Starting /dee2/code/volunteer_pipeline.sh SRR2029777 current disk space = 3050458456064 free memory = 1469125780 SRR2029777 SRAfilesize abb1947fe15476b2f3781beeb4610f86 SRR2029777.sra SRR2029777.sra file validated SRR2029777 is paired end SRR2029777 is conventional basespace SRR2029777 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029777_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.13475 31.0 22.0 33.0 2.0 34.0 2 26.89825 31.0 20.0 34.0 16.0 34.0 3 28.93075 31.0 28.0 34.0 25.0 34.0 4 33.12725 35.0 33.0 37.0 28.0 37.0 5 32.73775 35.0 33.0 37.0 26.0 37.0 6 32.70175 35.0 33.0 37.0 25.0 37.0 7 32.34025 35.0 33.0 37.0 23.0 37.0 8 32.5845 35.0 33.0 37.0 25.0 37.0 9 33.88125 38.0 34.0 39.0 25.0 39.0 10-11 33.823125000000005 38.0 34.0 39.0 24.0 39.0 12-13 33.66525 38.0 33.5 39.0 23.0 39.0 14-15 34.73875 39.0 33.5 41.0 23.5 41.0 16-17 34.3365 38.0 33.0 40.5 19.0 41.0 18-19 34.471875 38.5 34.0 40.0 21.5 41.0 20-21 34.435125 39.0 34.0 40.0 20.5 41.0 22-23 34.149 38.5 33.5 40.0 20.0 41.0 24-25 33.89812499999999 38.0 33.0 40.0 18.0 41.0 26-27 33.851124999999996 38.0 33.0 40.0 18.0 41.0 28-29 33.60025 38.0 33.0 40.0 16.5 41.0 30-31 33.102375 38.0 31.5 40.0 12.5 41.0 32-33 33.176125 38.0 32.0 40.0 12.5 41.0 34-35 33.060125 38.0 31.5 40.0 11.0 41.0 36-37 32.96325 38.0 31.5 40.0 10.5 41.0 38-39 32.778125 38.0 31.0 40.0 9.0 41.0 40-41 32.691625 38.0 31.0 40.0 9.0 41.0 42-43 32.395875000000004 38.0 31.0 40.0 8.0 41.0 44-45 32.454375 38.0 31.0 40.0 7.0 41.0 46-47 32.635374999999996 38.0 31.0 40.0 4.5 41.0 48-49 32.316125 38.0 31.0 40.0 2.0 41.0 50-51 32.007 37.5 30.5 40.0 2.0 41.0 52-53 31.732 37.0 30.0 40.0 2.0 41.0 54-55 31.609625 37.0 30.0 40.0 2.0 41.0 56-57 31.2225 37.0 29.5 40.0 2.0 41.0 58-59 31.064125 36.5 29.5 40.0 2.0 41.0 60-61 30.717 36.0 29.0 39.5 2.0 41.0 62-63 30.37775 36.0 28.0 39.0 2.0 40.0 64-65 29.79325 35.0 28.0 39.0 2.0 40.0 66-67 28.9555 34.0 26.0 38.0 2.0 40.0 68-69 28.6565 34.0 26.0 38.0 2.0 40.0 70-71 28.42975 34.0 26.0 38.0 2.0 40.0 72-73 27.821624999999997 33.5 24.0 37.5 2.0 39.5 74-75 27.317999999999998 33.0 23.5 36.0 2.0 39.0 76-77 25.895375 30.5 22.0 34.5 2.0 37.5 78-79 27.225625 33.0 25.5 36.0 2.0 39.0 80-81 27.176000000000002 33.0 25.0 36.0 2.0 38.0 82-83 26.971375000000002 33.0 25.0 35.0 2.0 37.0 84-85 26.606875 33.0 24.5 35.0 2.0 37.0 86-87 26.122875 33.0 22.0 35.0 2.0 36.0 88-89 25.663 32.0 20.5 35.0 2.0 36.0 90-91 25.081 32.0 18.0 35.0 2.0 35.5 92-93 24.758375 32.0 14.5 34.5 2.0 35.0 94-95 24.38025 32.0 4.5 34.0 2.0 35.0 96-97 23.581375 31.0 2.0 34.0 2.0 35.0 98-99 22.860625 31.0 2.0 34.0 2.0 35.0 100 20.40025 26.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 193.0 3 46.0 4 10.0 5 20.0 6 19.0 7 12.0 8 20.0 9 20.0 10 14.0 11 16.0 12 27.0 13 28.0 14 36.0 15 35.0 16 30.0 17 28.0 18 34.0 19 37.0 20 30.0 21 37.0 22 38.0 23 39.0 24 39.0 25 38.0 26 59.0 27 69.0 28 93.0 29 110.0 30 116.0 31 156.0 32 180.0 33 208.0 34 254.0 35 395.0 36 476.0 37 554.0 38 428.0 39 56.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.683622828784117 33.126550868486355 16.129032258064516 21.060794044665013 2 22.25 28.875 28.775000000000002 20.1 3 22.325 27.1 29.675 20.9 4 23.923923923923923 27.7027027027027 26.2012012012012 22.17217217217217 5 23.724999999999998 29.2 26.8 20.275000000000002 6 22.35294117647059 29.511889862327912 27.033792240300375 21.101376720901126 7 21.2531328320802 28.24561403508772 31.127819548872182 19.3734335839599 8 21.809977437954377 28.12735021308599 27.575833542241163 22.486838806718477 9 22.216649949849547 27.382146439317957 28.25977933801404 22.141424272818455 10-11 22.524442216094258 28.992228628729006 27.325144146402607 21.15818500877413 12-13 22.05366098294885 28.5481444332999 28.91173520561685 20.486459378134402 14-15 21.191222570532915 27.937304075235108 27.987460815047022 22.884012539184955 16-17 21.730407523510973 27.64890282131661 28.890282131661444 21.730407523510973 18-19 21.63551987959363 27.36736485639032 28.64668255361846 22.35043271039759 20-21 21.90990086585519 28.28460283598946 28.05872756933116 21.746768728824193 22-23 21.462619167084796 28.22378324134471 27.77220270948319 22.541394882087307 24-25 22.014550928248873 27.87255393878575 28.637732062217765 21.475163070747616 26-27 21.382858576985818 28.447734973020456 28.08382482118208 22.085581628811646 28-29 22.059192375219464 28.505141710559318 27.903185352395283 21.532480561825935 30-31 22.05513784461153 27.644110275689222 28.007518796992482 22.293233082706767 32-33 21.902849253169325 28.65570478222669 28.065771306639892 21.3756746579641 34-35 21.228840125391848 27.974921630094045 28.802507836990593 21.99373040752351 36-37 21.875 27.798694779116467 27.68574297188755 22.640562248995984 38-39 21.14636899535934 28.220243321209082 27.204314561645553 23.42907312178603 40-41 21.760943183243448 28.35820895522388 28.220243321209082 21.66060454032359 42-43 22.632041149165726 26.947685359427926 28.428051687366708 21.992221804039644 44-45 23.484373038784987 26.747834818626835 27.915149993724114 21.852642148864064 46-47 21.572808227768718 27.480245829675155 28.01956603536937 22.927379907186754 48-49 22.301706827309236 27.59789156626506 28.074799196787147 22.02560240963855 50-51 21.844416562107906 27.728983688833125 27.164366373902133 23.26223337515684 52-53 22.700464299159243 27.933241310076546 27.895595432300162 21.470698958464048 54-55 22.314153190422463 28.53202958505704 26.726839664034095 22.4269775604864 56-57 21.8377836279303 27.516610254481634 28.018051899210228 22.627554218377835 58-59 22.801956603536937 27.74363476733977 27.781261758434717 21.673146870688573 60-61 21.69823153141854 28.50871691960366 26.928383293615955 22.86466825536185 62-63 22.36578023080783 27.834922227797293 27.29553437029604 22.503763171098846 64-65 22.254298983306136 28.01556420233463 27.676666248274127 22.0534705660851 66-67 21.778948688997616 28.766779575962865 27.524777317776945 21.92949441726258 68-69 22.34349516999122 28.277505959101745 27.825868774306862 21.553130096600174 70-71 22.074501442367993 28.19515866047912 27.718550106609808 22.011789790543084 72-73 22.763207428786547 27.970887187852927 27.255615510101645 22.010289873258877 74-75 21.985460015041365 27.951867635998994 27.788919528703936 22.273752820255705 76-77 22.60007529175555 27.506588028610867 27.98343581377839 21.90990086585519 78-79 22.499686284351863 28.021081691554773 27.017191617517884 22.46204040657548 80-81 21.713497240341194 28.299046663321626 28.02308078273959 21.964375313597593 82-83 21.889111891620672 28.22378324134471 27.86001003512293 22.027094831911693 84-85 21.42678034102307 28.64844533600802 27.219157472417248 22.705616850551653 86-87 21.872649786914014 27.625971421408874 28.566056655803457 21.93532213587365 88-89 23.091387739751788 28.09326814591952 27.341105678826626 21.47423843550207 90-91 23.17241379310345 29.040752351097176 27.28526645768025 20.50156739811912 92-93 23.56703875580083 28.0697353568293 27.09143358836072 21.271792299009157 94-95 22.237499999999997 28.749999999999996 27.1625 21.85 96-97 22.843210802700675 28.219554888722183 26.756689172293076 22.18054513628407 98-99 21.492873218304574 29.21980495123781 27.19429857464366 22.093023255813954 100 23.075000000000003 27.700000000000003 27.200000000000003 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.5 5 3.0 6 3.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 3.0 20 2.0 21 3.0 22 8.0 23 13.5 24 19.0 25 21.0 26 25.5 27 31.5 28 32.0 29 40.0 30 56.0 31 64.5 32 76.0 33 90.0 34 100.5 35 112.5 36 121.5 37 132.0 38 134.5 39 145.5 40 169.0 41 177.5 42 175.5 43 168.5 44 160.5 45 161.0 46 175.5 47 172.0 48 148.0 49 133.5 50 125.0 51 114.5 52 102.0 53 89.5 54 85.5 55 79.5 56 66.5 57 55.5 58 47.5 59 44.0 60 41.5 61 40.0 62 35.0 63 27.5 64 25.5 65 24.5 66 17.5 67 14.0 68 17.5 69 15.0 70 9.0 71 7.0 72 5.0 73 3.5 74 2.5 75 3.5 76 4.0 77 2.5 78 3.5 79 3.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.400000000000002 2 0.0 3 0.0 4 0.1 5 0.0 6 0.125 7 0.25 8 0.27499999999999997 9 0.3 10-11 0.27499999999999997 12-13 0.3 14-15 0.3125 16-17 0.3125 18-19 0.3375 20-21 0.3875 22-23 0.35000000000000003 24-25 0.35000000000000003 26-27 0.3875 28-29 0.325 30-31 0.25 32-33 0.41250000000000003 34-35 0.3125 36-37 0.4 38-39 0.3375 40-41 0.3375 42-43 0.36250000000000004 44-45 0.41250000000000003 46-47 0.3375 48-49 0.4 50-51 0.375 52-53 0.3875 54-55 0.2875 56-57 0.2875 58-59 0.3375 60-61 0.3375 62-63 0.35000000000000003 64-65 0.41250000000000003 66-67 0.36250000000000004 68-69 0.36250000000000004 70-71 0.3375 72-73 0.3875 74-75 0.27499999999999997 76-77 0.3875 78-79 0.3875 80-81 0.35000000000000003 82-83 0.35000000000000003 84-85 0.3 86-87 0.27499999999999997 88-89 0.2875 90-91 0.3125 92-93 0.3375 94-95 0.0 96-97 0.025 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94994994994994 99.85000000000001 2 0.025025025025025023 0.05 3 0.0 0.0 4 0.025025025025025023 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.4125 0.0 0.0 0.0 0.0 74-75 0.475 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.075 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR2029777 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029777_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.72975 31.0 30.0 33.0 16.0 34.0 2 29.0115 31.0 30.0 34.0 16.0 34.0 3 29.06375 31.0 30.0 34.0 16.0 34.0 4 32.46125 35.0 33.0 37.0 19.0 37.0 5 32.43775 35.0 33.0 37.0 19.0 37.0 6 32.355 36.0 33.0 37.0 17.0 37.0 7 32.12875 36.0 33.0 37.0 17.0 37.0 8 32.32525 36.0 33.0 37.0 18.0 37.0 9 33.15175 37.0 33.0 39.0 17.0 39.0 10-11 33.00175 37.0 33.0 39.0 17.0 39.0 12-13 33.102000000000004 37.0 33.0 39.0 17.0 39.0 14-15 34.099625 38.0 33.0 41.0 17.0 41.0 16-17 33.982625 38.0 33.0 41.0 17.0 41.0 18-19 33.798249999999996 38.5 33.0 40.0 17.0 41.0 20-21 33.66125 38.5 33.0 40.0 11.0 41.0 22-23 33.200375 38.0 32.0 40.0 10.0 41.0 24-25 33.24125 38.0 32.0 40.0 10.5 41.0 26-27 33.360749999999996 38.0 32.0 40.0 10.0 41.0 28-29 33.217625 38.0 32.0 40.0 10.0 41.0 30-31 33.134625 38.0 32.0 40.0 10.0 41.0 32-33 32.858875 38.0 31.5 40.0 9.0 41.0 34-35 32.618625 38.0 31.0 40.0 9.0 41.0 36-37 32.441625 38.0 30.5 40.0 8.5 41.0 38-39 32.412 38.0 31.0 40.0 8.0 41.0 40-41 32.149249999999995 38.0 30.0 40.0 7.5 41.0 42-43 31.987625 38.0 30.0 40.0 6.5 41.0 44-45 31.9 37.5 30.0 40.0 2.0 41.0 46-47 31.543 37.0 30.0 40.0 2.0 41.0 48-49 31.379125000000002 37.0 30.0 40.0 2.0 41.0 50-51 29.900125000000003 35.0 27.5 38.5 2.0 40.0 52-53 30.18125 35.5 28.0 38.5 2.0 39.5 54-55 30.966875 37.0 29.5 39.5 2.0 40.5 56-57 31.554875 37.0 30.0 40.0 2.0 41.0 58-59 31.60275 37.0 30.5 40.0 2.0 41.0 60-61 31.583 37.0 30.5 40.0 2.0 41.0 62-63 30.624625 36.5 28.5 40.0 2.0 41.0 64-65 29.4775 35.0 25.5 39.0 2.0 41.0 66-67 30.154249999999998 35.5 28.0 39.0 2.0 41.0 68-69 29.704875 35.0 28.0 39.0 2.0 40.5 70-71 29.587125 35.0 28.0 39.0 2.0 40.0 72-73 29.248375 35.0 27.0 38.0 2.0 40.0 74-75 28.869374999999998 34.0 27.0 37.5 2.0 40.0 76-77 28.464125 34.0 26.0 37.0 2.0 39.0 78-79 28.06475 34.0 26.0 36.5 2.0 39.0 80-81 27.41525 34.0 25.0 36.0 2.0 38.5 82-83 27.227 34.0 25.0 35.5 2.0 37.0 84-85 26.795 34.0 24.0 35.0 2.0 37.0 86-87 26.23725 33.0 22.5 35.0 2.0 36.5 88-89 25.826999999999998 33.0 20.5 35.0 2.0 36.0 90-91 25.416249999999998 32.5 19.0 35.0 2.0 35.5 92-93 24.664125 31.5 12.5 35.0 2.0 35.0 94-95 23.96575 31.5 2.0 34.0 2.0 35.0 96-97 23.598125 31.0 2.0 34.0 2.0 35.0 98-99 22.827875 31.5 2.0 34.0 2.0 35.0 100 20.7705 29.0 2.0 33.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 185.0 3 42.0 4 34.0 5 29.0 6 16.0 7 23.0 8 20.0 9 20.0 10 16.0 11 33.0 12 19.0 13 26.0 14 21.0 15 27.0 16 23.0 17 24.0 18 25.0 19 36.0 20 38.0 21 40.0 22 44.0 23 45.0 24 44.0 25 57.0 26 74.0 27 81.0 28 85.0 29 104.0 30 109.0 31 131.0 32 163.0 33 174.0 34 250.0 35 294.0 36 404.0 37 624.0 38 518.0 39 102.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.55813953488372 32.30807701925482 14.603650912728183 20.530132533133283 2 22.9057264316079 26.806701675418854 29.75743935983996 20.530132533133283 3 23.705926481620406 26.70667666916729 27.106776694173547 22.48062015503876 4 24.306076519129782 26.331582895723933 26.831707926981746 22.53063265816454 5 23.40585146286572 28.432108027006752 27.38184546136534 20.78019504876219 6 23.375 28.125 27.075 21.425 7 22.375 28.050000000000004 29.4 20.175 8 20.8 28.125 28.825 22.25 9 21.099999999999998 28.000000000000004 28.625 22.275 10-11 21.9375 29.2 27.8875 20.974999999999998 12-13 21.762500000000003 28.287499999999998 28.449999999999996 21.5 14-15 21.375 28.7 28.537499999999998 21.3875 16-17 22.0 27.950000000000003 28.3375 21.712500000000002 18-19 21.625 27.925 28.012500000000003 22.4375 20-21 21.9625 27.5875 27.8375 22.6125 22-23 21.8625 27.150000000000002 28.7 22.287499999999998 24-25 22.5125 27.4125 28.3625 21.712500000000002 26-27 20.9875 28.6375 28.15 22.225 28-29 22.1375 28.3875 27.6 21.875 30-31 21.775 27.8875 28.6375 21.7 32-33 21.475 27.787499999999998 28.3625 22.375 34-35 22.125 28.262500000000003 27.8875 21.725 36-37 21.587500000000002 28.175 28.175 22.0625 38-39 22.0 28.65 28.012500000000003 21.337500000000002 40-41 21.5625 28.3875 27.3125 22.7375 42-43 22.0875 26.950000000000003 27.775 23.1875 44-45 21.224999999999998 27.987499999999997 27.787499999999998 23.0 46-47 22.45 27.400000000000002 27.275 22.875 48-49 21.6125 27.175 28.749999999999996 22.4625 50-51 22.375 27.700000000000003 27.287499999999998 22.6375 52-53 22.1375 27.6375 28.249999999999996 21.975 54-55 21.125 28.349999999999998 28.012500000000003 22.5125 56-57 22.4875 27.487499999999997 28.375 21.65 58-59 22.537499999999998 27.775 27.750000000000004 21.9375 60-61 22.25 27.8875 27.8375 22.025 62-63 21.4875 28.212500000000002 28.575 21.725 64-65 22.425 27.825 27.712500000000002 22.037499999999998 66-67 22.425 28.599999999999998 27.5875 21.3875 68-69 21.8125 27.925 28.5625 21.7 70-71 22.3875 28.0875 27.762500000000003 21.762500000000003 72-73 21.7375 28.037499999999998 29.5 20.724999999999998 74-75 22.662499999999998 28.537499999999998 27.400000000000002 21.4 76-77 22.2125 28.712500000000002 27.05 22.025 78-79 22.412499999999998 27.737499999999997 27.987499999999997 21.8625 80-81 22.15 28.012500000000003 27.625 22.2125 82-83 21.825 27.3625 28.3625 22.45 84-85 22.15 28.1875 27.8375 21.825 86-87 22.775000000000002 27.8625 27.762500000000003 21.6 88-89 22.0 27.8875 28.349999999999998 21.762500000000003 90-91 22.6125 27.075 28.7 21.6125 92-93 22.650000000000002 28.212500000000002 27.3875 21.75 94-95 22.8875 28.875 26.8 21.4375 96-97 22.4875 28.025 27.487499999999997 22.0 98-99 22.6125 29.25 27.224999999999998 20.9125 100 24.25 27.200000000000003 26.1 22.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 2.5 20 1.5 21 2.5 22 7.0 23 12.5 24 16.5 25 19.5 26 25.5 27 33.0 28 40.5 29 47.0 30 57.5 31 70.0 32 77.5 33 85.5 34 98.0 35 103.0 36 109.0 37 124.0 38 133.5 39 145.0 40 157.0 41 170.0 42 168.0 43 161.5 44 164.0 45 165.5 46 172.5 47 172.5 48 157.5 49 144.0 50 135.5 51 121.0 52 119.0 53 107.0 54 78.0 55 65.0 56 59.0 57 52.0 58 55.5 59 55.5 60 41.5 61 39.5 62 40.0 63 29.0 64 25.0 65 26.0 66 17.5 67 14.5 68 16.5 69 13.5 70 10.0 71 5.5 72 5.0 73 4.0 74 4.0 75 3.0 76 1.0 77 1.0 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.1875 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.275 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.5375 0.0 0.0 0.0 0.0 76-77 0.625 0.0 0.0 0.0 0.0 78-79 0.7 0.0 0.0 0.0 0.0 80-81 0.875 0.0 0.0 0.0 0.0 82-83 1.025 0.0 0.0 0.0 0.0 84-85 1.25 0.0 0.0 0.0 0.0 86-87 1.5625 0.0 0.0 0.0 0.0 88 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164778 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164778 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Read 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra Written 6164762 spots for SRR2029777.sra SRR ids: ['SRR2029777.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9r1gpkom SRR2029777.sra spots: 123295256 blocks: [[1, 6164762], [6164763, 12329524], [12329525, 18494286], [18494287, 24659048], [24659049, 30823810], [30823811, 36988572], [36988573, 43153334], [43153335, 49318096], [49318097, 55482858], [55482859, 61647620], [61647621, 67812382], [67812383, 73977144], [73977145, 80141906], [80141907, 86306668], [86306669, 92471430], [92471431, 98636192], [98636193, 104800954], [104800955, 110965716], [110965717, 117130478], [117130479, 123295256]] SRR2029777 file size 33543414 SRR2029777 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2029777 SRR2029777_1.fastq SRR2029777_2.fastq Input file: SRR2029777_1.fastq Paired file: SRR2029777_2.fastq trimmed: SRR2029777-trimmed-pair1.fastq, SRR2029777-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:21:42 2025 >> started Thu Feb 13 01:30:03 2025 >> done (501.652s) 123295256 read pairs processed; of these: 5580524 ( 4.53%) short read pairs filtered out after trimming by size control 15244489 (12.36%) empty read pairs filtered out after trimming by size control 102470243 (83.11%) read pairs available; of these: 50049958 (48.84%) trimmed read pairs available after processing 52420285 (51.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2691 0.00% 19 6129 0.01% 20 9584 0.01% 21 12985 0.01% 22 16366 0.02% 23 19664 0.02% 24 23604 0.02% 25 27692 0.03% 26 32351 0.03% 27 37483 0.04% 28 42791 0.04% 29 48681 0.05% 30 55106 0.05% 31 61343 0.06% 32 68636 0.07% 33 75822 0.07% 34 83152 0.08% 35 88865 0.09% 36 95676 0.09% 37 102814 0.10% 38 108585 0.11% 39 116572 0.11% 40 123561 0.12% 41 130099 0.13% 42 137151 0.13% 43 145178 0.14% 44 152697 0.15% 45 160118 0.16% 46 167051 0.16% 47 174017 0.17% 48 180786 0.18% 49 187662 0.18% 50 196848 0.19% 51 209989 0.20% 52 218308 0.21% 53 225695 0.22% 54 237833 0.23% 55 248185 0.24% 56 260799 0.25% 57 277461 0.27% 58 297244 0.29% 59 410972 0.40% 60 409876 0.40% 61 413777 0.40% 62 415767 0.41% 63 420825 0.41% 64 444287 0.43% 65 468809 0.46% 66 455349 0.44% 67 458036 0.45% 68 467372 0.46% 69 512228 0.50% 70 535850 0.52% 71 527151 0.51% 72 528283 0.52% 73 523012 0.51% 74 542943 0.53% 75 537072 0.52% 76 546717 0.53% 77 560989 0.55% 78 590179 0.58% 79 647571 0.63% 80 643806 0.63% 81 656022 0.64% 82 711154 0.69% 83 758640 0.74% 84 767374 0.75% 85 778895 0.76% 86 840279 0.82% 87 913173 0.89% 88 855167 0.83% 89 967473 0.94% 90 1120461 1.09% 91 1250186 1.22% 92 1363873 1.33% 93 1542438 1.51% 94 1756695 1.71% 95 2067080 2.02% 96 2540649 2.48% 97 3478030 3.39% 98 4602909 4.49% 99 7151315 6.98% 100 52420285 51.16% 102470243 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=26 prefix-density=1.28 prefix-fanout=2.9 sequence=CACGTGATCAGTGCATGATCAG criterion=fanout-score sequence-density=0.29 sequence-density-rank=9 fanout-score=17.98 fanout-score-rank=1 prefix-density=1.38 prefix-fanout=3.8 sequence=CGTGATCAGTGTATGATCAGC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=24 prefix-density=1.27 prefix-fanout=2.9 sequence=CACGTGATCAGTGCATGATCAG criterion=fanout-score sequence-density=0.29 sequence-density-rank=8 fanout-score=18.08 fanout-score-rank=1 prefix-density=1.37 prefix-fanout=3.8 sequence=CGTGATCAGTGTATGATCAGC SRR2029777 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:31:28 Started mapping on | Feb 13 01:31:28 Finished on | Feb 13 02:56:41 Mapping speed, Million of reads per hour | 72.15 Number of input reads | 102470243 Average input read length | 184 UNIQUE READS: Uniquely mapped reads number | 18935800 Uniquely mapped reads % | 18.48% Average mapped length | 184.87 Number of splices: Total | 9873879 Number of splices: Annotated (sjdb) | 9614329 Number of splices: GT/AG | 9708688 Number of splices: GC/AG | 131375 Number of splices: AT/AC | 7514 Number of splices: Non-canonical | 26302 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.02% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1158960 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 547526 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 79.72% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 82700563 82700563 82700563 N_multimapping 1158960 1158960 1158960 N_noFeature 929245 9746671 10025343 N_ambiguous 182942 45927 44772 UnstrandedReadsAssigned:17823613 PositiveStrandReadsAssigned:9143202 NegativeStrandReadsAssigned:8865685 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=93 echo kmer=89 SRR2029777 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR2029777-trimmed-pair1.fastq SRR2029777-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 102,470,243 reads, 19,476,384 reads pseudoaligned [quant] estimated average fragment length: 151.277 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR2029777.ke.tsv 34699 SRR2029777.se.tsv 87100 total ==> SRR2029777.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1867.72 2359 81.0181 Potri.005G024800.1.v4.1 1035 884.723 1551.26 112.472 Potri.004G059700.1.v4.1 961 810.737 3 0.23736 Potri.007G009000.2.v4.1 1416 1265.72 0 0 Potri.003G141000.2.v4.1 2943 2792.72 1344.38 30.8788 Potri.016G087400.1.v4.1 270 122.905 385 200.936 Potri.015G069301.1.v4.1 564 413.778 0 0 Potri.010G195200.1.v4.1 1773 1622.72 1717.62 67.8969 Potri.012G127500.1.v4.1 977 826.737 7827 607.288 ==> SRR2029777.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 413 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 6 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 68 Potri.001G452600.v4.1 262 SRR2029777 completed mapping pipeline successfully