Starting /dee2/code/volunteer_pipeline.sh SRR21683876 current disk space = 3049144954880 free memory = 1301243000 SRR21683876 SRAfilesize 7de9045c9beadec80ed5d4f0cead2985 SRR21683876.sra SRR21683876.sra file validated SRR21683876 is paired end SRR21683876 is conventional basespace SRR21683876 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52875 37.0 37.0 37.0 37.0 37.0 2 36.424 37.0 37.0 37.0 37.0 37.0 3 36.5275 37.0 37.0 37.0 37.0 37.0 4 36.452 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.446 37.0 37.0 37.0 37.0 37.0 7 36.514 37.0 37.0 37.0 37.0 37.0 8 36.5295 37.0 37.0 37.0 37.0 37.0 9 36.5475 37.0 37.0 37.0 37.0 37.0 10-14 36.5315 37.0 37.0 37.0 37.0 37.0 15-19 36.4835 37.0 37.0 37.0 37.0 37.0 20-24 36.4889 37.0 37.0 37.0 37.0 37.0 25-29 36.3955 37.0 37.0 37.0 37.0 37.0 30-34 36.3868 37.0 37.0 37.0 37.0 37.0 35-39 36.3729 37.0 37.0 37.0 37.0 37.0 40-44 36.3583 37.0 37.0 37.0 37.0 37.0 45-49 36.2963 37.0 37.0 37.0 37.0 37.0 50-54 36.268299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1766 37.0 37.0 37.0 37.0 37.0 60-64 36.1644 37.0 37.0 37.0 37.0 37.0 65-69 36.1329 37.0 37.0 37.0 37.0 37.0 70-74 36.1749 37.0 37.0 37.0 37.0 37.0 75-79 36.1255 37.0 37.0 37.0 37.0 37.0 80-84 36.0577 37.0 37.0 37.0 37.0 37.0 85-89 36.0245 37.0 37.0 37.0 37.0 37.0 90-94 35.99679999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.991600000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9101 37.0 37.0 37.0 37.0 37.0 105-109 35.7819 37.0 37.0 37.0 37.0 37.0 110-114 35.7964 37.0 37.0 37.0 37.0 37.0 115-119 35.7999 37.0 37.0 37.0 37.0 37.0 120-124 35.7632 37.0 37.0 37.0 37.0 37.0 125-129 35.65 37.0 37.0 37.0 37.0 37.0 130-134 35.660399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5935 37.0 37.0 37.0 37.0 37.0 140-144 35.581399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4171 37.0 37.0 37.0 37.0 37.0 150 35.4085 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 0.0 21 2.0 22 1.0 23 4.0 24 7.0 25 6.0 26 5.0 27 14.0 28 14.0 29 35.0 30 46.0 31 61.0 32 62.0 33 92.0 34 154.0 35 304.0 36 2674.0 37 517.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.98149537384346 17.35433858464616 22.18054513628407 34.48362090522631 2 21.825 27.025 35.3 15.85 3 20.325 32.574999999999996 26.575 20.525 4 23.45 35.4 20.674999999999997 20.474999999999998 5 23.65 35.85 21.9 18.6 6 17.525 36.95 23.0 22.525000000000002 7 16.125 17.125 42.725 24.025 8 18.925 22.075 27.55 31.45 9 20.599999999999998 21.224999999999998 30.7 27.474999999999998 10-14 21.445 28.535 26.195 23.825 15-19 21.634999999999998 27.97 27.725 22.67 20-24 21.38 28.845 28.095 21.68 25-29 20.810000000000002 28.939999999999998 27.98 22.27 30-34 21.044999999999998 28.910000000000004 27.455000000000002 22.59 35-39 21.135 28.64 28.53 21.695 40-44 21.565 28.63 27.015 22.79 45-49 21.865000000000002 28.725 27.985 21.425 50-54 21.84 28.384999999999998 27.634999999999998 22.14 55-59 21.395 28.689999999999998 27.939999999999998 21.975 60-64 22.425 28.265 27.310000000000002 22.0 65-69 22.305 28.294999999999998 27.54 21.86 70-74 21.67 28.660000000000004 27.284999999999997 22.384999999999998 75-79 22.105 27.605 27.935 22.355 80-84 21.83 28.79 27.115000000000002 22.264999999999997 85-89 21.755 28.315 27.839999999999996 22.09 90-94 22.235 28.050000000000004 27.694999999999997 22.02 95-99 22.175 28.585 27.705000000000002 21.535 100-104 21.955 28.255000000000003 27.834999999999997 21.955 105-109 22.325 28.139999999999997 27.634999999999998 21.9 110-114 22.985 27.625 27.685 21.705 115-119 22.134999999999998 28.310000000000002 27.24 22.314999999999998 120-124 22.305 27.24 28.215 22.24 125-129 22.03 27.525 28.349999999999998 22.095000000000002 130-134 22.395 28.095 27.750000000000004 21.759999999999998 135-139 22.03 28.03 27.815 22.125 140-144 22.825 28.199999999999996 27.26 21.715 145-149 22.025 27.97 27.975 22.03 150 21.95 27.975 26.424999999999997 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 2.0 25 4.0 26 2.5 27 6.0 28 11.5 29 19.0 30 29.5 31 29.0 32 31.5 33 33.5 34 50.5 35 81.0 36 98.0 37 112.0 38 140.0 39 184.0 40 202.0 41 220.5 42 243.0 43 254.5 44 264.0 45 274.0 46 257.5 47 217.5 48 195.5 49 175.5 50 169.0 51 149.0 52 126.5 53 101.0 54 68.5 55 49.5 56 44.5 57 43.0 58 30.0 59 22.5 60 15.0 61 9.5 62 7.0 63 7.5 64 6.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.94999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 89.09499718943226 79.25 2 9.527824620573355 16.950000000000003 3 1.2366498032602586 3.3000000000000003 4 0.1405283867341203 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6499999999999999 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1375 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACCA 10 0.006973645 144.0 3 >>END_MODULE SRR21683876 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683876_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3365 37.0 37.0 37.0 37.0 37.0 2 36.3875 37.0 37.0 37.0 37.0 37.0 3 36.401 37.0 37.0 37.0 37.0 37.0 4 36.3535 37.0 37.0 37.0 37.0 37.0 5 36.4545 37.0 37.0 37.0 37.0 37.0 6 36.3945 37.0 37.0 37.0 37.0 37.0 7 36.3705 37.0 37.0 37.0 37.0 37.0 8 36.478 37.0 37.0 37.0 37.0 37.0 9 36.5435 37.0 37.0 37.0 37.0 37.0 10-14 36.459199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3857 37.0 37.0 37.0 37.0 37.0 20-24 36.436099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.389799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.342600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3297 37.0 37.0 37.0 37.0 37.0 40-44 36.3448 37.0 37.0 37.0 37.0 37.0 45-49 36.2668 37.0 37.0 37.0 37.0 37.0 50-54 36.2592 37.0 37.0 37.0 37.0 37.0 55-59 36.19670000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.181 37.0 37.0 37.0 37.0 37.0 65-69 36.1645 37.0 37.0 37.0 37.0 37.0 70-74 36.051300000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0689 37.0 37.0 37.0 37.0 37.0 80-84 36.017399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.03959999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.994499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.937400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8749 37.0 37.0 37.0 37.0 37.0 105-109 35.911899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7769 37.0 37.0 37.0 37.0 37.0 115-119 35.767999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.67659999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7264 37.0 37.0 37.0 37.0 37.0 130-134 35.6635 37.0 37.0 37.0 37.0 37.0 135-139 35.5201 37.0 37.0 37.0 37.0 37.0 140-144 35.503499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4346 37.0 37.0 37.0 37.0 37.0 150 35.3995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 1.0 23 6.0 24 3.0 25 13.0 26 3.0 27 7.0 28 19.0 29 32.0 30 37.0 31 49.0 32 56.0 33 90.0 34 153.0 35 363.0 36 2766.0 37 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.174999999999997 16.85 23.175 33.800000000000004 2 21.15 27.500000000000004 34.5 16.85 3 20.75 32.725 26.125 20.4 4 23.275000000000002 38.0 18.875 19.85 5 22.575 36.975 21.099999999999998 19.35 6 17.549999999999997 36.725 22.675 23.05 7 18.025 16.275000000000002 41.875 23.825 8 19.425 20.45 27.875 32.25 9 18.975 21.8 30.15 29.075 10-14 20.655 28.7 27.400000000000002 23.244999999999997 15-19 21.27 27.389999999999997 28.115000000000002 23.225 20-24 21.535 28.58 27.994999999999997 21.89 25-29 21.09 28.355000000000004 28.349999999999998 22.205 30-34 21.125 29.2 27.49 22.185 35-39 21.93 29.28 27.339999999999996 21.45 40-44 21.81 28.1 28.375 21.715 45-49 21.73 27.725 28.26 22.285 50-54 22.215 28.265 27.994999999999997 21.525 55-59 21.59 28.58 27.54 22.29 60-64 21.154999999999998 28.48 28.075 22.29 65-69 21.65 28.389999999999997 27.250000000000004 22.71 70-74 21.29 28.775000000000002 27.29 22.645 75-79 22.255 27.965 27.165 22.615 80-84 21.685 28.4 27.55 22.365 85-89 22.15 27.839999999999996 28.105000000000004 21.905 90-94 21.565 28.835 27.33 22.27 95-99 21.55 27.894999999999996 28.08 22.475 100-104 23.01 28.65 26.795 21.545 105-109 22.605 27.584999999999997 27.815 21.995 110-114 22.45 27.37 27.589999999999996 22.59 115-119 22.2 28.87 27.445000000000004 21.485000000000003 120-124 22.585 27.975 27.834999999999997 21.605 125-129 22.605 27.615000000000002 27.315 22.465 130-134 22.655 27.815 27.865000000000002 21.665 135-139 22.61 28.000000000000004 27.67 21.72 140-144 22.88 27.634999999999998 28.125 21.36 145-149 22.805 27.66 28.005000000000003 21.529999999999998 150 23.200000000000003 28.575 27.224999999999998 21.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 2.5 19 1.0 20 0.0 21 0.5 22 2.0 23 3.0 24 3.5 25 3.0 26 5.0 27 7.5 28 9.0 29 15.0 30 23.5 31 27.5 32 32.0 33 43.5 34 52.0 35 74.0 36 105.5 37 114.5 38 137.5 39 172.0 40 189.0 41 204.0 42 229.5 43 247.5 44 259.5 45 267.5 46 251.0 47 228.5 48 227.0 49 215.0 50 167.5 51 134.5 52 124.5 53 102.0 54 78.5 55 65.0 56 43.5 57 26.5 58 26.5 59 23.5 60 12.5 61 8.5 62 8.0 63 6.5 64 4.5 65 2.5 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.75 #Duplication Level Percentage of deduplicated Percentage of total 1 88.84507042253522 78.85 2 9.802816901408452 17.4 3 1.1830985915492958 3.15 4 0.16901408450704225 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.5625 0.0 0.0 0.0 0.0 138 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACCA 10 0.006973645 144.0 2 TCCATGT 10 0.006973645 144.0 6 GATTTCA 10 0.006973645 144.0 3 >>END_MODULE Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951657 spots for SRR21683876.sra Written 951657 spots for SRR21683876.sra Read 951666 spots for SRR21683876.sra Written 951666 spots for SRR21683876.sra SRR ids: ['SRR21683876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lmyx_klm SRR21683876.sra spots: 19033149 blocks: [[1, 951657], [951658, 1903314], [1903315, 2854971], [2854972, 3806628], [3806629, 4758285], [4758286, 5709942], [5709943, 6661599], [6661600, 7613256], [7613257, 8564913], [8564914, 9516570], [9516571, 10468227], [10468228, 11419884], [11419885, 12371541], [12371542, 13323198], [13323199, 14274855], [14274856, 15226512], [15226513, 16178169], [16178170, 17129826], [17129827, 18081483], [18081484, 19033149]] SRR21683876 file size 6409422 SRR21683876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21683876 SRR21683876_1.fastq SRR21683876_2.fastq Input file: SRR21683876_1.fastq Paired file: SRR21683876_2.fastq trimmed: SRR21683876-trimmed-pair1.fastq, SRR21683876-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:15:34 2025 >> started Wed Feb 12 04:15:57 2025 >> done (23.580s) 19033149 read pairs processed; of these: 87 ( 0.00%) short read pairs filtered out after trimming by size control 128 ( 0.00%) empty read pairs filtered out after trimming by size control 19032934 (100.00%) read pairs available; of these: 482292 ( 2.53%) trimmed read pairs available after processing 18550642 (97.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 11 0.00% 21 6 0.00% 22 14 0.00% 23 6 0.00% 24 9 0.00% 25 8 0.00% 26 10 0.00% 27 8 0.00% 28 20 0.00% 29 19 0.00% 30 7 0.00% 31 6 0.00% 32 13 0.00% 33 15 0.00% 34 15 0.00% 35 21 0.00% 36 18 0.00% 37 14 0.00% 38 10 0.00% 39 12 0.00% 40 12 0.00% 41 25 0.00% 42 29 0.00% 43 27 0.00% 44 17 0.00% 45 19 0.00% 46 31 0.00% 47 35 0.00% 48 52 0.00% 49 64 0.00% 50 90 0.00% 51 75 0.00% 52 96 0.00% 53 82 0.00% 54 74 0.00% 55 105 0.00% 56 101 0.00% 57 164 0.00% 58 181 0.00% 59 256 0.00% 60 243 0.00% 61 274 0.00% 62 279 0.00% 63 265 0.00% 64 224 0.00% 65 233 0.00% 66 227 0.00% 67 286 0.00% 68 382 0.00% 69 436 0.00% 70 454 0.00% 71 450 0.00% 72 505 0.00% 73 489 0.00% 74 550 0.00% 75 549 0.00% 76 571 0.00% 77 579 0.00% 78 634 0.00% 79 725 0.00% 80 831 0.00% 81 888 0.00% 82 1011 0.01% 83 1038 0.01% 84 1097 0.01% 85 1159 0.01% 86 1231 0.01% 87 1212 0.01% 88 1428 0.01% 89 1548 0.01% 90 1664 0.01% 91 1625 0.01% 92 1873 0.01% 93 1994 0.01% 94 2134 0.01% 95 2198 0.01% 96 2388 0.01% 97 2451 0.01% 98 2616 0.01% 99 2731 0.01% 100 2879 0.02% 101 2958 0.02% 102 3201 0.02% 103 3549 0.02% 104 3589 0.02% 105 3775 0.02% 106 3880 0.02% 107 3879 0.02% 108 4252 0.02% 109 4302 0.02% 110 4417 0.02% 111 4517 0.02% 112 4914 0.03% 113 5098 0.03% 114 5453 0.03% 115 5731 0.03% 116 5798 0.03% 117 6123 0.03% 118 6147 0.03% 119 6401 0.03% 120 6568 0.03% 121 6978 0.04% 122 7216 0.04% 123 7516 0.04% 124 8022 0.04% 125 8133 0.04% 126 8312 0.04% 127 8634 0.05% 128 8964 0.05% 129 9197 0.05% 130 9524 0.05% 131 10116 0.05% 132 10389 0.05% 133 10651 0.06% 134 11017 0.06% 135 11343 0.06% 136 11884 0.06% 137 12181 0.06% 138 12516 0.07% 139 12757 0.07% 140 13503 0.07% 141 13596 0.07% 142 14258 0.07% 143 14821 0.08% 144 15231 0.08% 145 16033 0.08% 146 16517 0.09% 147 16929 0.09% 148 17485 0.09% 149 17870 0.09% 150 18550642 97.47% 19032934 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=13.98 fanout-score-rank=10 prefix-density=0.20 prefix-fanout=6.9 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=276.28 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=32.9 sequence=TCATCATCAACA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=13.68 fanout-score-rank=11 prefix-density=0.19 prefix-fanout=6.8 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=300.03 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=32.6 sequence=TCATCATCAACA SRR21683876 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 12 04:28:51 Started mapping on | Feb 12 04:28:51 Finished on | Feb 12 04:33:08 Mapping speed, Million of reads per hour | 266.61 Number of input reads | 19032695 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 16387982 Uniquely mapped reads % | 86.10% Average mapped length | 272.27 Number of splices: Total | 14532918 Number of splices: Annotated (sjdb) | 14108246 Number of splices: GT/AG | 14208271 Number of splices: GC/AG | 208920 Number of splices: AT/AC | 9227 Number of splices: Non-canonical | 106500 Mismatch rate per base, % | 1.99% Deletion rate per base | 0.11% Deletion average length | 3.20 Insertion rate per base | 0.08% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 869138 % of reads mapped to multiple loci | 4.57% Number of reads mapped to too many loci | 28675 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.01% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1775599 1775599 1775599 N_multimapping 869138 869138 869138 N_noFeature 468158 8264250 8381448 N_ambiguous 375730 83389 82607 UnstrandedReadsAssigned:15544094 PositiveStrandReadsAssigned:8040343 NegativeStrandReadsAssigned:7923927 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR21683876 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21683876-trimmed-pair1.fastq SRR21683876-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,032,695 reads, 15,370,593 reads pseudoaligned [quant] estimated average fragment length: 226.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR21683876.ke.tsv 34699 SRR21683876.se.tsv 87100 total ==> SRR21683876.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.48 1751 56.7444 Potri.005G024800.1.v4.1 1035 809.484 245 17.5813 Potri.004G059700.1.v4.1 961 735.489 0 0 Potri.007G009000.2.v4.1 1416 1190.48 0 0 Potri.003G141000.2.v4.1 2943 2717.48 122 2.60786 Potri.016G087400.1.v4.1 270 64.6709 299 268.568 Potri.015G069301.1.v4.1 564 338.614 0 0 Potri.010G195200.1.v4.1 1773 1547.48 38 1.42643 Potri.012G127500.1.v4.1 977 751.489 107 8.27091 ==> SRR21683876.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 86 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 118 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 70 SRR21683876 completed mapping pipeline successfully