Starting /dee2/code/volunteer_pipeline.sh SRR2029778 current disk space = 3050478272512 free memory = 1576966032 SRR2029778 SRAfilesize 11e53422d0c195131282407d719aa185 SRR2029778.sra SRR2029778.sra file validated SRR2029778 is paired end SRR2029778 is conventional basespace SRR2029778 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.55825 31.0 30.0 33.0 18.0 34.0 2 29.25225 31.0 30.0 34.0 22.0 34.0 3 29.8435 31.0 30.0 34.0 26.0 34.0 4 33.6265 35.0 35.0 37.0 30.0 37.0 5 33.252 35.0 35.0 37.0 27.0 37.0 6 33.10425 35.0 35.0 37.0 27.0 37.0 7 32.63425 35.0 33.0 37.0 25.0 37.0 8 32.668 35.0 33.0 37.0 25.0 37.0 9 34.04125 38.0 34.0 39.0 26.0 39.0 10-11 34.145375 38.0 34.0 39.0 26.0 39.0 12-13 34.0085 37.5 34.0 39.0 25.5 39.0 14-15 34.934625 39.0 34.0 40.5 25.5 41.0 16-17 34.672875 38.0 33.5 40.0 24.5 41.0 18-19 34.688125 38.5 34.0 40.0 24.0 41.0 20-21 34.635999999999996 39.0 34.0 40.0 23.5 41.0 22-23 34.56 38.5 34.0 40.0 23.5 41.0 24-25 34.353875 38.0 33.5 40.0 22.5 41.0 26-27 34.2195 38.0 33.5 40.0 22.0 41.0 28-29 33.984 38.0 33.0 40.0 18.5 41.0 30-31 33.571875 38.0 32.5 40.0 17.0 41.0 32-33 33.62475 38.0 33.0 40.0 17.5 41.0 34-35 33.366375000000005 38.0 32.5 40.0 15.5 41.0 36-37 33.123374999999996 38.0 31.5 40.0 15.0 41.0 38-39 32.995625000000004 38.0 31.5 40.0 14.0 41.0 40-41 32.873125 38.0 31.0 40.0 9.0 41.0 42-43 32.57899999999999 37.0 31.0 40.0 9.0 41.0 44-45 32.787875 37.5 31.5 40.0 9.0 41.0 46-47 32.8185 38.0 31.5 40.0 9.0 41.0 48-49 32.576750000000004 38.0 31.5 40.0 8.0 41.0 50-51 32.337625 37.0 31.0 40.0 7.0 41.0 52-53 32.28575 37.0 31.0 40.0 6.0 41.0 54-55 32.040875 37.0 31.0 40.0 2.0 41.0 56-57 31.603625 36.5 30.0 40.0 2.0 41.0 58-59 31.372500000000002 36.0 30.0 39.5 2.0 41.0 60-61 30.933625 36.0 29.0 39.0 2.0 41.0 62-63 30.55825 35.5 28.5 39.0 2.0 40.0 64-65 30.132624999999997 35.0 28.0 39.0 2.0 40.0 66-67 29.006375 34.0 26.0 38.0 2.0 40.0 68-69 28.783375 34.0 26.0 37.5 2.0 39.5 70-71 28.42875 34.0 26.0 37.0 2.0 39.0 72-73 27.965 33.5 25.5 36.0 2.0 39.0 74-75 27.494 33.0 25.5 36.0 2.0 38.5 76-77 25.906 30.5 23.5 34.0 2.0 36.0 78-79 27.1265 32.5 26.0 35.0 2.0 37.0 80-81 27.2885 33.0 26.0 35.0 2.0 37.0 82-83 27.03575 33.0 26.0 35.0 2.0 36.0 84-85 26.775750000000002 33.0 26.0 35.0 2.0 36.0 86-87 26.284875 32.5 24.5 35.0 2.0 35.5 88-89 25.656125 32.0 21.5 35.0 2.0 35.0 90-91 25.362875000000003 32.0 20.0 34.0 2.0 35.0 92-93 24.942875 32.0 19.0 34.0 2.0 35.0 94-95 24.421999999999997 31.0 12.0 34.0 2.0 35.0 96-97 23.65775 31.0 2.0 34.0 2.0 35.0 98-99 22.935625 31.0 2.0 34.0 2.0 35.0 100 20.29225 27.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 152.0 3 44.0 4 19.0 5 16.0 6 19.0 7 10.0 8 18.0 9 21.0 10 24.0 11 14.0 12 20.0 13 18.0 14 24.0 15 34.0 16 31.0 17 29.0 18 27.0 19 31.0 20 34.0 21 31.0 22 38.0 23 30.0 24 47.0 25 50.0 26 64.0 27 81.0 28 96.0 29 116.0 30 144.0 31 170.0 32 173.0 33 234.0 34 286.0 35 378.0 36 499.0 37 613.0 38 348.0 39 17.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.173665111456714 17.80715396578538 17.210990150336965 29.808190772420947 2 24.5 22.650000000000002 28.475 24.375 3 26.1 25.45 26.950000000000003 21.5 4 27.341011517275916 29.944917376064094 21.231847771657485 21.482223335002505 5 26.6 33.0 22.275 18.125 6 19.734535437014774 35.762584522915105 25.043826696719258 19.459053343350863 7 18.671679197994987 22.030075187969924 39.498746867167924 19.799498746867165 8 19.16708479678876 25.288509784244855 30.481685900652284 25.062719518314097 9 21.098845960863024 24.00903161063723 31.409934771700954 23.482187656798796 10-11 22.15951843491347 32.129420617005266 24.166039628793577 21.545021319287684 12-13 20.13540621865597 27.16900702106319 29.6765295887663 23.019057171514543 14-15 20.8955223880597 28.57142857142857 28.333124294493917 22.19992474601781 16-17 21.78876066231811 27.972905168088307 28.361766181635723 21.876567987957852 18-19 22.268222305858735 27.298958725379503 28.089323798770543 22.34349516999122 20-21 22.05494919081671 28.239869527035506 27.963869025216407 21.741312256931376 22-23 22.03963873557451 28.62518815855494 27.571500250878074 21.763672854992475 24-25 21.211741093828397 27.496236828901154 27.87255393878575 23.419468138484696 26-27 21.239493162714844 28.553506460920836 27.07314013298206 23.13386024338226 28-29 22.70846394984326 27.460815047021942 27.473354231974923 22.357366771159874 30-31 22.098270243168713 28.365505139132612 27.475557783905742 22.06066683379293 32-33 20.865746549560853 29.008782936010036 27.603513174404014 22.521957340025097 34-35 22.503763171098846 27.84746613146011 27.395885599598596 22.252885097842448 36-37 22.271016311166875 27.31493099121706 28.218318695106646 22.19573400250941 38-39 22.225009406747773 27.91922739244952 27.88160040135457 21.974162799448138 40-41 21.299548419468138 28.524836929252384 27.87255393878575 22.30306071249373 42-43 21.91694893990716 27.60005018190942 27.926232593150168 22.556768285033247 44-45 21.442910915934753 27.97992471769134 27.854454203262236 22.72271016311167 46-47 21.976919217260413 28.110888108379328 27.458605117912693 22.453587556447566 48-49 22.45922208281054 27.340025094102888 28.557089084065247 21.643663739021328 50-51 22.130222054949193 27.662777568686487 28.00150545728265 22.20549491908167 52-53 23.57295195082173 28.00150545728265 27.32404968009033 21.101492911805295 54-55 22.654290015052684 27.87255393878575 28.487205218263924 20.985950827897643 56-57 22.852125924996862 26.589740373761444 28.245327981939045 22.31280571930265 58-59 22.553938785750123 27.55895634721525 27.972905168088307 21.914199698946312 60-61 22.591570496738587 27.54641244355243 27.458605117912693 22.403411941796286 62-63 21.131176323049914 28.542763982944567 28.505141710559318 21.8209179834462 64-65 22.132998745294856 28.143036386449182 28.306148055207025 21.417816813048933 66-67 22.641746111389864 28.098344204716508 27.935273457099854 21.32463622679378 68-69 22.77004140007527 27.311504202734916 27.298958725379503 22.619495671810313 70-71 22.435415099071985 28.229245046400802 27.22598444946075 22.109355405066466 72-73 22.381131602057458 28.026596411993477 27.763141387529792 21.82913059841927 74-75 22.536976685886188 28.12735021308599 28.378039608924542 20.957633492103284 76-77 21.666039392798897 28.540960983565423 27.81332329695145 21.97967632668423 78-79 21.82913059841927 28.239869527035506 27.650232091331073 22.280767783214152 80-81 22.75464124435524 27.634219769192175 27.53386853988961 22.07727044656297 82-83 22.76718514801806 28.048168590065224 27.09483191169092 22.08981435022579 84-85 22.645768025078368 27.561128526645767 26.884012539184955 22.90909090909091 86-87 23.68949084524705 27.552044143466265 27.13819914722849 21.62026586405819 88-89 22.58307210031348 27.924764890282134 27.786833855799376 21.705329153605017 90-91 22.094043887147336 28.25078369905956 26.921630094043884 22.733542319749215 92-93 22.585904188612993 29.157261098570352 26.761976423375973 21.494858289440682 94-95 22.605651412853213 28.319579894973746 27.28182045511378 21.792948237059264 96-97 23.21071071071071 28.14064064064064 26.363863863863862 22.284784784784783 98-99 23.36086086086086 29.291791791791795 25.650650650650654 21.696696696696698 100 24.975 27.500000000000004 25.75 21.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 2.5 6 2.5 7 2.5 8 2.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.5 25 2.5 26 6.0 27 9.0 28 6.5 29 6.0 30 13.0 31 14.5 32 21.0 33 35.0 34 44.5 35 55.0 36 76.5 37 89.0 38 119.0 39 164.0 40 188.5 41 227.5 42 262.0 43 283.5 44 285.0 45 283.5 46 279.5 47 256.0 48 211.5 49 178.0 50 161.5 51 136.0 52 111.5 53 89.5 54 80.5 55 65.0 56 48.0 57 42.0 58 33.0 59 24.5 60 17.0 61 10.5 62 9.5 63 7.0 64 4.5 65 3.0 66 2.0 67 2.0 68 2.5 69 3.0 70 2.5 71 1.0 72 0.5 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.55 2 0.0 3 0.0 4 0.15 5 0.0 6 0.17500000000000002 7 0.25 8 0.35000000000000003 9 0.35000000000000003 10-11 0.325 12-13 0.3 14-15 0.3375 16-17 0.35000000000000003 18-19 0.36250000000000004 20-21 0.36250000000000004 22-23 0.35000000000000003 24-25 0.35000000000000003 26-27 0.36250000000000004 28-29 0.3125 30-31 0.27499999999999997 32-33 0.375 34-35 0.35000000000000003 36-37 0.375 38-39 0.3375 40-41 0.35000000000000003 42-43 0.36250000000000004 44-45 0.375 46-47 0.35000000000000003 48-49 0.375 50-51 0.36250000000000004 52-53 0.36250000000000004 54-55 0.35000000000000003 56-57 0.3375 58-59 0.35000000000000003 60-61 0.35000000000000003 62-63 0.325 64-65 0.375 66-67 0.35000000000000003 68-69 0.36250000000000004 70-71 0.325 72-73 0.36250000000000004 74-75 0.27499999999999997 76-77 0.36250000000000004 78-79 0.36250000000000004 80-81 0.35000000000000003 82-83 0.35000000000000003 84-85 0.3125 86-87 0.325 88-89 0.3125 90-91 0.3125 92-93 0.325 94-95 0.025 96-97 0.1 98-99 0.1 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.9125 0.0 0.0 0.0 0.0 86-87 1.3 0.0 0.0 0.0 0.0 88 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR2029778 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2029778_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.427 31.0 30.0 33.0 16.0 34.0 2 28.54925 31.0 30.0 34.0 16.0 34.0 3 28.5855 31.0 30.0 34.0 16.0 34.0 4 31.74425 35.0 32.0 37.0 16.0 37.0 5 31.7175 35.0 33.0 37.0 16.0 37.0 6 31.5705 35.0 33.0 37.0 11.0 37.0 7 31.5485 35.0 32.0 37.0 11.0 37.0 8 31.5865 35.0 33.0 37.0 11.0 37.0 9 32.64975 37.0 33.0 39.0 10.0 39.0 10-11 32.511375 37.0 32.5 39.0 10.5 39.0 12-13 32.62925 37.0 32.5 39.0 10.0 39.0 14-15 33.376374999999996 38.0 33.0 40.0 10.0 41.0 16-17 33.282875000000004 38.0 33.0 40.0 10.0 41.0 18-19 33.043625 38.0 32.0 40.0 9.5 41.0 20-21 33.054625 38.0 32.0 40.0 9.0 41.0 22-23 32.7815 38.0 32.0 40.0 8.0 41.0 24-25 32.540875 38.0 32.0 40.0 2.0 41.0 26-27 32.530249999999995 38.0 32.0 40.0 2.0 41.0 28-29 32.692375 38.0 32.0 40.0 2.0 41.0 30-31 32.566375 38.0 31.5 40.0 2.0 41.0 32-33 32.32425 38.0 31.0 40.0 2.0 41.0 34-35 32.152625 38.0 30.5 40.0 2.0 41.0 36-37 31.82525 38.0 30.0 40.0 2.0 41.0 38-39 31.805500000000002 38.0 30.0 40.0 2.0 41.0 40-41 31.677125 38.0 30.0 40.0 2.0 41.0 42-43 31.380875 37.5 30.0 40.0 2.0 41.0 44-45 31.20825 37.0 30.0 40.0 2.0 41.0 46-47 30.820875 37.0 29.0 40.0 2.0 41.0 48-49 30.877375 37.0 29.0 40.0 2.0 41.0 50-51 29.302125 35.0 26.5 38.5 2.0 39.5 52-53 29.68175 36.0 27.5 38.5 2.0 39.5 54-55 30.673125 37.0 28.5 39.5 2.0 40.5 56-57 31.008625 37.0 30.0 40.0 2.0 41.0 58-59 30.9615 37.0 29.5 40.0 2.0 41.0 60-61 30.680625 37.0 29.0 40.0 2.0 41.0 62-63 29.786375 36.0 27.0 39.5 2.0 41.0 64-65 28.941875000000003 35.0 25.5 39.0 2.0 40.5 66-67 29.360875 35.0 26.0 39.0 2.0 40.0 68-69 29.027250000000002 35.0 26.0 38.5 2.0 40.0 70-71 28.602249999999998 34.5 26.0 38.0 2.0 40.0 72-73 28.3265 34.5 26.0 37.0 2.0 39.0 74-75 27.910875 34.0 26.0 37.0 2.0 39.0 76-77 27.409750000000003 34.0 25.0 36.0 2.0 38.5 78-79 27.186625 34.0 25.0 36.0 2.0 37.5 80-81 26.532874999999997 33.5 23.0 35.0 2.0 37.0 82-83 26.384749999999997 33.0 23.5 35.0 2.0 36.5 84-85 25.866625 33.0 20.5 35.0 2.0 36.0 86-87 25.341124999999998 32.0 19.0 35.0 2.0 35.5 88-89 25.255499999999998 32.0 19.0 35.0 2.0 35.0 90-91 24.802500000000002 32.0 14.5 35.0 2.0 35.0 92-93 24.08025 31.5 4.5 34.5 2.0 35.0 94-95 23.442375 31.0 2.0 34.0 2.0 35.0 96-97 23.206375 31.0 2.0 34.0 2.0 35.0 98-99 22.478375 31.0 2.0 34.0 2.0 35.0 100 20.5225 27.0 2.0 33.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 266.0 3 52.0 4 37.0 5 23.0 6 20.0 7 24.0 8 22.0 9 23.0 10 17.0 11 25.0 12 22.0 13 22.0 14 29.0 15 21.0 16 17.0 17 13.0 18 31.0 19 23.0 20 29.0 21 30.0 22 46.0 23 33.0 24 51.0 25 51.0 26 70.0 27 90.0 28 82.0 29 88.0 30 102.0 31 118.0 32 149.0 33 217.0 34 241.0 35 323.0 36 472.0 37 634.0 38 461.0 39 26.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.24262131065532 16.633316658329164 15.182591295647823 32.94147073536769 2 26.401401401401404 21.02102102102102 28.27827827827828 24.2992992992993 3 26.21310655327664 25.812906453226613 24.88744372186093 23.08654327163582 4 28.946710032524393 28.396297222917187 21.841381035776834 20.815611708781585 5 25.619214410808105 32.9246935201401 21.491118338754063 19.96497373029772 6 20.625 34.4 26.275 18.7 7 19.475 21.05 38.975 20.5 8 20.575 24.0 29.7 25.724999999999998 9 20.25 25.05 31.0 23.7 10-11 21.775 32.25 25.55 20.424999999999997 12-13 20.837500000000002 26.987499999999997 30.887500000000003 21.2875 14-15 20.3625 27.8125 30.112499999999997 21.712500000000002 16-17 22.037499999999998 28.4125 27.6125 21.9375 18-19 21.349999999999998 28.025 28.237499999999997 22.3875 20-21 21.925 28.3125 27.375 22.3875 22-23 22.6875 29.0875 26.6 21.625 24-25 22.375 28.000000000000004 27.975 21.65 26-27 21.325 28.7375 27.5875 22.35 28-29 20.7625 28.4125 27.487499999999997 23.3375 30-31 21.587500000000002 29.1875 27.187499999999996 22.037499999999998 32-33 21.575 28.15 28.525 21.75 34-35 22.412499999999998 27.750000000000004 28.000000000000004 21.837500000000002 36-37 21.712500000000002 26.887499999999996 28.95 22.45 38-39 21.712500000000002 27.55 28.1625 22.575 40-41 21.224999999999998 27.500000000000004 27.8875 23.3875 42-43 21.0125 28.449999999999996 28.000000000000004 22.537499999999998 44-45 22.925 27.9375 27.224999999999998 21.912499999999998 46-47 22.900000000000002 28.425 26.4625 22.2125 48-49 23.2125 27.625 27.3625 21.8 50-51 22.537499999999998 27.962500000000002 26.7125 22.787499999999998 52-53 21.55 28.287499999999998 27.825 22.3375 54-55 20.4375 28.225 28.349999999999998 22.9875 56-57 21.1625 27.575 28.325 22.9375 58-59 22.1375 27.85 27.325 22.6875 60-61 22.025 28.012500000000003 28.212500000000002 21.75 62-63 21.45 29.049999999999997 27.6875 21.8125 64-65 21.712500000000002 28.275 27.625 22.3875 66-67 22.2 28.499999999999996 27.650000000000002 21.65 68-69 22.1375 28.6625 26.9125 22.287499999999998 70-71 22.0 28.749999999999996 27.437499999999996 21.8125 72-73 22.975 27.3625 28.025 21.637500000000003 74-75 22.35 28.3875 27.3125 21.95 76-77 22.0875 28.212500000000002 28.199999999999996 21.5 78-79 22.9625 27.787499999999998 27.275 21.975 80-81 22.0625 28.525 26.5875 22.825 82-83 21.5375 28.6125 27.200000000000003 22.650000000000002 84-85 22.7625 28.1625 27.3 21.775 86-87 22.5125 28.199999999999996 27.437499999999996 21.85 88-89 23.200000000000003 28.375 27.5625 20.8625 90-91 23.0 27.975 27.287499999999998 21.7375 92-93 24.125 28.787499999999998 25.9625 21.125 94-95 24.0 28.675 25.900000000000002 21.425 96-97 24.099999999999998 28.012500000000003 26.900000000000002 20.9875 98-99 24.6875 27.987499999999997 26.8625 20.4625 100 25.674999999999997 26.25 26.450000000000003 21.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 1.0 15 0.5 16 1.0 17 2.0 18 1.0 19 0.5 20 1.0 21 2.5 22 4.5 23 4.0 24 5.5 25 6.0 26 4.5 27 5.0 28 7.5 29 12.0 30 16.5 31 18.0 32 26.5 33 41.5 34 47.5 35 53.0 36 79.0 37 117.0 38 134.0 39 150.5 40 185.0 41 225.5 42 244.5 43 247.5 44 262.0 45 276.5 46 275.5 47 244.0 48 212.0 49 183.5 50 165.0 51 137.0 52 109.5 53 95.5 54 74.5 55 62.0 56 52.0 57 40.0 58 31.5 59 23.0 60 16.0 61 16.5 62 13.5 63 10.0 64 6.0 65 6.5 66 5.5 67 5.0 68 6.0 69 3.5 70 2.0 71 3.0 72 2.0 73 1.5 74 2.0 75 1.5 76 1.5 77 0.5 78 0.5 79 1.5 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.1 3 0.05 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.30000000000000004 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 1.0125 0.0 0.0 0.0 0.0 86-87 1.425 0.0 0.0 0.0 0.0 88 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155607 spots for SRR2029778.sra Written 1155607 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra Read 1155591 spots for SRR2029778.sra Written 1155591 spots for SRR2029778.sra SRR ids: ['SRR2029778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vbl_3mt6 SRR2029778.sra spots: 23111836 blocks: [[1, 1155591], [1155592, 2311182], [2311183, 3466773], [3466774, 4622364], [4622365, 5777955], [5777956, 6933546], [6933547, 8089137], [8089138, 9244728], [9244729, 10400319], [10400320, 11555910], [11555911, 12711501], [12711502, 13867092], [13867093, 15022683], [15022684, 16178274], [16178275, 17333865], [17333866, 18489456], [18489457, 19645047], [19645048, 20800638], [20800639, 21956229], [21956230, 23111836]] SRR2029778 file size 6274660 SRR2029778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2029778 SRR2029778_1.fastq SRR2029778_2.fastq Input file: SRR2029778_1.fastq Paired file: SRR2029778_2.fastq trimmed: SRR2029778-trimmed-pair1.fastq, SRR2029778-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:21:40 2025 >> started Thu Feb 13 01:23:45 2025 >> done (124.477s) 23111836 read pairs processed; of these: 1116427 ( 4.83%) short read pairs filtered out after trimming by size control 2593108 (11.22%) empty read pairs filtered out after trimming by size control 19402301 (83.95%) read pairs available; of these: 9909287 (51.07%) trimmed read pairs available after processing 9493014 (48.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 415 0.00% 19 960 0.00% 20 1370 0.01% 21 1903 0.01% 22 2349 0.01% 23 2927 0.02% 24 3396 0.02% 25 3933 0.02% 26 4725 0.02% 27 5608 0.03% 28 6208 0.03% 29 7275 0.04% 30 8132 0.04% 31 9273 0.05% 32 10407 0.05% 33 11730 0.06% 34 12672 0.07% 35 13853 0.07% 36 14752 0.08% 37 15975 0.08% 38 16983 0.09% 39 18441 0.10% 40 19539 0.10% 41 20954 0.11% 42 22058 0.11% 43 23269 0.12% 44 24695 0.13% 45 25972 0.13% 46 27204 0.14% 47 28399 0.15% 48 29525 0.15% 49 30575 0.16% 50 32362 0.17% 51 34085 0.18% 52 35269 0.18% 53 37138 0.19% 54 39288 0.20% 55 41955 0.22% 56 44659 0.23% 57 48882 0.25% 58 51431 0.27% 59 79882 0.41% 60 80049 0.41% 61 79473 0.41% 62 79006 0.41% 63 78822 0.41% 64 79191 0.41% 65 83637 0.43% 66 82093 0.42% 67 86922 0.45% 68 86161 0.44% 69 88992 0.46% 70 91616 0.47% 71 92237 0.48% 72 94632 0.49% 73 104182 0.54% 74 100516 0.52% 75 94179 0.49% 76 95898 0.49% 77 100772 0.52% 78 108792 0.56% 79 109164 0.56% 80 115636 0.60% 81 124714 0.64% 82 138506 0.71% 83 170440 0.88% 84 167555 0.86% 85 175261 0.90% 86 175632 0.91% 87 188041 0.97% 88 177336 0.91% 89 208965 1.08% 90 251666 1.30% 91 291602 1.50% 92 326452 1.68% 93 364700 1.88% 94 399035 2.06% 95 446281 2.30% 96 526554 2.71% 97 694354 3.58% 98 906519 4.67% 99 1373276 7.08% 100 9493014 48.93% 19402301 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.03 fanout-score-rank=21 prefix-density=0.25 prefix-fanout=3.5 sequence=GGAGACTTGTACTTGTAAGGGTGCGTTGGTGGTGGGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=65.32 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.3 sequence=TGGTGGTGGAGA criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.96 fanout-score-rank=18 prefix-density=0.14 prefix-fanout=5.4 sequence=CCAGTTTACAAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=59.15 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=TGAAGTTGTACGTAGCACAATTACAGAATAATGCATGGAAAACAAGATCTCTTATTTAGTACAATAAAACAAACACCAAGGGAGAACTAGAAACTCCTTATTTCATAAGATCCAGCAGGATGATAATCAGCATGCATGAGCCTTCAACCAATTACAGGAACCCGAGTAACAATTCTGTT SRR2029778 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:25:38 Started mapping on | Feb 13 01:25:38 Finished on | Feb 13 01:27:21 Mapping speed, Million of reads per hour | 678.14 Number of input reads | 19402301 Average input read length | 185 UNIQUE READS: Uniquely mapped reads number | 16239402 Uniquely mapped reads % | 83.70% Average mapped length | 185.77 Number of splices: Total | 8978013 Number of splices: Annotated (sjdb) | 8776844 Number of splices: GT/AG | 8837214 Number of splices: GC/AG | 111418 Number of splices: AT/AC | 6904 Number of splices: Non-canonical | 22477 Mismatch rate per base, % | 0.68% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1279456 % of reads mapped to multiple loci | 6.59% Number of reads mapped to too many loci | 218294 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.27% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2113732 2113732 2113732 N_multimapping 1279456 1279456 1279456 N_noFeature 529532 8258444 8439572 N_ambiguous 144705 37502 36742 UnstrandedReadsAssigned:15565165 PositiveStrandReadsAssigned:7943456 NegativeStrandReadsAssigned:7763088 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=92 echo kmer=87 SRR2029778 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR2029778-trimmed-pair1.fastq SRR2029778-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,402,301 reads, 16,966,414 reads pseudoaligned [quant] estimated average fragment length: 140.551 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR2029778.ke.tsv 34699 SRR2029778.se.tsv 87100 total ==> SRR2029778.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1878.45 3394.69 133.044 Potri.005G024800.1.v4.1 1035 895.449 268.081 22.0403 Potri.004G059700.1.v4.1 961 821.449 23 2.0613 Potri.007G009000.2.v4.1 1416 1276.45 0 0 Potri.003G141000.2.v4.1 2943 2803.45 774.799 20.3465 Potri.016G087400.1.v4.1 270 133.844 507.666 279.236 Potri.015G069301.1.v4.1 564 424.467 0 0 Potri.010G195200.1.v4.1 1773 1633.45 967.89 43.6228 Potri.012G127500.1.v4.1 977 837.449 6178 543.104 ==> SRR2029778.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 157 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 572 SRR2029778 completed mapping pipeline successfully