0.26009930038366136 1102 2 1.0642819529075425 1102 3 0.03372702424835694 1102 4 -0.516311843326065 1102 5 -0.20881917801349204 1102 6 -0.34727550841294885 1102 7 -0.62471476215552 1102 8 -0.20004262895258051 1102 9 -0.36796308834223623 1102 10-14 -0.32357381077760294 1102 15-19 -0.3864991599588805 1102 20-24 -0.4256751673813284 1102 25-29 -0.37130319215627594 1102 30-34 -0.23779182025626966 1102 35-39 -0.10164246846711222 1102 40-44 -0.15798791343814855 1102 45-49 -0.36062840091275916 1102 50-54 -0.18387121041149612 1102 55-59 -0.14391534391534577 1102 60-64 -0.20575490859852152 1102 65-69 -0.07896637327917233 1102 70-74 -0.19151433085081493 1102 75-79 -0.1062664560294948 1102 80-84 -0.19272047945033677 1102 85-89 -0.10498507986659433 1102 90-94 -0.16472579553148137 1102 95-99 -0.14328092479751575 1102 100-104 -0.1948268512249527 1102 105-109 -0.20655984352666223 1102 110-114 -0.1990145189197321 1102 115-119 -0.26793299731688336 1102 120-124 -0.20760299907218638 1102 125-129 -0.2836731111612636 1102 130-134 0.08641390205370669 1102 135-139 0.014305774969280094 1102 140-144 -0.04342636475337969 1102 145-149 -0.31725971062464 1102 150 -0.15425411870909045 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 2.0 19 10.0 20 6.0 21 7.0 22 18.0 23 12.0 24 10.0 25 20.0 26 18.0 27 24.0 28 21.0 29 37.0 30 57.0 31 54.0 32 57.0 33 71.0 34 87.0 35 88.0 36 116.0 37 167.0 38 256.0 39 383.0 40 2477.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.565961732124872 28.423967774420944 15.080563947633435 39.92950654582075 2 21.571169302566762 23.567539538501425 36.14207933627171 18.7192118226601 3 18.375 26.924999999999997 30.175 24.525 4 21.0 24.25 29.375 25.374999999999996 5 25.75 24.125 27.950000000000003 22.175 6 24.099999999999998 24.95 26.6 24.349999999999998 7 24.474999999999998 26.674999999999997 26.825 22.025 8 19.525000000000002 23.175 32.25 25.05 9 22.725 22.825 30.875000000000004 23.575 10-14 23.96 25.624999999999996 25.515 24.9 15-19 24.355 25.040000000000003 24.72 25.885 20-24 24.635 24.845 25.369999999999997 25.15 25-29 23.745 24.855 25.77 25.629999999999995 30-34 24.490000000000002 25.380000000000003 25.575 24.555 35-39 25.165 25.0 25.16 24.675 40-44 24.83 25.15 25.165 24.855 45-49 25.019999999999996 25.055 25.055 24.87 50-54 24.685000000000002 24.75 25.074999999999996 25.490000000000002 55-59 24.675 24.665 25.305 25.355 60-64 25.615 25.009999999999998 24.505 24.87 65-69 25.28 24.8 24.83 25.09 70-74 24.745 24.435000000000002 25.545 25.275 75-79 25.16 24.635 25.330000000000002 24.875 80-84 24.759999999999998 25.09 24.945 25.205 85-89 24.92 25.119999999999997 24.355 25.605 90-94 25.240000000000002 25.09 24.705 24.965 95-99 24.825 25.275 24.905 24.995 100-104 25.42127106355318 25.141257062853146 24.7862393119656 24.65123256162808 105-109 24.38 25.009999999999998 25.09 25.52 110-114 25.295 25.805 24.87 24.03 115-119 25.662566256625663 24.847484748474848 25.06250625062506 24.427442744274426 120-124 25.502550255025504 25.027502750275026 24.602460246024602 24.867486748674867 125-129 25.259999999999998 24.89 25.174999999999997 24.675 130-134 24.65 25.69 24.825 24.834999999999997 135-139 24.83 25.245 25.115 24.81 140-144 24.795 25.935000000000002 24.75 24.52 145-149 25.395 26.87 24.36 23.375 150 25.674999999999997 27.224999999999998 23.95 23.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 2.0 2 3.5 3 4.0 4 4.5 5 2.5 6 0.5 7 1.5 8 1.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.5 14 1.0 15 2.0 16 2.5 17 1.5 18 1.0 19 1.5 20 2.5 21 2.5 22 3.0 23 2.5 24 2.0 25 5.5 26 7.5 27 7.5 28 8.0 29 9.5 30 10.5 31 14.0 32 20.0 33 21.5 34 29.5 35 41.0 36 47.0 37 55.0 38 58.5 39 68.5 40 90.5 41 121.0 42 139.5 43 145.0 44 162.5 45 185.0 46 179.5 47 155.0 48 154.5 49 166.0 50 165.5 51 163.0 52 169.0 53 169.5 54 144.5 55 117.0 56 121.5 57 123.5 58 103.5 59 115.5 60 118.0 61 73.5 62 55.5 63 59.5 64 48.0 65 34.0 66 26.5 67 32.5 68 42.0 69 39.5 70 31.5 71 23.0 72 14.5 73 10.0 74 8.5 75 6.5 76 9.0 77 12.5 78 11.5 79 4.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 3.5749999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.6 #Duplication Level Percentage of deduplicated Percentage of total 1 87.35397196261682 74.775 2 9.579439252336448 16.400000000000002 3 2.27803738317757 5.8500000000000005 4 0.5257009345794392 1.7999999999999998 5 0.20443925233644858 0.8750000000000001 6 0.05841121495327102 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTTATCTAATAAATGCGTCCCTTCCAGAAGTCGGGGTTTGTTGCACGT 6 0.15 No Hit CGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAA 6 0.15 No Hit CAATGTCTTCCGCCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAAAAAG 5 0.125 No Hit CCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGC 5 0.125 No Hit ATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAA 5 0.125 No Hit AAAAAGCTCGTAGTTGGACTTTGGGTTGGGTCGGCCGGTCCGCCTCAGGT 5 0.125 No Hit TGTTTGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit CCTCTTTTTGGACCCAAGGCCGCTTCGGCGGCCGATCCGGGCGGAAGACA 5 0.125 No Hit GTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCTC 10 0.006716492 145.79747 1 GTCCTCC 10 0.006716492 145.79747 2 TTTGTGT 15 1.11538764E-4 145.79747 2 CCGGATT 10 0.0069772652 143.975 7 TCCTCCG 10 0.0069772652 143.975 3 GGATTTT 10 0.0069772652 143.975 9 CGGATTT 10 0.0069772652 143.975 8 TTGAGCC 10 0.0069772652 143.975 4 CCTCCGG 10 0.0069772652 143.975 4 TCCGGAT 10 0.0069772652 143.975 6 TGAGCCC 10 0.0069772652 143.975 5 GTGTTTG 25 8.9624035E-4 86.385 5 TGTGTTT 25 8.9624035E-4 86.385 4 GTTTGAG 30 0.0018486676 71.9875 7 TTGTGTT 40 6.096386E-5 71.9875 3 CTTTGTG 35 0.0032380994 62.48463 1 TGTTTGA 40 0.005781407 53.990627 6 >>END_MODULE SRR18274417 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18274417_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.34 32.0 12.0 32.0 2.0 32.0 2 30.57625 32.0 32.0 32.0 27.0 32.0 3 32.78625 32.0 32.0 37.0 27.0 37.0 4 34.2575 37.0 32.0 37.0 27.0 37.0 5 34.445 37.0 37.0 37.0 27.0 37.0 6 37.275 41.0 37.0 41.0 32.0 41.0 7 37.77875 41.0 37.0 41.0 32.0 41.0 8 37.93375 41.0 37.0 41.0 32.0 41.0 9 37.51375 41.0 37.0 41.0 27.0 41.0 10-14 38.13885 41.0 38.6 41.0 32.0 41.0 15-19 37.954750000000004 41.0 38.6 41.0 29.0 41.0 20-24 37.816649999999996 41.0 37.0 41.0 28.0 41.0 25-29 37.961149999999996 41.0 37.8 41.0 29.0 41.0 30-34 37.806349999999995 41.0 37.0 41.0 28.0 41.0 35-39 37.69015 41.0 37.0 41.0 27.0 41.0 40-44 37.72745 41.0 37.0 41.0 27.0 41.0 45-49 37.80185 41.0 37.8 41.0 27.0 41.0 50-54 37.7367 41.0 37.0 41.0 27.0 41.0 55-59 37.41985 41.0 37.0 41.0 27.0 41.0 60-64 37.222449999999995 41.0 37.0 41.0 27.0 41.0 65-69 37.83775 41.0 37.8 41.0 29.0 41.0 70-74 38.34309999999999 41.0 41.0 41.0 32.0 41.0 75-79 37.6421 41.0 38.6 41.0 29.0 41.0 80-84 38.04625 41.0 39.4 41.0 30.0 41.0 85-89 37.966499999999996 41.0 39.4 41.0 30.0 41.0 90-94 38.09755 41.0 40.2 41.0 30.0 41.0 95-99 38.09795 41.0 41.0 41.0 32.0 41.0 100-104 37.8056 41.0 38.6 41.0 28.0 41.0 105-109 37.996399999999994 41.0 39.4 41.0 31.0 41.0 110-114 37.8703 41.0 37.0 41.0 29.0 41.0 115-119 37.605599999999995 41.0 37.0 41.0 27.0 41.0 120-124 37.12155 41.0 37.0 41.0 26.0 41.0 125-129 36.930400000000006 41.0 37.0 41.0 25.0 41.0 130-134 36.93495 41.0 37.0 41.0 27.0 41.0 135-139 36.6606 41.0 37.0 41.0 25.0 41.0 140-144 36.349650000000004 41.0 37.0 41.0 23.0 41.0 145-149 35.8495 41.0 33.0 41.0 22.0 41.0 150 35.77375 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 -5.9452970234960745 1101 2 0.19722159532586048 1101 3 -0.7996063090849788 1101 4 -0.35150078988942113 1101 5 -0.29965646079390496 1101 6 -0.2671706913413132 1101 7 0.10035356954788455 1101 8 0.08812909049875373 1101 9 -0.08891897991424003 1101 10-14 -0.006818124827603356 1101 15-19 0.3253065523207681 1101 20-24 -0.055851450638179756 1101 25-29 0.04864214248100751 1101 30-34 0.21363374206976005 1101 35-39 0.27092956192481665 1101 40-44 0.18252212944155843 1101 45-49 0.23168835728078108 1101 50-54 0.059186539281327555 1101 55-59 0.05286993154292219 1101 60-64 0.30214649314174835 1101 65-69 -0.16539030567466284 1101 70-74 -0.10901978484917407 1101 75-79 -0.20058677499435618 1101 80-84 -0.11775621254294322 1101 85-89 -0.2513929637152401 1101 90-94 -0.03130971187842846 1101 95-99 -0.16116502419819767 1101 100-104 0.11815742621429592 1101 105-109 0.13954211489756574 1101 110-114 0.07773514882519805 1101 115-119 0.13344868226384676 1101 120-124 -0.47950299656460516 1101 125-129 -0.2989493216981387 1101 130-134 0.0994809298126853 1101 135-139 -0.179337495925175 1101 140-144 -0.13792472228490738 1101 145-149 0.15001629930539906 1101 150 0.08885629027809472 1102 1 5.945297023496078 1102 2 -0.19722159532586048 1102 3 0.7996063090849859 1102 4 0.351500789889414 1102 5 0.29965646079389785 1102 6 0.2671706913413061 1102 7 -0.10035356954788455 1102 8 -0.08812909049876083 1102 9 0.08891897991424003 1102 10-14 0.006818124827603356 1102 15-19 -0.3253065523207681 1102 20-24 0.055851450638179756 1102 25-29 -0.048642142481000405 1102 30-34 -0.21363374206976715 1102 35-39 -0.27092956192482376 1102 40-44 -0.18252212944155843 1102 45-49 -0.23168835728077397 1102 50-54 -0.059186539281327555 1102 55-59 -0.05286993154291508 1102 60-64 -0.30214649314175546 1102 65-69 0.16539030567466995 1102 70-74 0.10901978484917407 1102 75-79 0.20058677499435618 1102 80-84 0.11775621254295032 1102 85-89 0.2513929637152401 1102 90-94 0.03130971187842846 1102 95-99 0.16116502419819767 1102 100-104 -0.11815742621429592 1102 105-109 -0.13954211489756574 1102 110-114 -0.07773514882519805 1102 115-119 -0.13344868226384676 1102 120-124 0.47950299656460516 1102 125-129 0.2989493216981316 1102 130-134 -0.0994809298126853 1102 135-139 0.179337495925175 1102 140-144 0.13792472228491448 1102 145-149 -0.15001629930539195 1102 150 -0.08885629027808761 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 4.0 17 5.0 18 11.0 19 13.0 20 10.0 21 19.0 22 25.0 23 30.0 24 32.0 25 40.0 26 36.0 27 53.0 28 52.0 29 49.0 30 86.0 31 78.0 32 75.0 33 133.0 34 114.0 35 140.0 36 149.0 37 209.0 38 314.0 39 548.0 40 1773.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.74279379157428 29.743427304402914 16.43965790307254 38.07412100095027 2 21.525 22.650000000000002 38.85 16.975 3 18.975 28.000000000000004 29.475 23.549999999999997 4 20.775 24.8 29.549999999999997 24.875 5 24.55 24.425 26.55 24.474999999999998 6 23.625 26.1 25.95 24.325 7 24.125 26.200000000000003 26.275 23.400000000000002 8 19.35 23.375 30.325000000000003 26.950000000000003 9 21.2 23.275000000000002 30.125 25.4 10-14 23.185 25.31 26.58 24.925 15-19 24.82 25.074999999999996 25.290000000000003 24.815 20-24 24.51 24.625 25.825 25.040000000000003 25-29 24.14 24.505 26.055 25.3 30-34 24.075 25.8 25.240000000000002 24.884999999999998 35-39 25.105 24.77 24.92 25.205 40-44 24.435000000000002 24.765 25.27 25.53 45-49 25.019999999999996 25.11 25.345000000000002 24.525 50-54 24.93623405851463 24.646161540385098 25.401350337584393 25.01625406351588 55-59 25.174999999999997 24.64 25.264999999999997 24.92 60-64 24.77 23.855 25.5 25.874999999999996 65-69 25.16 24.740000000000002 25.180000000000003 24.92 70-74 24.560000000000002 24.709999999999997 25.080000000000002 25.650000000000002 75-79 24.19 25.2 25.525 25.085 80-84 24.57 24.54 25.045 25.845000000000002 85-89 24.91 25.005 24.67 25.415 90-94 24.7 25.130000000000003 25.319999999999997 24.85 95-99 24.62 24.915000000000003 24.705 25.759999999999998 100-104 24.490000000000002 25.15 24.87 25.490000000000002 105-109 24.675 24.279999999999998 25.55 25.495 110-114 24.884999999999998 24.615000000000002 25.355 25.145 115-119 25.130000000000003 24.91 25.585 24.375 120-124 25.230000000000004 24.575 24.965 25.230000000000004 125-129 25.2 25.069999999999997 25.064999999999998 24.665 130-134 24.785 24.345 25.759999999999998 25.11 135-139 24.48 25.264999999999997 25.319999999999997 24.935 140-144 25.205 25.97 24.6 24.224999999999998 145-149 25.545 26.669999999999998 23.919999999999998 23.865 150 25.924999999999997 27.125 23.200000000000003 23.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 3.0 3 2.0 4 0.5 5 1.5 6 1.5 7 0.5 8 0.0 9 0.5 10 1.5 11 2.0 12 2.0 13 2.0 14 2.0 15 1.5 16 2.0 17 2.5 18 2.0 19 3.0 20 3.5 21 3.0 22 5.0 23 7.5 24 7.0 25 3.5 26 4.0 27 8.0 28 6.5 29 6.0 30 8.5 31 12.0 32 19.0 33 22.0 34 31.0 35 50.5 36 53.5 37 49.5 38 57.0 39 78.0 40 109.0 41 130.0 42 132.0 43 137.0 44 172.0 45 192.5 46 167.5 47 161.0 48 175.0 49 173.0 50 151.5 51 147.5 52 162.0 53 155.5 54 134.5 55 132.5 56 135.5 57 116.0 58 111.5 59 113.5 60 93.0 61 61.0 62 47.5 63 63.0 64 59.0 65 39.5 66 37.5 67 39.5 68 38.0 69 28.0 70 18.5 71 20.5 72 17.5 73 10.0 74 11.0 75 8.0 76 7.0 77 11.5 78 9.5 79 3.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.025 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.42224681793027 82.6 2 6.945213060320973 12.55 3 1.3004980630879912 3.5249999999999995 4 0.2767017155506364 1.0 5 0.02767017155506364 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02767017155506364 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCT 8 0.2 No Hit ATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361911 spots for SRR18274417.sra Written 1361911 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra Read 1361895 spots for SRR18274417.sra Written 1361895 spots for SRR18274417.sra SRR ids: ['SRR18274417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fgvh_lpu SRR18274417.sra spots: 27237916 blocks: [[1, 1361895], [1361896, 2723790], [2723791, 4085685], [4085686, 5447580], [5447581, 6809475], [6809476, 8171370], [8171371, 9533265], [9533266, 10895160], [10895161, 12257055], [12257056, 13618950], [13618951, 14980845], [14980846, 16342740], [16342741, 17704635], [17704636, 19066530], [19066531, 20428425], [20428426, 21790320], [21790321, 23152215], [23152216, 24514110], [24514111, 25876005], [25876006, 27237916]] SRR18274417 file size 10005085 SRR18274417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18274417 SRR18274417_1.fastq SRR18274417_2.fastq Input file: SRR18274417_1.fastq Paired file: SRR18274417_2.fastq trimmed: SRR18274417-trimmed-pair1.fastq, SRR18274417-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:26:04 2025 >> started Tue Feb 11 04:33:28 2025 >> done (443.665s) 27237916 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 27237916 (100.00%) read pairs available; of these: 3633425 (13.34%) trimmed read pairs available after processing 23604491 (86.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 1 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 1 0.00% 70 0 0.00% 71 2 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 1 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 1 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 1 0.00% 103 0 0.00% 104 0 0.00% 105 1 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 0 0.00% 111 0 0.00% 112 1 0.00% 113 0 0.00% 114 0 0.00% 115 0 0.00% 116 0 0.00% 117 0 0.00% 118 0 0.00% 119 1 0.00% 120 1 0.00% 121 3 0.00% 122 0 0.00% 123 1 0.00% 124 0 0.00% 125 4 0.00% 126 6 0.00% 127 4 0.00% 128 3 0.00% 129 3 0.00% 130 4 0.00% 131 2 0.00% 132 4 0.00% 133 0 0.00% 134 0 0.00% 135 0 0.00% 136 2 0.00% 137 7 0.00% 138 15 0.00% 139 132 0.00% 140 3086 0.01% 141 312460 1.15% 142 315645 1.16% 143 318714 1.17% 144 320491 1.18% 145 324344 1.19% 146 327362 1.20% 147 337982 1.24% 148 379452 1.39% 149 993681 3.65% 150 23604491 86.66% 27237916 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=1.37 fanout-score-rank=40 prefix-density=0.17 prefix-fanout=1.4 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=172.39 fanout-score-rank=1 prefix-density=2.80 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCCGGAGAGG criterion=sequence-density sequence-density=1.56 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=46 prefix-density=1.65 prefix-fanout=2.0 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=46 fanout-score=128.29 fanout-score-rank=1 prefix-density=2.71 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCCGGAGAGG SRR18274417 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 07:35:02 Started mapping on | Feb 11 07:35:02 Finished on | Feb 11 07:45:40 Mapping speed, Million of reads per hour | 153.69 Number of input reads | 27237912 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 5105594 Uniquely mapped reads % | 18.74% Average mapped length | 265.44 Number of splices: Total | 2559377 Number of splices: Annotated (sjdb) | 2436541 Number of splices: GT/AG | 2459915 Number of splices: GC/AG | 37758 Number of splices: AT/AC | 3144 Number of splices: Non-canonical | 58560 Mismatch rate per base, % | 0.71% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 3.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 660498 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 14481505 % of reads mapped to too many loci | 53.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.15% % of reads unmapped: other | 11.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 21471821 21471821 21471821 N_multimapping 660498 660498 660498 N_noFeature 1539779 3381585 3217054 N_ambiguous 93054 23293 23349 UnstrandedReadsAssigned:3472761 PositiveStrandReadsAssigned:1700716 NegativeStrandReadsAssigned:1865191 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18274417 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR18274417-trimmed-pair1.fastq SRR18274417-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,237,912 reads, 22,278,290 reads pseudoaligned [quant] estimated average fragment length: 170.862 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52401 SRR18274417.ke.tsv 34699 SRR18274417.se.tsv 87100 total ==> SRR18274417.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1848.14 165 3.02616 Potri.005G024800.1.v4.1 1035 865.138 22 0.861946 Potri.004G059700.1.v4.1 961 791.138 3 0.128532 Potri.007G009000.2.v4.1 1416 1246.14 0 0 Potri.003G141000.2.v4.1 2943 2773.14 162.475 1.9859 Potri.016G087400.1.v4.1 270 106.524 302 96.0957 Potri.015G069301.1.v4.1 564 394.2 0 0 Potri.010G195200.1.v4.1 1773 1603.14 12 0.253719 Potri.012G127500.1.v4.1 977 807.138 2692 113.05 ==> SRR18274417.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 65 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR18274417 completed mapping pipeline successfully