Starting /dee2/code/volunteer_pipeline.sh SRR2029776 current disk space = 3050507149312 free memory = 1574846748 SRR2029776 SRAfilesize 175ef29018b73cbd00ac9e7bd3689855 SRR2029776.sra SRR2029776.sra file validated SRR2029776 is paired end SRR2029776 is conventional basespace SRR2029776 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.55975 31.0 30.0 33.0 18.0 34.0 2 29.47125 31.0 30.0 34.0 23.0 34.0 3 30.06725 31.0 30.0 34.0 26.0 34.0 4 33.92575 35.0 35.0 37.0 30.0 37.0 5 33.575 35.0 35.0 37.0 28.0 37.0 6 33.40075 36.0 35.0 37.0 28.0 37.0 7 32.9355 35.0 33.0 37.0 26.0 37.0 8 33.07325 35.0 33.0 37.0 26.0 37.0 9 34.36275 38.0 34.0 39.0 27.0 39.0 10-11 34.577124999999995 38.0 35.0 39.0 27.0 39.0 12-13 34.36825 38.0 34.5 39.0 27.0 39.0 14-15 35.409125 39.0 35.0 41.0 27.0 41.0 16-17 35.227000000000004 38.5 34.0 40.5 27.0 41.0 18-19 35.198750000000004 39.0 34.5 40.0 27.0 41.0 20-21 35.076625 39.0 34.0 40.0 25.5 41.0 22-23 35.028625000000005 38.5 34.0 40.0 26.0 41.0 24-25 34.696250000000006 38.0 34.0 40.0 24.0 41.0 26-27 34.513999999999996 38.0 34.0 40.0 24.0 41.0 28-29 34.435500000000005 38.0 33.5 40.0 24.0 41.0 30-31 34.017624999999995 38.0 32.5 40.0 20.0 41.0 32-33 34.155375 38.0 33.0 40.0 22.5 41.0 34-35 34.0145 38.0 33.0 40.0 21.0 41.0 36-37 33.759 38.0 33.0 40.0 20.5 41.0 38-39 33.636250000000004 38.0 33.0 40.0 18.5 41.0 40-41 33.585625 38.0 33.0 40.0 18.0 41.0 42-43 33.301874999999995 38.0 32.0 40.0 17.0 41.0 44-45 33.569125 38.0 33.0 40.0 18.5 41.0 46-47 33.574 38.0 33.0 40.0 18.0 41.0 48-49 33.2685 38.0 32.0 40.0 16.0 41.0 50-51 33.042249999999996 38.0 32.0 40.0 14.5 41.0 52-53 32.837 38.0 31.5 40.0 10.5 41.0 54-55 32.730625 37.5 31.5 40.0 10.0 41.0 56-57 32.276875000000004 37.0 31.0 40.0 8.0 41.0 58-59 32.056625 37.0 31.0 40.0 7.0 41.0 60-61 31.64 36.0 30.0 39.0 4.0 41.0 62-63 31.264875 36.0 29.0 39.0 2.0 40.0 64-65 30.778624999999998 35.0 29.0 39.0 2.0 40.0 66-67 29.725250000000003 34.0 28.0 38.0 2.0 40.0 68-69 29.3995 34.0 26.5 38.0 2.0 40.0 70-71 29.199625 34.0 27.0 37.0 2.0 39.0 72-73 28.685375 33.5 26.0 36.5 2.0 39.0 74-75 28.12175 33.5 26.0 36.0 2.0 39.0 76-77 26.4465 31.0 24.5 34.0 2.0 36.0 78-79 27.7935 33.0 26.0 35.0 2.0 37.0 80-81 28.043 33.5 26.0 35.0 2.0 37.0 82-83 27.77175 33.0 26.0 35.0 2.0 36.5 84-85 27.444499999999998 33.0 26.0 35.0 2.0 36.0 86-87 26.900125 33.0 26.0 35.0 2.0 36.0 88-89 26.497625 33.0 25.0 35.0 2.0 35.0 90-91 26.166874999999997 32.0 24.5 35.0 2.0 35.0 92-93 25.7705 32.0 23.5 34.5 2.0 35.0 94-95 25.3315 32.0 21.5 34.0 2.0 35.0 96-97 24.449125000000002 31.5 12.0 34.0 2.0 35.0 98-99 23.81325 31.0 2.0 34.0 2.0 35.0 100 21.246 27.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 128.0 3 37.0 4 24.0 5 9.0 6 18.0 7 9.0 8 6.0 9 12.0 10 13.0 11 20.0 12 26.0 13 15.0 14 25.0 15 21.0 16 19.0 17 28.0 18 39.0 19 25.0 20 38.0 21 35.0 22 30.0 23 37.0 24 39.0 25 52.0 26 58.0 27 90.0 28 88.0 29 107.0 30 126.0 31 166.0 32 193.0 33 211.0 34 310.0 35 407.0 36 498.0 37 629.0 38 387.0 39 25.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.8712715855573 18.367346938775512 15.934065934065933 29.82731554160126 2 24.75 19.925 31.275 24.05 3 25.05 24.075 28.4 22.475 4 27.656914228557138 28.00700175043761 21.85546386596649 22.48062015503876 5 25.624999999999996 32.525 23.3 18.55 6 19.36452339254441 34.450838128596445 26.770077558168627 19.41456092069052 7 18.40260390585879 23.73560340510766 38.758137205808715 19.103655483224838 8 21.038114343029086 24.82447342026078 30.842527582748247 23.294884653961887 9 20.386158475426278 25.501504513540624 32.64794383149449 21.464393179538614 10-11 22.5802407221665 31.61985957873621 25.601805416248745 20.198094282848544 12-13 20.238095238095237 27.29323308270677 30.852130325814535 21.616541353383457 14-15 19.962382445141067 29.191222570532915 29.88087774294671 20.96551724137931 16-17 21.940822467402207 28.09679037111334 28.497993981945836 21.464393179538614 18-19 21.592476489028215 29.01567398119122 28.17554858934169 21.21630094043887 20-21 21.356909957361424 29.219964885879108 29.107098068723353 20.31602708803612 22-23 20.428893905191874 29.16980185603211 29.044394281414597 21.356909957361424 24-25 21.266457680250785 27.82445141065831 28.752351097178686 22.156739811912228 26-27 21.588058203712997 28.863522328148523 27.621675865529355 21.92674360260913 28-29 22.37683339601354 27.930299611382726 28.3314529271656 21.361414065438133 30-31 21.2227511901779 28.71460786770233 28.088198446504638 21.974442495615136 32-33 21.459927254483883 28.433462937413772 28.13244700865421 21.974162799448138 34-35 21.99373040752351 27.924764890282134 29.0282131661442 21.053291536050157 36-37 21.595184349134687 28.254326561324305 28.71833458740908 21.43215450213193 38-39 21.592476489028215 28.23824451410658 28.451410658307207 21.717868338557995 40-41 21.617554858934167 29.529780564263326 27.87460815047022 20.97805642633229 42-43 21.391849529780565 27.94984326018809 28.26332288401254 22.394984326018808 44-45 22.12467076382792 27.88160040135457 28.42092060704879 21.572808227768718 46-47 21.793103448275865 27.27272727272727 28.50156739811912 22.43260188087774 48-49 21.889111891620672 28.161063723030605 28.03562468640241 21.914199698946312 50-51 21.369450714823177 28.693253072485582 28.053674441936295 21.883621770754953 52-53 21.758214196137445 28.542763982944567 28.36719337848006 21.33182844243792 54-55 21.489468405215646 28.184553660982946 28.761283851554666 21.564694082246742 56-57 21.51454363089268 28.610832497492478 28.059177532597797 21.81544633901705 58-59 21.843260188087772 27.987460815047022 27.79937304075235 22.369905956112852 60-61 22.422874341610232 27.577125658389768 28.66817155756208 21.33182844243792 62-63 21.896162528216703 28.58038625532982 28.467519438174065 21.055931778279408 64-65 21.595184349134687 28.680712315023825 27.715073990469026 22.00902934537246 66-67 21.871081013293203 27.326310509154755 28.179082016553803 22.623526460998246 68-69 21.748400852878465 29.098206446757807 27.98193904427443 21.1714536560893 70-71 21.54945468221136 28.63231791400276 27.554218377836282 22.264009025949605 72-73 22.322548281916227 28.480060195635815 27.890644594933534 21.30674692751442 74-75 22.148408122336424 28.854349461017797 27.93933316620707 21.057909250438705 76-77 22.66399096952214 28.40837827668381 27.1039759187257 21.823654835068357 78-79 21.8459994983697 28.179082016553803 28.31703034863306 21.65788813644344 80-81 22.322548281916227 27.85302232254828 28.49260095309757 21.33182844243792 82-83 22.799097065462753 28.091296714321544 27.45171808377226 21.65788813644344 84-85 20.850050150451356 27.30692076228686 29.33801404212638 22.50501504513541 86-87 21.65245737211635 28.43530591775326 28.761283851554666 21.150952858575728 88-89 22.135873652544497 28.202557031837554 27.788919528703936 21.872649786914014 90-91 21.521684632740033 29.155176736024067 27.625971421408874 21.697167209827022 92-93 22.191574724172515 28.93681043129388 27.4197592778335 21.4518555667001 94-95 22.040255031878985 27.19089886235779 28.86610826353294 21.90273784223028 96-97 21.47415842823176 27.943936929045176 29.670879739707175 20.911024903015893 98-99 22.863221123764234 28.819922412714305 27.43085971718183 20.885996746339632 100 25.1 26.950000000000003 26.950000000000003 21.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 1.5 6 2.5 7 1.5 8 0.5 9 2.5 10 2.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 2.0 22 1.5 23 0.0 24 2.0 25 4.5 26 5.5 27 6.0 28 8.5 29 14.0 30 17.0 31 28.0 32 33.0 33 38.5 34 54.5 35 74.0 36 99.5 37 119.5 38 147.0 39 182.0 40 213.0 41 255.0 42 275.0 43 265.0 44 280.5 45 281.0 46 263.0 47 248.5 48 208.0 49 178.0 50 153.0 51 114.5 52 94.0 53 80.0 54 56.5 55 39.5 56 34.0 57 29.5 58 21.5 59 10.5 60 4.0 61 3.5 62 3.5 63 7.0 64 6.5 65 4.5 66 4.5 67 2.0 68 1.5 69 1.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.45 2 0.0 3 0.0 4 0.025 5 0.0 6 0.075 7 0.15 8 0.3 9 0.3 10-11 0.3 12-13 0.25 14-15 0.3125 16-17 0.3 18-19 0.3125 20-21 0.325 22-23 0.325 24-25 0.3125 26-27 0.35000000000000003 28-29 0.2875 30-31 0.22499999999999998 32-33 0.3375 34-35 0.3125 36-37 0.325 38-39 0.3125 40-41 0.3125 42-43 0.3125 44-45 0.3375 46-47 0.3125 48-49 0.35000000000000003 50-51 0.325 52-53 0.325 54-55 0.3 56-57 0.3 58-59 0.3125 60-61 0.325 62-63 0.325 64-65 0.325 66-67 0.325 68-69 0.3375 70-71 0.2875 72-73 0.325 74-75 0.27499999999999997 76-77 0.3375 78-79 0.325 80-81 0.325 82-83 0.325 84-85 0.3 86-87 0.3 88-89 0.27499999999999997 90-91 0.27499999999999997 92-93 0.3 94-95 0.0125 96-97 0.11249999999999999 98-99 0.11249999999999999 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR2029776 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029776_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.34075 31.0 28.0 33.0 10.0 34.0 2 27.48275 31.0 28.0 34.0 10.0 34.0 3 27.4155 31.0 28.0 34.0 10.0 34.0 4 30.6005 35.0 32.0 37.0 10.0 37.0 5 30.40175 35.0 32.0 37.0 2.0 37.0 6 30.25575 35.0 32.0 37.0 2.0 37.0 7 30.2685 35.0 32.0 37.0 2.0 37.0 8 30.32475 35.0 32.0 37.0 2.0 37.0 9 31.424 37.0 32.0 39.0 2.0 39.0 10-11 31.021250000000002 37.0 30.0 39.0 2.0 39.0 12-13 31.016750000000002 37.0 31.0 39.0 2.0 39.0 14-15 31.847749999999998 38.0 31.5 40.0 2.0 41.0 16-17 31.836750000000002 38.0 31.5 40.0 2.0 41.0 18-19 31.644375 38.0 31.0 40.0 2.0 41.0 20-21 31.542749999999998 38.0 30.5 40.0 2.0 41.0 22-23 31.274375 38.0 30.5 40.0 2.0 41.0 24-25 31.049500000000002 38.0 29.5 40.0 2.0 41.0 26-27 31.036375 38.0 30.0 40.0 2.0 41.0 28-29 31.09075 38.0 30.0 40.0 2.0 41.0 30-31 30.920375 38.0 30.0 40.0 2.0 41.0 32-33 30.64025 38.0 29.0 40.0 2.0 41.0 34-35 30.454625 38.0 28.0 40.0 2.0 41.0 36-37 30.084375 37.5 26.0 40.0 2.0 41.0 38-39 30.172625 37.0 27.5 40.0 2.0 41.0 40-41 30.00525 37.0 26.5 40.0 2.0 41.0 42-43 29.723875 37.0 26.0 40.0 2.0 41.0 44-45 29.417749999999998 37.0 24.5 40.0 2.0 41.0 46-47 29.278 36.5 24.5 40.0 2.0 41.0 48-49 29.274875 36.0 25.0 40.0 2.0 41.0 50-51 27.99075 34.5 23.5 38.5 2.0 39.5 52-53 28.360500000000002 35.0 24.0 38.5 2.0 39.5 54-55 29.1985 36.5 26.0 39.5 2.0 40.5 56-57 29.497 37.0 26.0 40.0 2.0 41.0 58-59 29.596375000000002 37.0 26.5 40.0 2.0 41.0 60-61 29.31775 36.0 26.0 40.0 2.0 41.0 62-63 28.551125 35.5 23.5 39.0 2.0 41.0 64-65 27.742125 34.0 21.0 39.0 2.0 40.5 66-67 28.21925 35.0 22.5 39.0 2.0 40.0 68-69 27.813875000000003 34.5 22.0 38.5 2.0 40.0 70-71 27.445 34.0 22.0 38.0 2.0 40.0 72-73 27.071875 34.0 21.0 37.0 2.0 39.0 74-75 26.683125 34.0 20.0 36.5 2.0 39.0 76-77 26.424125 34.0 20.0 36.0 2.0 39.0 78-79 26.0475 34.0 19.0 36.0 2.0 37.5 80-81 25.406 32.5 14.0 35.0 2.0 37.0 82-83 25.282375000000002 33.0 13.5 35.0 2.0 36.5 84-85 24.682 32.0 7.0 35.0 2.0 36.0 86-87 24.2145 32.0 4.0 35.0 2.0 36.0 88-89 24.158375 32.0 2.0 35.0 2.0 35.0 90-91 23.757 31.5 2.0 35.0 2.0 35.0 92-93 23.015125 31.0 2.0 34.5 2.0 35.0 94-95 22.424750000000003 30.5 2.0 34.0 2.0 35.0 96-97 22.187875 31.0 2.0 34.0 2.0 35.0 98-99 21.5945 30.5 2.0 34.0 2.0 35.0 100 19.87575 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 422.0 3 59.0 4 41.0 5 32.0 6 31.0 7 19.0 8 26.0 9 19.0 10 19.0 11 22.0 12 21.0 13 18.0 14 26.0 15 20.0 16 16.0 17 19.0 18 15.0 19 23.0 20 24.0 21 36.0 22 33.0 23 43.0 24 44.0 25 40.0 26 59.0 27 61.0 28 83.0 29 98.0 30 113.0 31 124.0 32 154.0 33 188.0 34 259.0 35 317.0 36 431.0 37 577.0 38 442.0 39 26.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15928982245561 17.5293823455864 14.128532133033259 31.182795698924732 2 23.923923923923923 18.893893893893893 30.78078078078078 26.401401401401404 3 25.581395348837212 23.355838959739934 26.531632908227053 24.5311327831958 4 28.61430715357679 25.512756378189096 22.061030515257627 23.81190595297649 5 24.568426319739807 31.298473855391546 23.267450587940957 20.8656492369277 6 20.5 33.074999999999996 25.85 20.575 7 17.675 23.425 39.275 19.625 8 20.150000000000002 25.174999999999997 30.425 24.25 9 20.674999999999997 25.7 30.625000000000004 23.0 10-11 21.2625 32.3875 25.775 20.575 12-13 19.8375 27.950000000000003 29.975 22.237499999999997 14-15 21.4 26.974999999999998 29.7375 21.8875 16-17 21.099999999999998 28.875 28.025 22.0 18-19 20.3875 30.362499999999997 27.85 21.4 20-21 20.474999999999998 28.125 29.125 22.275 22-23 21.475 28.5875 28.075 21.8625 24-25 22.075 28.762500000000003 27.875 21.2875 26-27 21.6 29.512500000000003 27.0125 21.875 28-29 22.112499999999997 28.975 27.037499999999998 21.875 30-31 21.6875 29.099999999999998 27.5125 21.7 32-33 21.125 28.050000000000004 28.5625 22.2625 34-35 21.7875 28.9875 26.974999999999998 22.25 36-37 21.5 28.6125 27.762500000000003 22.125 38-39 21.725 28.299999999999997 27.5125 22.4625 40-41 21.9375 29.7125 26.787499999999998 21.5625 42-43 21.3875 29.099999999999998 27.725 21.7875 44-45 21.637500000000003 28.512500000000003 28.012500000000003 21.837500000000002 46-47 21.65 28.9875 26.987499999999997 22.375 48-49 21.2 28.6625 27.800000000000004 22.3375 50-51 20.0625 28.812500000000004 28.4 22.725 52-53 21.0 28.5875 28.875 21.5375 54-55 20.974999999999998 29.849999999999998 27.450000000000003 21.725 56-57 21.05 29.5 27.575 21.875 58-59 20.7375 28.375 29.2375 21.65 60-61 21.825 29.212500000000002 27.200000000000003 21.762500000000003 62-63 21.4 28.625 27.950000000000003 22.025 64-65 21.4 28.549999999999997 28.512500000000003 21.5375 66-67 21.0 29.512500000000003 27.925 21.5625 68-69 21.8125 27.712500000000002 29.1375 21.337500000000002 70-71 21.762500000000003 28.787499999999998 27.6375 21.8125 72-73 21.25 29.325000000000003 28.4 21.025 74-75 21.087500000000002 28.6375 29.349999999999998 20.925 76-77 22.175 28.012500000000003 28.487499999999997 21.325 78-79 21.975 27.950000000000003 27.950000000000003 22.125 80-81 22.025 28.249999999999996 28.5875 21.1375 82-83 21.987499999999997 28.487499999999997 27.425 22.1 84-85 21.2875 28.675 28.287499999999998 21.75 86-87 21.6875 28.762500000000003 27.962500000000002 21.587500000000002 88-89 21.5 29.212500000000002 27.3375 21.95 90-91 22.0875 28.449999999999996 28.537499999999998 20.925 92-93 22.225 28.199999999999996 27.55 22.025 94-95 23.0875 28.3625 28.3375 20.2125 96-97 22.4875 28.749999999999996 27.6875 21.075 98-99 22.825 27.750000000000004 28.512500000000003 20.9125 100 22.625 28.875 27.675 20.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 1.0 15 2.0 16 1.5 17 3.5 18 4.0 19 3.5 20 4.5 21 4.5 22 7.5 23 6.5 24 5.0 25 7.5 26 10.5 27 12.0 28 16.5 29 18.5 30 24.5 31 35.0 32 34.5 33 34.0 34 47.5 35 68.0 36 93.5 37 130.5 38 156.5 39 176.5 40 210.0 41 242.5 42 251.0 43 243.0 44 247.5 45 268.5 46 257.0 47 222.0 48 197.0 49 175.5 50 148.5 51 129.0 52 112.0 53 74.5 54 45.0 55 39.0 56 37.5 57 34.5 58 30.0 59 21.5 60 17.0 61 14.5 62 12.0 63 8.0 64 5.5 65 4.5 66 3.0 67 4.5 68 6.5 69 5.5 70 4.0 71 2.0 72 1.0 73 1.0 74 3.0 75 2.5 76 1.0 77 1.5 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.1 3 0.025 4 0.05 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5249999999999999 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1195477 spots for SRR2029776.sra Written 1195477 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra Read 1195470 spots for SRR2029776.sra Written 1195470 spots for SRR2029776.sra SRR ids: ['SRR2029776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dywaprpe SRR2029776.sra spots: 23909407 blocks: [[1, 1195470], [1195471, 2390940], [2390941, 3586410], [3586411, 4781880], [4781881, 5977350], [5977351, 7172820], [7172821, 8368290], [8368291, 9563760], [9563761, 10759230], [10759231, 11954700], [11954701, 13150170], [13150171, 14345640], [14345641, 15541110], [15541111, 16736580], [16736581, 17932050], [17932051, 19127520], [19127521, 20322990], [20322991, 21518460], [21518461, 22713930], [22713931, 23909407]] SRR2029776 file size 6491557 SRR2029776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2029776 SRR2029776_1.fastq SRR2029776_2.fastq Input file: SRR2029776_1.fastq Paired file: SRR2029776_2.fastq trimmed: SRR2029776-trimmed-pair1.fastq, SRR2029776-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:17:55 2025 >> started Thu Feb 13 01:21:34 2025 >> done (218.768s) 23909407 read pairs processed; of these: 1408119 ( 5.89%) short read pairs filtered out after trimming by size control 3441314 (14.39%) empty read pairs filtered out after trimming by size control 19059974 (79.72%) read pairs available; of these: 9364416 (49.13%) trimmed read pairs available after processing 9695558 (50.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 433 0.00% 19 1005 0.01% 20 1508 0.01% 21 2146 0.01% 22 2577 0.01% 23 3100 0.02% 24 3702 0.02% 25 4330 0.02% 26 5240 0.03% 27 6105 0.03% 28 6875 0.04% 29 7795 0.04% 30 8794 0.05% 31 9970 0.05% 32 11224 0.06% 33 12471 0.07% 34 13759 0.07% 35 14903 0.08% 36 16011 0.08% 37 17443 0.09% 38 18426 0.10% 39 20164 0.11% 40 21351 0.11% 41 22512 0.12% 42 24063 0.13% 43 26028 0.14% 44 27727 0.15% 45 28002 0.15% 46 29664 0.16% 47 31239 0.16% 48 31967 0.17% 49 32937 0.17% 50 35195 0.18% 51 37456 0.20% 52 38503 0.20% 53 42029 0.22% 54 47797 0.25% 55 44457 0.23% 56 47643 0.25% 57 51806 0.27% 58 55494 0.29% 59 95774 0.50% 60 94078 0.49% 61 92615 0.49% 62 90846 0.48% 63 87382 0.46% 64 89850 0.47% 65 88077 0.46% 66 88529 0.46% 67 89964 0.47% 68 89521 0.47% 69 94571 0.50% 70 96448 0.51% 71 94466 0.50% 72 96153 0.50% 73 100727 0.53% 74 101624 0.53% 75 96466 0.51% 76 95469 0.50% 77 99055 0.52% 78 104055 0.55% 79 109235 0.57% 80 114721 0.60% 81 119204 0.63% 82 127854 0.67% 83 130220 0.68% 84 132369 0.69% 85 142820 0.75% 86 148227 0.78% 87 157907 0.83% 88 144979 0.76% 89 169125 0.89% 90 204516 1.07% 91 234855 1.23% 92 260049 1.36% 93 296902 1.56% 94 335352 1.76% 95 393389 2.06% 96 483867 2.54% 97 664203 3.48% 98 886258 4.65% 99 1358843 7.13% 100 9695558 50.87% 19059974 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=19 prefix-density=0.15 prefix-fanout=2.9 sequence=CATCAGAATGTCAAGGTAAGAGTTCATGGCCAGAGCTCCTTGGAGCGCAAGCAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=9 fanout-score=50.11 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.8 sequence=AAAGAAAAATGACTTCTATGAGCTCTTCAATGCTGCCATT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=24 prefix-density=0.11 prefix-fanout=3.0 sequence=CTTGCTTGCGCTCCAAGGAGCTCTGGCCATGAACTCTTACCTTGACATTCTGATGCCATTGTAGTATTGGTCTAATGCTCTTCGGTGCTCTGTCACGATA criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=64.01 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.4 sequence=AAAGAAAAATGACTTCTATGAGCTCTTCAATGCTGCCATT SRR2029776 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:24:17 Started mapping on | Feb 13 01:24:17 Finished on | Feb 13 01:26:20 Mapping speed, Million of reads per hour | 557.85 Number of input reads | 19059974 Average input read length | 184 UNIQUE READS: Uniquely mapped reads number | 16123480 Uniquely mapped reads % | 84.59% Average mapped length | 185.69 Number of splices: Total | 8280393 Number of splices: Annotated (sjdb) | 8052537 Number of splices: GT/AG | 8140922 Number of splices: GC/AG | 112230 Number of splices: AT/AC | 6325 Number of splices: Non-canonical | 20916 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1197042 % of reads mapped to multiple loci | 6.28% Number of reads mapped to too many loci | 245516 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.53% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2056261 2056261 2056261 N_multimapping 1197042 1197042 1197042 N_noFeature 826141 8326937 8536251 N_ambiguous 159892 37533 36601 UnstrandedReadsAssigned:15137447 PositiveStrandReadsAssigned:7759010 NegativeStrandReadsAssigned:7550628 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=94 echo kmer=89 SRR2029776 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR2029776-trimmed-pair1.fastq SRR2029776-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,059,974 reads, 16,480,878 reads pseudoaligned [quant] estimated average fragment length: 154.232 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR2029776.ke.tsv 34699 SRR2029776.se.tsv 87100 total ==> SRR2029776.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1864.77 2831 111.019 Potri.005G024800.1.v4.1 1035 881.768 772.18 64.0395 Potri.004G059700.1.v4.1 961 807.768 1 0.0905309 Potri.007G009000.2.v4.1 1416 1262.77 0 0 Potri.003G141000.2.v4.1 2943 2789.77 608.126 15.9408 Potri.016G087400.1.v4.1 270 120.715 421.46 255.317 Potri.015G069301.1.v4.1 564 410.813 0 0 Potri.010G195200.1.v4.1 1773 1619.77 875.93 39.5458 Potri.012G127500.1.v4.1 977 823.768 4558 404.625 ==> SRR2029776.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 9 Potri.001G122700.v4.1 389 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 3 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 60 Potri.001G452600.v4.1 323 SRR2029776 completed mapping pipeline successfully