Starting /dee2/code/volunteer_pipeline.sh SRR2029746 current disk space = 3050512494592 free memory = 1579735464 SRR2029746 SRAfilesize 67f6940ac6f66e224f2015759ab0e56d SRR2029746.sra SRR2029746.sra file validated SRR2029746 is paired end SRR2029746 is conventional basespace SRR2029746 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029746_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.44425 31.0 31.0 34.0 27.0 34.0 2 30.9765 33.0 31.0 34.0 27.0 34.0 3 31.302 34.0 31.0 34.0 28.0 34.0 4 34.80925 37.0 35.0 37.0 32.0 37.0 5 34.48875 37.0 35.0 37.0 31.0 37.0 6 34.33825 37.0 35.0 37.0 30.0 37.0 7 34.353 37.0 35.0 37.0 31.0 37.0 8 34.25425 37.0 35.0 37.0 30.0 37.0 9 35.626 39.0 35.0 39.0 30.0 39.0 10-11 35.607625 39.0 36.0 39.0 29.5 39.0 12-13 35.859375 39.0 35.0 39.0 30.0 39.0 14-15 36.917249999999996 40.0 37.0 41.0 30.5 41.0 16-17 36.950625 40.0 37.0 41.0 31.0 41.0 18-19 36.898375 40.0 37.0 41.0 30.5 41.0 20-21 36.713499999999996 40.0 37.0 41.0 30.0 41.0 22-23 36.427875 40.0 36.5 41.0 29.0 41.0 24-25 36.38375 40.0 36.0 41.0 29.5 41.0 26-27 36.308625 40.0 36.0 41.0 29.0 41.0 28-29 36.382374999999996 40.0 36.0 41.0 29.5 41.0 30-31 36.387875 40.0 36.0 41.0 29.5 41.0 32-33 36.035875000000004 39.5 36.0 41.0 27.0 41.0 34-35 35.794375 39.0 35.5 41.0 27.0 41.0 36-37 35.795874999999995 39.0 35.0 41.0 27.5 41.0 38-39 35.543000000000006 39.0 35.0 41.0 26.5 41.0 40-41 35.447625 39.0 35.0 40.5 26.0 41.0 42-43 35.32875 39.0 35.0 40.0 26.0 41.0 44-45 35.08925 39.0 35.0 40.0 25.0 41.0 46-47 35.441874999999996 39.0 35.0 41.0 26.0 41.0 48-49 35.054874999999996 39.0 35.0 40.5 24.5 41.0 50-51 34.964875 39.0 34.5 40.0 24.0 41.0 52-53 34.641000000000005 39.0 34.0 40.0 23.0 41.0 54-55 34.671875 38.5 34.0 40.0 24.0 41.0 56-57 34.49975 38.0 34.0 40.0 23.0 41.0 58-59 34.157624999999996 38.0 34.0 40.0 22.5 41.0 60-61 33.86275 38.0 33.5 40.0 22.0 41.0 62-63 33.36275 37.0 32.0 40.0 20.0 41.0 64-65 33.040000000000006 37.0 32.0 39.5 19.5 41.0 66-67 32.3495 36.0 31.0 39.0 15.5 41.0 68-69 32.232124999999996 36.0 31.0 39.0 15.5 40.0 70-71 31.770375 35.0 31.0 38.0 13.0 40.0 72-73 31.395249999999997 35.0 31.0 37.5 10.5 39.5 74-75 30.933500000000002 35.0 30.0 37.0 8.0 39.0 76-77 29.093249999999998 32.5 27.5 35.0 8.0 36.5 78-79 30.489874999999998 34.0 30.5 36.0 10.0 38.0 80-81 30.463875 34.5 30.5 36.0 7.0 37.0 82-83 30.09075 34.0 30.5 35.5 4.0 37.0 84-85 29.79475 34.0 30.0 35.0 2.0 36.5 86-87 29.32825 34.0 30.0 35.0 2.0 36.0 88-89 28.94175 34.0 29.0 35.0 2.0 36.0 90-91 28.591124999999998 34.0 29.0 35.0 2.0 35.0 92-93 28.415374999999997 34.0 29.0 35.0 2.0 35.0 94-95 27.7475 34.0 29.0 35.0 2.0 35.0 96-97 27.14075 33.5 27.0 35.0 2.0 35.0 98-99 26.103125 33.0 25.0 35.0 2.0 35.0 100 23.97675 30.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 76.0 3 23.0 4 12.0 5 8.0 6 7.0 7 8.0 8 10.0 9 15.0 10 14.0 11 22.0 12 12.0 13 12.0 14 14.0 15 13.0 16 18.0 17 20.0 18 24.0 19 16.0 20 18.0 21 15.0 22 33.0 23 27.0 24 34.0 25 34.0 26 50.0 27 63.0 28 69.0 29 73.0 30 69.0 31 118.0 32 132.0 33 182.0 34 233.0 35 312.0 36 512.0 37 862.0 38 768.0 39 72.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.24130879345603 17.101226993865033 14.008179959100204 30.649284253578735 2 23.7 18.275 34.125 23.9 3 25.6 21.125 29.825000000000003 23.45 4 27.35 25.124999999999996 23.849999999999998 23.674999999999997 5 26.125 29.925 24.725 19.225 6 19.85 34.725 26.224999999999998 19.2 7 19.3 21.325 40.35 19.025 8 19.175 24.099999999999998 32.2 24.525 9 21.46609957468101 24.518388791593697 31.17338003502627 22.842131598699027 10-11 21.625 32.9625 25.624999999999996 19.787499999999998 12-13 21.875 26.35 30.9875 20.7875 14-15 19.662499999999998 28.487499999999997 30.7125 21.1375 16-17 20.8625 27.35 30.0375 21.75 18-19 20.3625 29.2875 28.275 22.075 20-21 21.45268158519815 28.066008251031377 29.078634829353668 21.402675334416802 22-23 21.925 28.487499999999997 28.15 21.4375 24-25 20.849999999999998 28.3875 28.425 22.3375 26-27 20.974999999999998 29.15 28.025 21.85 28-29 22.400000000000002 28.4375 27.625 21.5375 30-31 21.837500000000002 28.575 28.175 21.4125 32-33 21.1625 29.225 27.750000000000004 21.8625 34-35 21.987499999999997 27.737499999999997 28.549999999999997 21.725 36-37 21.3 28.199999999999996 28.575 21.925 38-39 22.525000000000002 27.5875 27.537499999999998 22.35 40-41 21.683131174190322 28.323121170438913 28.09803676378642 21.895710891584343 42-43 21.1125 28.462500000000002 28.037499999999998 22.3875 44-45 21.875 28.775000000000002 27.8125 21.5375 46-47 21.875 29.325000000000003 27.200000000000003 21.6 48-49 22.05 28.0875 27.250000000000004 22.6125 50-51 21.825 28.575 28.175 21.425 52-53 21.0125 28.65 28.225 22.112499999999997 54-55 21.675 28.549999999999997 27.5125 22.2625 56-57 21.6625 28.3375 27.6375 22.3625 58-59 21.6 28.6125 27.712500000000002 22.075 60-61 21.5375 27.6 28.712500000000002 22.15 62-63 21.2375 28.875 27.737499999999997 22.15 64-65 22.662499999999998 28.8375 26.2625 22.237499999999997 66-67 21.025 29.5375 27.275 22.162499999999998 68-69 22.225 27.450000000000003 28.199999999999996 22.125 70-71 21.95 27.925 28.325 21.8 72-73 22.1375 28.037499999999998 28.299999999999997 21.525 74-75 21.4125 28.075 27.762500000000003 22.75 76-77 21.8 28.237499999999997 27.6375 22.325 78-79 21.675 28.3375 27.787499999999998 22.2 80-81 20.974999999999998 28.1125 28.7375 22.175 82-83 21.987499999999997 28.0875 27.8625 22.0625 84-85 20.974999999999998 27.5125 28.525 22.9875 86-87 21.6875 29.5875 26.9625 21.762500000000003 88-89 21.925 28.237499999999997 28.125 21.712500000000002 90-91 22.6875 27.6875 28.012500000000003 21.6125 92-93 21.6125 28.15 28.775000000000002 21.462500000000002 94-95 21.675 27.900000000000002 27.875 22.55 96-97 21.587500000000002 28.5875 27.625 22.2 98-99 21.95 28.3625 27.975 21.712500000000002 100 21.85 27.900000000000002 28.475 21.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 2.5 18 2.5 19 1.0 20 1.0 21 3.0 22 2.5 23 1.0 24 2.0 25 6.0 26 6.5 27 6.5 28 11.5 29 13.0 30 17.0 31 26.0 32 31.5 33 34.0 34 49.0 35 67.5 36 80.5 37 109.5 38 139.5 39 160.5 40 189.0 41 229.0 42 263.0 43 281.5 44 289.5 45 293.0 46 283.5 47 267.5 48 234.5 49 187.5 50 150.0 51 119.0 52 97.0 53 81.5 54 67.5 55 47.5 56 32.5 57 25.0 58 20.5 59 15.0 60 8.5 61 7.5 62 7.0 63 5.0 64 4.5 65 2.5 66 2.5 67 2.5 68 2.5 69 3.0 70 1.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.075 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0375 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR2029746 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029746_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.778 31.0 30.0 34.0 16.0 34.0 2 28.8605 31.0 30.0 34.0 16.0 34.0 3 28.79675 31.0 30.0 34.0 10.0 34.0 4 31.89625 37.0 35.0 37.0 10.0 37.0 5 31.64525 37.0 33.0 37.0 10.0 37.0 6 31.52575 37.0 33.0 37.0 10.0 37.0 7 31.5235 37.0 33.0 37.0 8.0 37.0 8 31.443 37.0 33.0 37.0 8.0 37.0 9 32.6975 39.0 34.0 39.0 8.0 39.0 10-11 32.68075 39.0 34.0 39.0 2.0 39.0 12-13 32.58675 39.0 33.5 39.0 2.0 39.0 14-15 33.499875 39.0 34.0 41.0 2.0 41.0 16-17 33.341125 39.0 33.5 41.0 2.0 41.0 18-19 33.245125 39.5 34.0 41.0 2.0 41.0 20-21 33.108375 39.0 33.0 41.0 2.0 41.0 22-23 33.013875 39.0 33.5 41.0 2.0 41.0 24-25 32.892875000000004 39.0 33.0 41.0 2.0 41.0 26-27 32.34675 39.0 32.0 40.5 2.0 41.0 28-29 32.40025 39.0 32.5 40.0 2.0 41.0 30-31 32.123625000000004 38.5 31.5 40.5 2.0 41.0 32-33 32.2715 38.5 32.0 40.0 2.0 41.0 34-35 32.192750000000004 38.5 32.0 41.0 2.0 41.0 36-37 32.088 38.0 31.5 40.0 2.0 41.0 38-39 31.802374999999998 38.0 31.0 40.0 2.0 41.0 40-41 31.8075 38.0 31.0 40.0 2.0 41.0 42-43 31.549125 38.0 30.5 40.0 2.0 41.0 44-45 31.445375 38.0 30.5 40.0 2.0 41.0 46-47 31.17475 38.0 30.0 40.0 2.0 41.0 48-49 31.176 38.0 30.0 40.0 2.0 41.0 50-51 29.790125 36.0 28.0 39.0 2.0 40.0 52-53 30.220999999999997 37.5 29.0 39.0 2.0 39.5 54-55 30.7225 38.0 29.5 40.0 2.0 41.0 56-57 30.945500000000003 38.0 29.0 40.0 2.0 41.0 58-59 31.07025 38.0 29.5 40.0 2.0 41.0 60-61 30.922875 38.0 29.0 40.0 2.0 41.0 62-63 30.551875 37.0 28.5 40.0 2.0 41.0 64-65 30.433999999999997 37.0 28.5 40.0 2.0 41.0 66-67 29.609375 36.0 27.0 39.0 2.0 41.0 68-69 29.475625 35.0 28.0 39.0 2.0 41.0 70-71 29.280875 35.0 28.0 39.0 2.0 40.0 72-73 28.861874999999998 35.0 27.0 37.5 2.0 40.0 74-75 28.519624999999998 35.0 26.5 37.0 2.0 39.0 76-77 28.256375 35.0 26.5 37.0 2.0 39.0 78-79 27.796125 34.5 26.0 36.0 2.0 38.5 80-81 27.386625 34.0 26.0 36.0 2.0 37.0 82-83 26.8135 34.0 24.0 35.0 2.0 37.0 84-85 26.6555 34.0 24.5 35.0 2.0 36.0 86-87 26.271875 34.0 23.0 35.0 2.0 36.0 88-89 26.11975 34.0 23.5 35.0 2.0 36.0 90-91 25.560625 33.0 19.5 35.0 2.0 35.0 92-93 25.26125 33.0 18.0 35.0 2.0 35.0 94-95 24.921625 33.0 9.0 35.0 2.0 35.0 96-97 24.601625 33.0 2.0 35.0 2.0 35.0 98-99 23.93575 32.5 2.0 35.0 2.0 35.0 100 21.835 29.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 337.0 3 65.0 4 37.0 5 33.0 6 30.0 7 17.0 8 21.0 9 15.0 10 13.0 11 17.0 12 16.0 13 18.0 14 20.0 15 11.0 16 14.0 17 9.0 18 20.0 19 28.0 20 23.0 21 22.0 22 28.0 23 30.0 24 35.0 25 31.0 26 45.0 27 44.0 28 52.0 29 73.0 30 87.0 31 86.0 32 126.0 33 138.0 34 199.0 35 285.0 36 415.0 37 742.0 38 738.0 39 80.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.8097024256064 18.30457614403601 13.353338334583645 29.532383095773945 2 23.849999999999998 19.375 31.65 25.124999999999996 3 24.65 22.2 28.325 24.825 4 28.249999999999996 24.349999999999998 23.125 24.275 5 25.75 29.049999999999997 24.5 20.7 6 22.2 31.874999999999996 26.474999999999998 19.45 7 20.424999999999997 21.05 39.574999999999996 18.95 8 21.025 24.099999999999998 32.125 22.75 9 21.725 24.425 31.45 22.400000000000002 10-11 21.725 31.924999999999997 26.6125 19.7375 12-13 20.45 27.400000000000002 31.662499999999998 20.4875 14-15 20.816122167980975 28.138690699712104 30.55451245462511 20.490674677681813 16-17 21.46793587174349 28.95791583166333 28.79509018036072 20.779058116232466 18-19 21.611125031320473 28.55174141819093 28.927587070909546 20.909546479579053 20-21 21.194291437155734 28.955933900851278 28.229844767150723 21.61992989484226 22-23 20.947724708537045 29.05854331202206 28.29384480381096 21.699887175629936 24-25 21.692789968652036 27.485893416927897 29.504702194357368 21.316614420062695 26-27 22.016048144433302 28.42276830491474 27.770812437311935 21.790371113340022 28-29 22.1665623043206 28.966812773951155 28.202880400751408 20.66374452097683 30-31 21.71571696931747 28.854101440200374 28.766437069505322 20.66374452097683 32-33 21.9814629258517 28.43186372745491 28.35671342685371 21.22995991983968 34-35 21.60030052592036 28.33708990733784 28.36213373403456 21.700475832707237 36-37 22.094188376753507 27.367234468937873 29.396292585170343 21.142284569138276 38-39 21.563951299108826 28.793774319066145 28.203840843479348 21.438433538345674 40-41 21.54212041557141 28.576793090499436 28.238828389034925 21.64225810489423 42-43 21.78714859437751 28.790160642570285 27.899096385542173 21.52359437751004 44-45 21.937751004016064 27.56024096385542 29.191767068273094 21.310240963855424 46-47 22.904116465863453 27.48493975903614 27.397088353413658 22.213855421686745 48-49 21.91815214662315 28.320361536530253 28.119507908611602 21.641978408234998 50-51 21.79969879518072 28.150100401606426 28.940763052208833 21.109437751004016 52-53 22.075803212851405 28.463855421686745 28.11244979919679 21.34789156626506 54-55 21.586345381526105 28.463855421686745 27.735943775100402 22.213855421686745 56-57 21.34789156626506 28.727409638554217 28.20030120481928 21.72439759036145 58-59 22.399297276948175 27.694817417492786 28.146567950809388 21.759317354749655 60-61 21.994981179422833 28.53199498117942 27.49058971141782 21.982434127979925 62-63 22.47458903250094 27.64462291379094 27.970887187852927 21.90990086585519 64-65 21.307566821433053 28.334797339691303 28.297151461914922 22.060484376960723 66-67 21.79969879518072 29.32981927710843 27.81124497991968 21.059236947791167 68-69 22.04793575103526 27.782657798971012 27.84540092859832 22.324005521395407 70-71 22.34910277324633 28.66106161375329 28.008533065629315 20.981302547371065 72-73 21.721671476973274 27.95833856192747 28.686158865604217 21.633831095495044 74-75 21.674196787148595 27.547690763052206 28.225401606425706 22.552710843373493 76-77 21.721671476973274 28.28460283598946 28.510478102647763 21.48324758438951 78-79 21.4930991217064 27.327478042659976 29.14680050188206 22.03262233375157 80-81 22.17063989962359 27.365119196988708 28.670012547051442 21.794228356336262 82-83 20.966729441305713 27.859384808537353 29.27809165097301 21.89579409918393 84-85 21.628402960732657 28.014050934638064 27.825868774306862 22.53167733032242 86-87 21.16422029858236 27.876050683728515 29.205871283402335 21.75385773428679 88-89 21.606022584692596 28.444165621079048 27.302383939774156 22.647427854454204 90-91 22.763207428786547 28.259505584138537 28.35989459154223 20.61739239553269 92-93 22.882950696273994 28.540960983565423 27.90114163843934 20.67494668172124 94-95 22.14832475843895 28.272054210063995 27.64462291379094 21.93499811770611 96-97 22.145545796737768 28.469259723964868 28.243412797992473 21.141781681304895 98-99 22.30865746549561 27.95483061480552 28.180677540777914 21.555834378920956 100 23.1058705469142 28.02308078273959 27.270446562970395 21.600602107375817 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 2.0 13 3.0 14 4.0 15 3.5 16 4.0 17 4.5 18 5.5 19 5.0 20 5.0 21 6.5 22 7.0 23 7.0 24 7.0 25 9.5 26 14.0 27 13.0 28 15.0 29 20.0 30 26.5 31 33.5 32 39.5 33 44.5 34 55.0 35 72.0 36 85.0 37 106.5 38 126.0 39 148.5 40 188.5 41 235.5 42 248.0 43 249.0 44 261.0 45 250.0 46 251.0 47 241.5 48 219.0 49 199.5 50 155.5 51 119.0 52 101.5 53 83.5 54 66.5 55 50.5 56 37.0 57 28.5 58 21.5 59 21.0 60 17.5 61 11.5 62 9.0 63 7.0 64 7.5 65 6.0 66 5.5 67 6.5 68 4.5 69 3.5 70 1.5 71 0.5 72 1.5 73 2.0 74 3.0 75 2.5 76 0.5 77 0.5 78 0.5 79 0.0 80 1.0 81 1.0 82 0.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.13749999999999998 16-17 0.2 18-19 0.22499999999999998 20-21 0.15 22-23 0.2875 24-25 0.3125 26-27 0.3 28-29 0.1875 30-31 0.1875 32-33 0.2 34-35 0.17500000000000002 36-37 0.2 38-39 0.41250000000000003 40-41 0.13749999999999998 42-43 0.4 44-45 0.4 46-47 0.4 48-49 0.42500000000000004 50-51 0.4 52-53 0.4 54-55 0.4 56-57 0.4 58-59 0.3875 60-61 0.375 62-63 0.3875 64-65 0.3875 66-67 0.4 68-69 0.3875 70-71 0.3875 72-73 0.3875 74-75 0.4 76-77 0.3875 78-79 0.375 80-81 0.375 82-83 0.43750000000000006 84-85 0.36250000000000004 86-87 0.36250000000000004 88-89 0.375 90-91 0.3875 92-93 0.36250000000000004 94-95 0.3875 96-97 0.375 98-99 0.375 100 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra Read 1535340 spots for SRR2029746.sra Written 1535340 spots for SRR2029746.sra Read 1535336 spots for SRR2029746.sra Written 1535336 spots for SRR2029746.sra SRR ids: ['SRR2029746.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_teiq7sx6 SRR2029746.sra spots: 30706724 blocks: [[1, 1535336], [1535337, 3070672], [3070673, 4606008], [4606009, 6141344], [6141345, 7676680], [7676681, 9212016], [9212017, 10747352], [10747353, 12282688], [12282689, 13818024], [13818025, 15353360], [15353361, 16888696], [16888697, 18424032], [18424033, 19959368], [19959369, 21494704], [21494705, 23030040], [23030041, 24565376], [24565377, 26100712], [26100713, 27636048], [27636049, 29171384], [29171385, 30706724]] SRR2029746 file size 8340106 SRR2029746 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2029746 SRR2029746_1.fastq SRR2029746_2.fastq Input file: SRR2029746_1.fastq Paired file: SRR2029746_2.fastq trimmed: SRR2029746-trimmed-pair1.fastq, SRR2029746-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:25:39 2025 >> started Thu Feb 13 01:27:22 2025 >> done (103.342s) 30706724 read pairs processed; of these: 1475102 ( 4.80%) short read pairs filtered out after trimming by size control 2270444 ( 7.39%) empty read pairs filtered out after trimming by size control 26961178 (87.80%) read pairs available; of these: 10148750 (37.64%) trimmed read pairs available after processing 16812428 (62.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 420 0.00% 19 929 0.00% 20 1389 0.01% 21 1771 0.01% 22 2346 0.01% 23 2820 0.01% 24 3224 0.01% 25 3878 0.01% 26 4418 0.02% 27 5155 0.02% 28 6025 0.02% 29 6961 0.03% 30 7707 0.03% 31 8824 0.03% 32 9771 0.04% 33 10763 0.04% 34 11855 0.04% 35 12877 0.05% 36 13773 0.05% 37 14656 0.05% 38 15909 0.06% 39 17085 0.06% 40 18387 0.07% 41 19499 0.07% 42 20476 0.08% 43 21510 0.08% 44 22920 0.09% 45 23738 0.09% 46 25680 0.10% 47 26299 0.10% 48 27187 0.10% 49 28364 0.11% 50 29778 0.11% 51 30994 0.11% 52 32931 0.12% 53 35357 0.13% 54 36932 0.14% 55 38493 0.14% 56 40837 0.15% 57 44181 0.16% 58 47822 0.18% 59 113472 0.42% 60 114718 0.43% 61 117886 0.44% 62 108735 0.40% 63 102248 0.38% 64 102030 0.38% 65 101553 0.38% 66 105228 0.39% 67 104784 0.39% 68 120485 0.45% 69 104277 0.39% 70 124090 0.46% 71 111006 0.41% 72 105988 0.39% 73 110794 0.41% 74 110727 0.41% 75 101497 0.38% 76 99178 0.37% 77 101810 0.38% 78 103853 0.39% 79 115745 0.43% 80 114456 0.42% 81 119181 0.44% 82 126233 0.47% 83 139633 0.52% 84 149439 0.55% 85 147469 0.55% 86 160397 0.59% 87 167569 0.62% 88 155940 0.58% 89 185869 0.69% 90 212010 0.79% 91 244322 0.91% 92 278302 1.03% 93 312609 1.16% 94 362048 1.34% 95 427292 1.58% 96 529712 1.96% 97 710332 2.63% 98 976927 3.62% 99 1614965 5.99% 100 16812428 62.36% 26961178 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=32 prefix-density=0.10 prefix-fanout=2.3 sequence=GCTCTCCACCTCCAAGGTGATGGTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=56.57 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.3 sequence=ATTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTAATCCAACCTAGTACGAGAGGAACCGTTGATTCGCACAATTGGTCATCGCGCTTGGTTGAAAAGCCAGTGGCGCGAAGCTACCGTGCGTTGGATTATGACTGAACGCCTCTAAGTCAGAATCCGGGCTAGATGCGACGCGTGCGCCCGCCGTCCGATTGCCGACCTGCAG criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=25 prefix-density=0.12 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCACATTGTCGATGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=64.23 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.3 sequence=AAAGAAAAATGACTTCTATGAGCTCTTCAATGCTGCCATTTCTAATTTGTCTTCTC SRR2029746 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:28:42 Started mapping on | Feb 13 01:28:42 Finished on | Feb 13 01:30:32 Mapping speed, Million of reads per hour | 882.37 Number of input reads | 26961178 Average input read length | 188 UNIQUE READS: Uniquely mapped reads number | 24173452 Uniquely mapped reads % | 89.66% Average mapped length | 188.89 Number of splices: Total | 12916729 Number of splices: Annotated (sjdb) | 12609602 Number of splices: GT/AG | 12699509 Number of splices: GC/AG | 173169 Number of splices: AT/AC | 11563 Number of splices: Non-canonical | 32488 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1263221 % of reads mapped to multiple loci | 4.69% Number of reads mapped to too many loci | 313195 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1929652 1929652 1929652 N_multimapping 1263221 1263221 1263221 N_noFeature 1481320 12670939 12846860 N_ambiguous 247237 56341 54683 UnstrandedReadsAssigned:22444895 PositiveStrandReadsAssigned:11446172 NegativeStrandReadsAssigned:11271909 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=99 echo kmer=95 SRR2029746 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR2029746-trimmed-pair1.fastq SRR2029746-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,961,178 reads, 23,810,522 reads pseudoaligned [quant] estimated average fragment length: 155.296 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR2029746.ke.tsv 34699 SRR2029746.se.tsv 87100 total ==> SRR2029746.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1863.7 2539 63.9172 Potri.005G024800.1.v4.1 1035 880.704 1687 89.8706 Potri.004G059700.1.v4.1 961 806.709 9 0.523429 Potri.007G009000.2.v4.1 1416 1261.7 0 0 Potri.003G141000.2.v4.1 2943 2788.7 1355.51 22.8052 Potri.016G087400.1.v4.1 270 119.964 705.372 275.867 Potri.015G069301.1.v4.1 564 409.743 0 0 Potri.010G195200.1.v4.1 1773 1618.7 1544 44.752 Potri.012G127500.1.v4.1 977 822.709 18119 1033.28 ==> SRR2029746.se.tsv <== Potri.001G166300.v4.1 8 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 36 Potri.001G122700.v4.1 816 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 149 Potri.001G452600.v4.1 831 SRR2029746 completed mapping pipeline successfully