Starting /dee2/code/volunteer_pipeline.sh SRR2029745 current disk space = 3050455007232 free memory = 1579027848 SRR2029745 SRAfilesize d375e321b89c35912b8913ddd5f5d511 SRR2029745.sra SRR2029745.sra file validated SRR2029745 is paired end SRR2029745 is conventional basespace SRR2029745 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029745_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.67275 31.0 31.0 34.0 26.0 34.0 2 30.34025 31.0 31.0 34.0 26.0 34.0 3 30.859 31.0 31.0 34.0 27.0 34.0 4 34.367 37.0 35.0 37.0 30.0 37.0 5 33.85325 37.0 35.0 37.0 28.0 37.0 6 33.74725 37.0 35.0 37.0 28.0 37.0 7 33.8405 37.0 35.0 37.0 30.0 37.0 8 33.7815 37.0 35.0 37.0 29.0 37.0 9 34.94225 39.0 35.0 39.0 28.0 39.0 10-11 34.90325 38.5 35.0 39.0 28.0 39.0 12-13 35.18925 39.0 35.0 39.0 28.5 39.0 14-15 36.1995 40.0 36.0 41.0 27.5 41.0 16-17 36.22225 40.0 36.0 41.0 28.0 41.0 18-19 36.096375 40.0 36.0 41.0 27.5 41.0 20-21 36.089 40.0 36.0 41.0 27.0 41.0 22-23 35.796375 39.5 36.0 41.0 27.5 41.0 24-25 35.71575 39.0 36.0 41.0 27.0 41.0 26-27 35.603625 39.0 36.0 41.0 26.5 41.0 28-29 35.686875 39.0 36.0 41.0 26.5 41.0 30-31 35.592124999999996 39.0 35.5 41.0 27.0 41.0 32-33 35.352000000000004 39.0 35.0 41.0 25.0 41.0 34-35 35.109750000000005 39.0 35.0 41.0 24.5 41.0 36-37 35.198625 39.0 35.0 41.0 25.0 41.0 38-39 34.7385 39.0 34.0 40.0 24.0 41.0 40-41 34.69175 38.5 34.0 40.0 24.0 41.0 42-43 34.702 38.0 34.0 40.0 24.0 41.0 44-45 34.4345 38.0 34.0 40.0 21.5 41.0 46-47 34.664625 39.0 34.5 40.0 23.5 41.0 48-49 34.199 38.0 33.0 40.0 20.0 41.0 50-51 34.303875 39.0 33.5 40.0 22.5 41.0 52-53 34.0005 38.0 33.0 40.0 20.0 41.0 54-55 33.958625 38.0 33.0 40.0 19.0 41.0 56-57 33.82825 38.0 33.0 40.0 19.0 41.0 58-59 33.567 38.0 33.0 40.0 18.5 41.0 60-61 33.200375 38.0 32.0 40.0 13.5 41.0 62-63 32.492625000000004 37.0 31.0 40.0 8.0 41.0 64-65 32.22924999999999 36.5 31.0 39.5 8.0 41.0 66-67 31.661375 36.0 30.5 39.0 7.0 40.5 68-69 31.625375 36.0 30.5 39.0 6.0 40.0 70-71 31.143250000000002 35.0 30.0 38.5 2.0 40.0 72-73 30.68325 35.0 29.5 37.5 2.0 39.5 74-75 30.119125 34.5 29.0 37.0 2.0 39.0 76-77 28.138875 32.0 27.0 34.5 2.0 37.0 78-79 29.602 34.0 29.0 36.0 2.0 38.0 80-81 29.71875 34.0 30.0 36.0 2.0 37.0 82-83 29.3435 34.0 29.5 35.5 2.0 37.0 84-85 29.11 34.0 29.0 35.0 2.0 36.5 86-87 28.574625 34.0 29.0 35.0 2.0 36.0 88-89 28.366374999999998 34.0 29.0 35.0 2.0 36.0 90-91 27.974 34.0 29.0 35.0 2.0 35.0 92-93 27.755625000000002 34.0 28.5 35.0 2.0 35.0 94-95 26.868875 34.0 25.5 35.0 2.0 35.0 96-97 26.159375 33.5 24.5 35.0 2.0 35.0 98-99 25.189875 32.5 19.5 35.0 2.0 35.0 100 23.20825 30.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 112.0 3 27.0 4 12.0 5 10.0 6 14.0 7 12.0 8 8.0 9 15.0 10 16.0 11 22.0 12 18.0 13 12.0 14 22.0 15 21.0 16 23.0 17 26.0 18 22.0 19 12.0 20 20.0 21 30.0 22 22.0 23 30.0 24 31.0 25 45.0 26 42.0 27 60.0 28 68.0 29 84.0 30 100.0 31 116.0 32 126.0 33 189.0 34 238.0 35 302.0 36 484.0 37 787.0 38 755.0 39 67.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.56701030927835 16.804123711340207 17.010309278350515 30.61855670103093 2 24.9 20.075000000000003 30.575000000000003 24.45 3 24.099999999999998 25.374999999999996 28.199999999999996 22.325 4 27.500000000000004 28.4 22.525000000000002 21.575 5 24.05 32.775 23.525 19.650000000000002 6 18.8 36.775000000000006 25.874999999999996 18.55 7 18.3 22.25 42.025 17.424999999999997 8 21.349999999999998 24.45 30.55 23.65 9 20.055082623935906 24.211316975463195 31.77265898848272 23.960941412118178 10-11 21.337500000000002 32.225 26.1625 20.275000000000002 12-13 19.462163852407755 28.205128205128204 31.45716072545341 20.87554721701063 14-15 19.839979997499686 27.54094261782723 31.366420802600324 21.25265658207276 16-17 21.0625 28.712500000000002 28.787499999999998 21.4375 18-19 20.740092511563944 28.90361295161895 29.541192649081133 20.815101887735967 20-21 21.290968226169625 28.5839379534651 29.422066549912433 20.70302727045284 22-23 21.198099049524764 28.77688844422211 27.988994497248626 22.0360180090045 24-25 21.305326331582897 28.86971742935734 28.40710177544386 21.417854463615903 26-27 20.820307615355755 28.135550831561833 28.735775915968485 22.308365637113916 28-29 20.778083562672002 28.921691268451337 29.20940705529147 21.09081811358519 30-31 21.155288822205552 28.419604901225306 27.85696424106027 22.568142035508878 32-33 21.273136568284144 29.177088544272134 27.363681840920464 22.18609304652326 34-35 21.087500000000002 28.599999999999998 28.249999999999996 22.0625 36-37 21.912499999999998 28.075 28.025 21.987499999999997 38-39 21.5375 28.65 28.5625 21.25 40-41 21.50093808630394 28.455284552845526 28.542839274546594 21.50093808630394 42-43 21.595598349381017 28.973365011879455 27.98549456046017 21.445542078279356 44-45 21.9625 27.775 28.0875 22.175 46-47 21.8125 28.349999999999998 28.000000000000004 21.837500000000002 48-49 21.462500000000002 28.499999999999996 28.349999999999998 21.6875 50-51 21.224999999999998 29.4 27.500000000000004 21.875 52-53 21.675 28.537499999999998 27.525 22.2625 54-55 21.3625 28.487499999999997 28.65 21.5 56-57 21.587500000000002 28.025 28.3625 22.025 58-59 21.625 29.037499999999998 27.250000000000004 22.0875 60-61 21.987499999999997 28.3875 28.225 21.4 62-63 21.190148768596075 28.978622327790976 28.01600200025003 21.81522690336292 64-65 20.990123765470685 29.041130141267658 28.091011376422053 21.877734716839605 66-67 21.1875 28.525 28.499999999999996 21.7875 68-69 21.175 28.762500000000003 28.3875 21.675 70-71 21.375 28.15 29.349999999999998 21.125 72-73 21.002625328166022 27.528441055131893 29.26615826978372 22.202775346918365 74-75 21.725 29.099999999999998 28.575 20.599999999999998 76-77 22.112499999999997 28.4 28.1125 21.375 78-79 21.975 28.512500000000003 28.762500000000003 20.75 80-81 20.977622202775347 28.116014501812725 29.428678584823103 21.477684710588825 82-83 21.987499999999997 28.3875 28.0625 21.5625 84-85 20.674999999999997 29.037499999999998 28.8875 21.4 86-87 21.65 28.725 27.787499999999998 21.837500000000002 88-89 21.935967983991997 27.951475737868936 27.888944472236116 22.22361180590295 90-91 22.25 28.499999999999996 28.8875 20.3625 92-93 21.502687835979497 28.62857857232154 27.803475434429302 22.06525815726966 94-95 21.5375 29.0875 28.175 21.2 96-97 21.45268158519815 28.82860357544693 28.391048881110137 21.327665958244783 98-99 22.075 28.825 27.212500000000002 21.8875 100 23.400000000000002 27.3 27.85 21.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 2.0 23 2.0 24 1.5 25 1.5 26 4.0 27 6.5 28 8.5 29 13.0 30 15.5 31 21.5 32 32.5 33 40.5 34 51.0 35 66.0 36 89.5 37 117.0 38 146.0 39 188.0 40 228.5 41 272.5 42 294.5 43 299.5 44 318.5 45 314.5 46 284.0 47 244.5 48 213.5 49 184.0 50 144.0 51 108.0 52 72.5 53 52.5 54 43.0 55 29.0 56 23.0 57 19.0 58 12.5 59 6.0 60 3.5 61 3.5 62 2.0 63 1.5 64 2.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 1.0 74 1.0 75 0.5 76 0.5 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.15 10-11 0.0 12-13 0.0625 14-15 0.0125 16-17 0.0 18-19 0.0125 20-21 0.075 22-23 0.05 24-25 0.025 26-27 0.0375 28-29 0.075 30-31 0.025 32-33 0.05 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0625 42-43 0.0375 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.05 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR2029745 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029745_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.58825 31.0 30.0 34.0 16.0 34.0 2 28.79975 31.0 30.0 34.0 16.0 34.0 3 28.786 31.0 30.0 34.0 10.0 34.0 4 31.833 37.0 33.0 37.0 10.0 37.0 5 31.76375 37.0 33.0 37.0 10.0 37.0 6 31.53475 37.0 33.0 37.0 10.0 37.0 7 31.63425 37.0 33.0 37.0 10.0 37.0 8 31.5445 37.0 33.0 37.0 10.0 37.0 9 32.78725 38.0 34.0 39.0 10.0 39.0 10-11 32.825 38.0 33.5 39.0 10.0 39.0 12-13 32.7235 38.0 33.5 39.0 9.0 39.0 14-15 33.468125 39.0 33.5 41.0 2.0 41.0 16-17 33.308625 39.0 33.0 41.0 2.0 41.0 18-19 33.241625 39.0 33.5 41.0 2.0 41.0 20-21 33.13275 39.0 33.0 41.0 2.0 41.0 22-23 33.037499999999994 39.0 33.0 41.0 2.0 41.0 24-25 32.885999999999996 39.0 33.0 41.0 2.0 41.0 26-27 32.377 38.5 32.0 40.5 2.0 41.0 28-29 32.43575 38.5 32.0 40.0 2.0 41.0 30-31 32.163625 38.5 31.5 40.0 2.0 41.0 32-33 32.34025 38.5 32.0 40.0 2.0 41.0 34-35 32.303625 38.0 31.5 40.5 2.0 41.0 36-37 32.132999999999996 38.0 31.5 40.5 2.0 41.0 38-39 31.824125000000002 38.0 30.5 40.0 2.0 41.0 40-41 31.871375 38.0 30.5 40.0 2.0 41.0 42-43 31.666625 38.0 30.5 40.0 2.0 41.0 44-45 31.472625 38.0 30.0 40.0 2.0 41.0 46-47 31.174999999999997 38.0 30.0 40.0 2.0 41.0 48-49 31.190125000000002 38.0 30.0 40.0 2.0 41.0 50-51 29.960875 36.0 28.5 39.0 2.0 40.0 52-53 30.241875 37.5 28.5 39.0 2.0 39.5 54-55 30.826875 38.0 29.5 40.0 2.0 41.0 56-57 31.047 38.0 29.5 40.0 2.0 41.0 58-59 31.114625 38.0 30.0 40.0 2.0 41.0 60-61 30.953625 38.0 29.5 40.0 2.0 41.0 62-63 30.67575 37.0 29.0 40.0 2.0 41.0 64-65 30.545749999999998 37.0 29.0 40.0 2.0 41.0 66-67 29.715125 36.0 27.0 39.0 2.0 41.0 68-69 29.552875 36.0 28.0 39.0 2.0 41.0 70-71 29.240125 35.0 27.5 39.0 2.0 40.0 72-73 28.941125 35.0 26.5 38.0 2.0 40.0 74-75 28.544125 35.0 26.0 37.0 2.0 39.0 76-77 28.137 34.5 26.0 37.0 2.0 39.0 78-79 27.819625000000002 34.0 26.0 36.0 2.0 38.5 80-81 27.419875 34.0 26.0 36.0 2.0 37.0 82-83 26.93775 34.0 25.0 35.0 2.0 37.0 84-85 26.68125 34.0 25.0 35.0 2.0 36.0 86-87 26.365375 34.0 24.0 35.0 2.0 36.0 88-89 26.079749999999997 34.0 22.5 35.0 2.0 36.0 90-91 25.625625 33.0 19.5 35.0 2.0 35.0 92-93 25.356749999999998 33.0 18.0 35.0 2.0 35.0 94-95 25.052 33.0 14.0 35.0 2.0 35.0 96-97 24.636875 33.0 2.0 35.0 2.0 35.0 98-99 23.951124999999998 32.5 2.0 35.0 2.0 35.0 100 21.62525 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 322.0 3 54.0 4 37.0 5 22.0 6 29.0 7 17.0 8 18.0 9 17.0 10 32.0 11 22.0 12 23.0 13 16.0 14 27.0 15 14.0 16 12.0 17 13.0 18 17.0 19 16.0 20 25.0 21 27.0 22 13.0 23 35.0 24 45.0 25 44.0 26 44.0 27 47.0 28 76.0 29 65.0 30 77.0 31 80.0 32 115.0 33 144.0 34 217.0 35 271.0 36 442.0 37 756.0 38 699.0 39 70.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5774330748061 17.838378784088064 15.211408556417313 30.372779584688516 2 25.174999999999997 19.175 29.075 26.575 3 23.275000000000002 24.175 28.425 24.125 4 26.950000000000003 27.075 23.200000000000003 22.775000000000002 5 26.450000000000003 30.45 24.05 19.05 6 19.85 33.324999999999996 26.650000000000002 20.175 7 18.975 22.125 39.475 19.425 8 19.825 23.9 32.725 23.549999999999997 9 21.45 25.025 30.95 22.575 10-11 22.237499999999997 31.5 27.3375 18.925 12-13 20.1875 27.875 31.5375 20.4 14-15 20.115230460921843 27.342184368737477 31.462925851703403 21.079659318637276 16-17 20.933734939759034 28.463855421686745 29.31726907630522 21.285140562248998 18-19 21.699297188755022 28.125 29.028614457831324 21.147088353413654 20-21 20.94569170951963 28.78464818763326 28.83481750909319 21.43484259375392 22-23 21.598895582329316 29.9824297188755 28.225401606425706 20.19327309236948 24-25 20.841180163214062 30.04394224733208 27.683615819209038 21.431261770244824 26-27 20.966729441305713 28.775894538606405 28.913998744507218 21.343377275580664 28-29 21.372991967871485 28.664658634538153 29.0035140562249 20.95883534136546 30-31 20.682730923694777 28.56425702811245 28.627008032128515 22.126004016064257 32-33 22.10090361445783 28.28815261044177 29.154116465863456 20.456827309236946 34-35 21.561244979919678 28.28815261044177 27.99949799196787 22.151104417670684 36-37 21.57379518072289 29.631024096385545 27.974397590361445 20.82078313253012 38-39 21.308387744851835 28.35258663987946 28.578603716725265 21.760421898543445 40-41 21.062523493296577 29.54516977822328 27.94136073173788 21.450945996742263 42-43 20.8955223880597 29.474476357707264 28.395835946318826 21.23416530791421 44-45 21.670428893905193 29.194883370955605 27.63982944569852 21.494858289440682 46-47 21.708051166290442 28.06621519939804 28.291948833709558 21.93378480060196 48-49 21.8612818261633 27.88160040135457 28.696851875078387 21.560265897403738 50-51 20.880361173814897 28.02859292701279 28.981690494105845 22.109355405066466 52-53 21.908703285678456 28.16654125909205 29.08201655379985 20.842738901429648 54-55 22.06195911200301 27.931769722814497 28.64668255361846 21.35958861156403 56-57 21.055931778279408 28.58038625532982 29.257587158264357 21.10609480812641 58-59 22.259844494607474 28.655630800100322 27.715073990469026 21.369450714823177 60-61 22.197140707298722 27.94080762478054 28.16654125909205 21.695510408828696 62-63 21.231502382743916 28.893905191873586 28.981690494105845 20.89290193127665 64-65 20.59192375219463 29.08201655379985 28.95660897918234 21.369450714823177 66-67 21.758214196137445 28.392274893403563 28.856282919488336 20.993227990970656 68-69 22.172059192375222 28.793579132179588 27.48934035615751 21.545021319287684 70-71 22.121896162528216 28.655630800100322 27.86556308001003 21.356909957361424 72-73 22.50094067477737 28.63414022325348 28.8975291609181 19.967389941051046 74-75 21.532480561825935 28.56784549786807 28.78103837471783 21.11863556558816 76-77 21.582643591672937 29.357913217958366 27.627288688236767 21.43215450213193 78-79 22.23476297968397 28.404815650865313 28.404815650865313 20.955605718585403 80-81 22.36017055430148 27.86556308001003 28.818660647103084 20.955605718585403 82-83 22.027094831911693 27.68439538384345 29.465629703963874 20.822880080280985 84-85 21.545021319287684 28.592927012791574 28.517682468021064 21.344369199899674 86-87 21.231502382743916 28.53022322548282 28.618008527715073 21.62026586405819 88-89 21.921244043140206 28.981690494105845 27.752696262854275 21.344369199899674 90-91 21.33182844243792 28.128918986706797 28.618008527715073 21.921244043140206 92-93 21.457236017055433 28.49260095309757 29.056935038876347 20.993227990970656 94-95 22.74893403561575 27.99097065462754 28.279408076247805 20.980687233508906 96-97 21.896162528216703 28.404815650865313 28.555304740406324 21.143717080511664 98-99 22.37271131176323 28.35465262101831 28.467519438174065 20.805116629044395 100 24.70529219964886 28.643090042638576 26.837220968146475 19.81439678956609 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.5 10 1.5 11 2.5 12 2.0 13 2.5 14 3.0 15 2.0 16 3.0 17 4.0 18 4.5 19 5.5 20 5.0 21 4.0 22 6.5 23 8.5 24 7.5 25 6.5 26 11.5 27 13.5 28 15.0 29 17.0 30 27.5 31 36.0 32 36.5 33 49.0 34 60.5 35 77.5 36 97.0 37 117.0 38 134.5 39 175.5 40 219.0 41 228.5 42 249.5 43 286.0 44 296.5 45 275.0 46 262.5 47 230.5 48 192.5 49 168.5 50 138.0 51 103.5 52 84.0 53 79.0 54 58.5 55 32.0 56 21.0 57 26.0 58 21.0 59 11.0 60 8.5 61 9.0 62 7.0 63 6.5 64 6.5 65 4.5 66 5.5 67 4.0 68 0.5 69 3.0 70 3.5 71 1.5 72 2.0 73 2.0 74 1.5 75 0.5 76 0.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 1.0 84 1.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.2 16-17 0.4 18-19 0.4 20-21 0.3375 22-23 0.4 24-25 0.43750000000000006 26-27 0.43750000000000006 28-29 0.4 30-31 0.4 32-33 0.4 34-35 0.4 36-37 0.4 38-39 0.44999999999999996 40-41 0.2375 42-43 0.3375 44-45 0.325 46-47 0.325 48-49 0.3375 50-51 0.325 52-53 0.325 54-55 0.3375 56-57 0.325 58-59 0.325 60-61 0.325 62-63 0.325 64-65 0.325 66-67 0.325 68-69 0.325 70-71 0.325 72-73 0.3375 74-75 0.325 76-77 0.325 78-79 0.325 80-81 0.325 82-83 0.35000000000000003 84-85 0.325 86-87 0.325 88-89 0.325 90-91 0.325 92-93 0.325 94-95 0.325 96-97 0.325 98-99 0.325 100 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra Read 1694407 spots for SRR2029745.sra Written 1694407 spots for SRR2029745.sra Read 1694396 spots for SRR2029745.sra Written 1694396 spots for SRR2029745.sra SRR ids: ['SRR2029745.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ub6ec73 SRR2029745.sra spots: 33887931 blocks: [[1, 1694396], [1694397, 3388792], [3388793, 5083188], [5083189, 6777584], [6777585, 8471980], [8471981, 10166376], [10166377, 11860772], [11860773, 13555168], [13555169, 15249564], [15249565, 16943960], [16943961, 18638356], [18638357, 20332752], [20332753, 22027148], [22027149, 23721544], [23721545, 25415940], [25415941, 27110336], [27110337, 28804732], [28804733, 30499128], [30499129, 32193524], [32193525, 33887931]] SRR2029745 file size 9205330 SRR2029745 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2029745 SRR2029745_1.fastq SRR2029745_2.fastq Input file: SRR2029745_1.fastq Paired file: SRR2029745_2.fastq trimmed: SRR2029745-trimmed-pair1.fastq, SRR2029745-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:29:58 2025 >> started Thu Feb 13 01:30:55 2025 >> done (57.245s) 33887931 read pairs processed; of these: 1675731 ( 4.94%) short read pairs filtered out after trimming by size control 2926521 ( 8.64%) empty read pairs filtered out after trimming by size control 29285679 (86.42%) read pairs available; of these: 11255868 (38.43%) trimmed read pairs available after processing 18029811 (61.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 979 0.00% 19 1210 0.00% 20 1769 0.01% 21 2359 0.01% 22 2875 0.01% 23 3532 0.01% 24 4034 0.01% 25 4791 0.02% 26 5745 0.02% 27 6576 0.02% 28 7551 0.03% 29 8755 0.03% 30 9606 0.03% 31 10671 0.04% 32 12023 0.04% 33 13507 0.05% 34 14789 0.05% 35 15612 0.05% 36 17156 0.06% 37 18294 0.06% 38 19731 0.07% 39 20905 0.07% 40 22077 0.08% 41 23998 0.08% 42 25209 0.09% 43 26641 0.09% 44 27422 0.09% 45 29184 0.10% 46 30346 0.10% 47 31850 0.11% 48 33669 0.11% 49 35061 0.12% 50 37551 0.13% 51 38618 0.13% 52 40039 0.14% 53 42013 0.14% 54 43950 0.15% 55 46891 0.16% 56 50152 0.17% 57 60312 0.21% 58 57806 0.20% 59 121465 0.41% 60 119757 0.41% 61 118779 0.41% 62 115583 0.39% 63 111111 0.38% 64 110618 0.38% 65 112093 0.38% 66 112280 0.38% 67 117202 0.40% 68 135595 0.46% 69 118791 0.41% 70 174932 0.60% 71 133052 0.45% 72 121270 0.41% 73 124222 0.42% 74 128622 0.44% 75 123731 0.42% 76 120480 0.41% 77 120839 0.41% 78 119356 0.41% 79 129869 0.44% 80 136791 0.47% 81 143824 0.49% 82 150951 0.52% 83 159499 0.54% 84 164605 0.56% 85 167988 0.57% 86 174489 0.60% 87 187794 0.64% 88 170648 0.58% 89 204026 0.70% 90 230644 0.79% 91 264899 0.90% 92 299027 1.02% 93 335865 1.15% 94 388373 1.33% 95 458014 1.56% 96 571542 1.95% 97 766578 2.62% 98 1050209 3.59% 99 1735196 5.93% 100 18029811 61.57% 29285679 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.06 prefix-fanout=2.0 sequence=GTCGTTGGATTCTACAACTGGTGAAAATATTACTGGGAGTCCATCGCTCATTGGAGAAAACATAACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=304.39 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.9 sequence=TTCTTCTTCTTC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.06 prefix-fanout=2.0 sequence=CCCGCCATCCTACATGTGGCTGCATCAAAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=329.77 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=30.2 sequence=TTCTTCTTCTTC SRR2029745 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:31:25 Started mapping on | Feb 13 01:31:26 Finished on | Feb 13 01:32:44 Mapping speed, Million of reads per hour | 1351.65 Number of input reads | 29285679 Average input read length | 188 UNIQUE READS: Uniquely mapped reads number | 26025841 Uniquely mapped reads % | 88.87% Average mapped length | 188.47 Number of splices: Total | 16097104 Number of splices: Annotated (sjdb) | 15807865 Number of splices: GT/AG | 15835267 Number of splices: GC/AG | 220859 Number of splices: AT/AC | 13253 Number of splices: Non-canonical | 27725 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1083972 % of reads mapped to multiple loci | 3.70% Number of reads mapped to too many loci | 55603 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.21% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2621083 2621083 2621083 N_multimapping 1083972 1083972 1083972 N_noFeature 1042251 13406890 13555871 N_ambiguous 239132 68023 66447 UnstrandedReadsAssigned:24744458 PositiveStrandReadsAssigned:12550928 NegativeStrandReadsAssigned:12403523 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=99 echo kmer=95 SRR2029745 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR2029745-trimmed-pair1.fastq SRR2029745-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,285,679 reads, 25,791,093 reads pseudoaligned [quant] estimated average fragment length: 157.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR2029745.ke.tsv 34699 SRR2029745.se.tsv 87100 total ==> SRR2029745.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1861.35 4157 112.299 Potri.005G024800.1.v4.1 1035 878.351 369 21.1243 Potri.004G059700.1.v4.1 961 804.36 36 2.25049 Potri.007G009000.2.v4.1 1416 1259.35 0 0 Potri.003G141000.2.v4.1 2943 2786.35 1473.89 26.5983 Potri.016G087400.1.v4.1 270 118.156 985.602 419.44 Potri.015G069301.1.v4.1 564 407.426 0 0 Potri.010G195200.1.v4.1 1773 1616.35 2727.7 84.8566 Potri.012G127500.1.v4.1 977 820.356 24852 1523.29 ==> SRR2029745.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 824 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 458 SRR2029745 completed mapping pipeline successfully