Starting /dee2/code/volunteer_pipeline.sh SRR21683875 current disk space = 3049162412032 free memory = 1576334208 SRR21683875 SRAfilesize 4cb050ef0a36c55ad7c16e823a4f3557 SRR21683875.sra SRR21683875.sra file validated SRR21683875 is paired end SRR21683875 is conventional basespace SRR21683875 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3945 37.0 37.0 37.0 37.0 37.0 2 36.5045 37.0 37.0 37.0 37.0 37.0 3 36.5305 37.0 37.0 37.0 37.0 37.0 4 36.534 37.0 37.0 37.0 37.0 37.0 5 36.491 37.0 37.0 37.0 37.0 37.0 6 36.5465 37.0 37.0 37.0 37.0 37.0 7 36.4225 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.5185 37.0 37.0 37.0 37.0 37.0 10-14 36.506800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.4779 37.0 37.0 37.0 37.0 37.0 20-24 36.4276 37.0 37.0 37.0 37.0 37.0 25-29 36.359300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.37859999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3899 37.0 37.0 37.0 37.0 37.0 40-44 36.356700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.328700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3002 37.0 37.0 37.0 37.0 37.0 55-59 36.2303 37.0 37.0 37.0 37.0 37.0 60-64 36.2011 37.0 37.0 37.0 37.0 37.0 65-69 36.179899999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.11749999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.116 37.0 37.0 37.0 37.0 37.0 80-84 36.0926 37.0 37.0 37.0 37.0 37.0 85-89 35.986000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9787 37.0 37.0 37.0 37.0 37.0 95-99 35.946200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.86899999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.7961 37.0 37.0 37.0 37.0 37.0 110-114 35.7998 37.0 37.0 37.0 37.0 37.0 115-119 35.783100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.79100000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6223 37.0 37.0 37.0 37.0 37.0 130-134 35.614 37.0 37.0 37.0 37.0 37.0 135-139 35.5701 37.0 37.0 37.0 37.0 37.0 140-144 35.4702 37.0 37.0 37.0 37.0 37.0 145-149 35.4429 37.0 37.0 37.0 37.0 37.0 150 35.4155 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 1.0 24 3.0 25 7.0 26 6.0 27 9.0 28 18.0 29 20.0 30 46.0 31 57.0 32 73.0 33 111.0 34 176.0 35 357.0 36 2617.0 37 494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.113056528264135 16.708354177088545 21.935967983991997 35.24262131065532 2 20.375 27.725 35.35 16.55 3 21.224999999999998 31.574999999999996 26.275 20.925 4 22.475 37.6 20.674999999999997 19.25 5 22.625 36.8 21.4 19.175 6 17.45 37.85 23.150000000000002 21.55 7 16.725 16.025 43.15 24.099999999999998 8 19.575 21.8 28.525 30.099999999999998 9 20.25 22.05 29.849999999999998 27.85 10-14 21.185000000000002 29.345 26.534999999999997 22.935 15-19 21.085 28.439999999999998 27.794999999999998 22.68 20-24 21.72 28.804999999999996 27.87 21.605 25-29 21.32 29.56 27.185 21.935 30-34 21.505 29.360000000000003 27.32 21.815 35-39 21.26 29.304999999999996 27.92 21.515 40-44 21.404999999999998 28.660000000000004 27.93 22.005 45-49 21.135 29.34 27.785 21.740000000000002 50-54 21.529999999999998 28.895 27.6 21.975 55-59 22.05 28.325 27.765 21.86 60-64 21.634999999999998 28.075 28.005000000000003 22.285 65-69 21.759999999999998 28.27 27.744999999999997 22.225 70-74 21.48 28.62 27.805000000000003 22.095000000000002 75-79 21.555 29.195 27.155 22.095000000000002 80-84 21.61 28.48 27.765 22.145 85-89 21.790000000000003 28.549999999999997 27.66 22.0 90-94 21.745 28.575 27.800000000000004 21.88 95-99 21.83 27.939999999999998 28.215 22.015 100-104 21.755 27.950000000000003 28.544999999999998 21.75 105-109 21.9 27.79 28.555000000000003 21.755 110-114 21.740000000000002 28.560000000000002 28.215 21.485000000000003 115-119 22.505 29.13 27.565 20.8 120-124 22.155 28.595 27.505000000000003 21.745 125-129 21.805 28.565 27.935 21.695 130-134 22.61 28.26 27.36 21.77 135-139 21.805 28.02 28.265 21.91 140-144 21.959999999999997 27.87 28.050000000000004 22.12 145-149 22.295 27.595 28.16 21.95 150 21.65 28.675 27.6 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.5 24 8.0 25 9.0 26 7.0 27 9.5 28 11.0 29 13.5 30 19.0 31 30.0 32 40.5 33 51.0 34 64.5 35 71.5 36 91.5 37 125.5 38 145.0 39 165.0 40 194.5 41 231.0 42 269.0 43 276.5 44 262.0 45 257.5 46 241.0 47 217.5 48 218.0 49 203.0 50 154.5 51 116.5 52 98.5 53 101.0 54 83.5 55 46.5 56 35.5 57 31.5 58 28.0 59 21.5 60 15.0 61 12.0 62 6.0 63 2.0 64 1.0 65 2.5 66 3.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.2 #Duplication Level Percentage of deduplicated Percentage of total 1 87.89682539682539 77.525 2 10.96938775510204 19.35 3 0.992063492063492 2.625 4 0.1417233560090703 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.3875000000000002 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.5125000000000002 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAAGA 10 0.006973645 144.0 6 >>END_MODULE SRR21683875 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683875_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3955 37.0 37.0 37.0 37.0 37.0 2 36.371 37.0 37.0 37.0 37.0 37.0 3 36.507 37.0 37.0 37.0 37.0 37.0 4 36.426 37.0 37.0 37.0 37.0 37.0 5 36.4605 37.0 37.0 37.0 37.0 37.0 6 36.391 37.0 37.0 37.0 37.0 37.0 7 36.3725 37.0 37.0 37.0 37.0 37.0 8 36.494 37.0 37.0 37.0 37.0 37.0 9 36.5225 37.0 37.0 37.0 37.0 37.0 10-14 36.4875 37.0 37.0 37.0 37.0 37.0 15-19 36.4722 37.0 37.0 37.0 37.0 37.0 20-24 36.448699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4022 37.0 37.0 37.0 37.0 37.0 30-34 36.3646 37.0 37.0 37.0 37.0 37.0 35-39 36.3418 37.0 37.0 37.0 37.0 37.0 40-44 36.2987 37.0 37.0 37.0 37.0 37.0 45-49 36.2884 37.0 37.0 37.0 37.0 37.0 50-54 36.2583 37.0 37.0 37.0 37.0 37.0 55-59 36.231 37.0 37.0 37.0 37.0 37.0 60-64 36.17470000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1708 37.0 37.0 37.0 37.0 37.0 70-74 36.1486 37.0 37.0 37.0 37.0 37.0 75-79 36.1308 37.0 37.0 37.0 37.0 37.0 80-84 36.03 37.0 37.0 37.0 37.0 37.0 85-89 36.0175 37.0 37.0 37.0 37.0 37.0 90-94 35.96900000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9387 37.0 37.0 37.0 37.0 37.0 100-104 35.864799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.8485 37.0 37.0 37.0 37.0 37.0 110-114 35.8239 37.0 37.0 37.0 37.0 37.0 115-119 35.750600000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.661 37.0 37.0 37.0 37.0 37.0 125-129 35.6961 37.0 37.0 37.0 37.0 37.0 130-134 35.6614 37.0 37.0 37.0 37.0 37.0 135-139 35.4859 37.0 37.0 37.0 37.0 37.0 140-144 35.463 37.0 37.0 37.0 37.0 37.0 145-149 35.4232 37.0 37.0 37.0 37.0 37.0 150 35.466 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 4.0 19 0.0 20 2.0 21 4.0 22 0.0 23 5.0 24 4.0 25 4.0 26 11.0 27 7.0 28 19.0 29 27.0 30 30.0 31 49.0 32 52.0 33 97.0 34 146.0 35 389.0 36 2723.0 37 426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.650000000000002 18.75 21.475 34.125 2 21.5 26.900000000000002 33.800000000000004 17.8 3 20.325 33.25 27.150000000000002 19.275000000000002 4 24.55 36.375 19.675 19.400000000000002 5 22.325 38.975 20.05 18.65 6 17.2 37.275000000000006 22.525000000000002 23.0 7 15.8 16.575 43.55 24.075 8 20.200000000000003 21.025 26.55 32.225 9 19.650000000000002 23.724999999999998 29.099999999999998 27.525 10-14 20.89 29.17 26.85 23.09 15-19 21.26 27.325 28.854999999999997 22.56 20-24 21.485000000000003 28.27 27.97 22.275 25-29 21.375 28.87 27.834999999999997 21.92 30-34 20.990000000000002 29.23 28.27 21.51 35-39 21.48 28.555000000000003 27.875 22.09 40-44 21.955 28.74 27.58 21.725 45-49 21.240000000000002 28.815 27.105 22.84 50-54 21.490000000000002 28.775000000000002 28.03 21.705 55-59 20.855 29.099999999999998 27.865000000000002 22.18 60-64 21.58 28.000000000000004 27.88 22.54 65-69 21.955 28.27 28.065 21.709999999999997 70-74 21.349999999999998 28.110000000000003 28.095 22.445 75-79 21.61 28.405 27.334999999999997 22.650000000000002 80-84 21.404999999999998 28.265 27.839999999999996 22.49 85-89 22.31 28.13 27.694999999999997 21.865000000000002 90-94 21.310000000000002 28.549999999999997 27.794999999999998 22.345000000000002 95-99 22.009999999999998 28.444999999999997 27.665 21.88 100-104 21.755 27.98 27.98 22.285 105-109 21.485000000000003 28.405 27.634999999999998 22.475 110-114 22.375 27.665 28.155 21.805 115-119 22.48 28.060000000000002 28.000000000000004 21.46 120-124 21.925 27.91 28.035 22.13 125-129 22.5 28.345 27.605 21.55 130-134 22.46 27.785 28.115000000000002 21.64 135-139 22.365 28.455000000000002 27.779999999999998 21.4 140-144 22.66 27.595 28.110000000000003 21.634999999999998 145-149 22.705000000000002 28.38 27.47 21.445 150 21.925 27.6 27.250000000000004 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.5 17 1.0 18 0.5 19 1.0 20 2.0 21 1.0 22 2.0 23 3.0 24 4.0 25 5.5 26 8.5 27 10.5 28 13.0 29 16.5 30 16.0 31 24.5 32 39.0 33 50.0 34 60.5 35 73.5 36 89.5 37 104.5 38 127.5 39 167.5 40 199.0 41 220.5 42 257.5 43 280.5 44 273.5 45 275.5 46 254.5 47 214.0 48 205.0 49 195.0 50 166.0 51 130.5 52 104.5 53 86.5 54 80.0 55 67.0 56 41.5 57 30.0 58 25.5 59 19.0 60 11.5 61 8.5 62 9.0 63 6.0 64 2.5 65 2.5 66 3.5 67 2.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.075 #Duplication Level Percentage of deduplicated Percentage of total 1 87.68095373261426 77.225 2 11.183650298041442 19.7 3 1.0502412716434857 2.775 4 0.08515469770082316 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6499999999999999 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.175 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.4874999999999998 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.6375000000000002 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATAGGA 10 0.006973645 144.0 7 >>END_MODULE Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817881 spots for SRR21683875.sra Written 817881 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra Read 817864 spots for SRR21683875.sra Written 817864 spots for SRR21683875.sra SRR ids: ['SRR21683875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__tl5ybn5 SRR21683875.sra spots: 16357297 blocks: [[1, 817864], [817865, 1635728], [1635729, 2453592], [2453593, 3271456], [3271457, 4089320], [4089321, 4907184], [4907185, 5725048], [5725049, 6542912], [6542913, 7360776], [7360777, 8178640], [8178641, 8996504], [8996505, 9814368], [9814369, 10632232], [10632233, 11450096], [11450097, 12267960], [12267961, 13085824], [13085825, 13903688], [13903689, 14721552], [14721553, 15539416], [15539417, 16357297]] SRR21683875 file size 5505276 SRR21683875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21683875 SRR21683875_1.fastq SRR21683875_2.fastq Input file: SRR21683875_1.fastq Paired file: SRR21683875_2.fastq trimmed: SRR21683875-trimmed-pair1.fastq, SRR21683875-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:35:49 2025 >> started Wed Feb 12 04:36:07 2025 >> done (18.110s) 16357297 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 162 ( 0.00%) empty read pairs filtered out after trimming by size control 16357046 (100.00%) read pairs available; of these: 501633 ( 3.07%) trimmed read pairs available after processing 15855413 (96.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 15 0.00% 21 4 0.00% 22 11 0.00% 23 9 0.00% 24 4 0.00% 25 5 0.00% 26 15 0.00% 27 13 0.00% 28 12 0.00% 29 10 0.00% 30 9 0.00% 31 11 0.00% 32 16 0.00% 33 14 0.00% 34 10 0.00% 35 13 0.00% 36 13 0.00% 37 11 0.00% 38 15 0.00% 39 24 0.00% 40 23 0.00% 41 22 0.00% 42 22 0.00% 43 25 0.00% 44 46 0.00% 45 30 0.00% 46 39 0.00% 47 45 0.00% 48 61 0.00% 49 72 0.00% 50 105 0.00% 51 98 0.00% 52 104 0.00% 53 120 0.00% 54 91 0.00% 55 128 0.00% 56 155 0.00% 57 210 0.00% 58 263 0.00% 59 309 0.00% 60 314 0.00% 61 368 0.00% 62 326 0.00% 63 299 0.00% 64 268 0.00% 65 330 0.00% 66 342 0.00% 67 385 0.00% 68 429 0.00% 69 500 0.00% 70 508 0.00% 71 554 0.00% 72 561 0.00% 73 614 0.00% 74 620 0.00% 75 680 0.00% 76 682 0.00% 77 706 0.00% 78 829 0.01% 79 854 0.01% 80 935 0.01% 81 1000 0.01% 82 1119 0.01% 83 1327 0.01% 84 1215 0.01% 85 1352 0.01% 86 1390 0.01% 87 1641 0.01% 88 1610 0.01% 89 1794 0.01% 90 1860 0.01% 91 2030 0.01% 92 2160 0.01% 93 2345 0.01% 94 2520 0.02% 95 2576 0.02% 96 2737 0.02% 97 2690 0.02% 98 2974 0.02% 99 3039 0.02% 100 3235 0.02% 101 3455 0.02% 102 3483 0.02% 103 3930 0.02% 104 4091 0.03% 105 4028 0.02% 106 4362 0.03% 107 4385 0.03% 108 4446 0.03% 109 4784 0.03% 110 4783 0.03% 111 5136 0.03% 112 5277 0.03% 113 5636 0.03% 114 5876 0.04% 115 6151 0.04% 116 6217 0.04% 117 6239 0.04% 118 6640 0.04% 119 6585 0.04% 120 7040 0.04% 121 7413 0.05% 122 7630 0.05% 123 7950 0.05% 124 8173 0.05% 125 8443 0.05% 126 8695 0.05% 127 8881 0.05% 128 9107 0.06% 129 9382 0.06% 130 9874 0.06% 131 10304 0.06% 132 10400 0.06% 133 10885 0.07% 134 11303 0.07% 135 11713 0.07% 136 11849 0.07% 137 12203 0.07% 138 12637 0.08% 139 13058 0.08% 140 13531 0.08% 141 13769 0.08% 142 14281 0.09% 143 14769 0.09% 144 15250 0.09% 145 15941 0.10% 146 16169 0.10% 147 16692 0.10% 148 17114 0.10% 149 17738 0.11% 150 15855413 96.93% 16357046 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=14.26 fanout-score-rank=10 prefix-density=0.19 prefix-fanout=6.9 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=278.08 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=32.4 sequence=TCATCATCAACA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=6.41 fanout-score-rank=18 prefix-density=0.14 prefix-fanout=4.1 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=290.95 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=31.6 sequence=TCATCATCAACA SRR21683875 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:36:59 Started mapping on | Feb 12 04:36:59 Finished on | Feb 12 04:40:57 Mapping speed, Million of reads per hour | 247.42 Number of input reads | 16357046 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14330105 Uniquely mapped reads % | 87.61% Average mapped length | 291.22 Number of splices: Total | 13727201 Number of splices: Annotated (sjdb) | 13325099 Number of splices: GT/AG | 13424975 Number of splices: GC/AG | 196910 Number of splices: AT/AC | 8353 Number of splices: Non-canonical | 96963 Mismatch rate per base, % | 1.94% Deletion rate per base | 0.12% Deletion average length | 3.25 Insertion rate per base | 0.08% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 793152 % of reads mapped to multiple loci | 4.85% Number of reads mapped to too many loci | 20664 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.21% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1233789 1233789 1233789 N_multimapping 793152 793152 793152 N_noFeature 406353 7216869 7343165 N_ambiguous 306952 66165 64952 UnstrandedReadsAssigned:13616800 PositiveStrandReadsAssigned:7047071 NegativeStrandReadsAssigned:6921988 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR21683875 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21683875-trimmed-pair1.fastq SRR21683875-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,357,046 reads, 13,116,866 reads pseudoaligned [quant] estimated average fragment length: 243.411 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR21683875.ke.tsv 34699 SRR21683875.se.tsv 87100 total ==> SRR21683875.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.59 1536.69 59.4902 Potri.005G024800.1.v4.1 1035 792.589 207 17.9525 Potri.004G059700.1.v4.1 961 718.589 0 0 Potri.007G009000.2.v4.1 1416 1173.59 0 0 Potri.003G141000.2.v4.1 2943 2700.59 80.1687 2.04056 Potri.016G087400.1.v4.1 270 56.0506 163 199.899 Potri.015G069301.1.v4.1 564 321.726 0 0 Potri.010G195200.1.v4.1 1773 1530.59 23 1.03293 Potri.012G127500.1.v4.1 977 734.589 88 8.23458 ==> SRR21683875.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 75 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 92 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 57 SRR21683875 completed mapping pipeline successfully