Starting /dee2/code/volunteer_pipeline.sh SRR21683877 current disk space = 3049184141312 free memory = 1579366092 SRR21683877 SRAfilesize a2df18cfc2ff2f2f734e0ca38156be7d SRR21683877.sra SRR21683877.sra file validated SRR21683877 is paired end SRR21683877 is conventional basespace SRR21683877 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53175 37.0 37.0 37.0 37.0 37.0 2 36.449 37.0 37.0 37.0 37.0 37.0 3 36.438 37.0 37.0 37.0 37.0 37.0 4 36.557 37.0 37.0 37.0 37.0 37.0 5 36.559 37.0 37.0 37.0 37.0 37.0 6 36.401 37.0 37.0 37.0 37.0 37.0 7 36.481 37.0 37.0 37.0 37.0 37.0 8 36.555 37.0 37.0 37.0 37.0 37.0 9 36.523 37.0 37.0 37.0 37.0 37.0 10-14 36.512600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.494800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.452600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.403999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.414199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.370599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3494 37.0 37.0 37.0 37.0 37.0 45-49 36.262 37.0 37.0 37.0 37.0 37.0 50-54 36.2476 37.0 37.0 37.0 37.0 37.0 55-59 36.2208 37.0 37.0 37.0 37.0 37.0 60-64 36.12429999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1038 37.0 37.0 37.0 37.0 37.0 70-74 36.074200000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0513 37.0 37.0 37.0 37.0 37.0 80-84 36.028999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9419 37.0 37.0 37.0 37.0 37.0 90-94 35.9525 37.0 37.0 37.0 37.0 37.0 95-99 35.9322 37.0 37.0 37.0 37.0 37.0 100-104 35.8566 37.0 37.0 37.0 37.0 37.0 105-109 35.7915 37.0 37.0 37.0 37.0 37.0 110-114 35.776199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7608 37.0 37.0 37.0 37.0 37.0 120-124 35.774899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.693 37.0 37.0 37.0 37.0 37.0 130-134 35.6083 37.0 37.0 37.0 37.0 37.0 135-139 35.6153 37.0 37.0 37.0 37.0 37.0 140-144 35.5711 37.0 37.0 37.0 37.0 37.0 145-149 35.444 37.0 37.0 37.0 37.0 37.0 150 35.515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 2.0 21 0.0 22 3.0 23 3.0 24 5.0 25 6.0 26 9.0 27 14.0 28 27.0 29 30.0 30 39.0 31 58.0 32 66.0 33 94.0 34 135.0 35 317.0 36 2654.0 37 537.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.456614153538382 19.004751187796952 20.7551887971993 33.78344586146537 2 20.875 28.975 33.650000000000006 16.5 3 21.349999999999998 33.35 24.575 20.724999999999998 4 23.674999999999997 37.05 19.375 19.900000000000002 5 21.25 37.875 21.55 19.325 6 18.625 37.7 22.475 21.2 7 16.975 16.2 42.75 24.075 8 19.8 21.15 28.299999999999997 30.75 9 19.900000000000002 21.375 30.675 28.050000000000004 10-14 20.875 28.4 27.02 23.705000000000002 15-19 21.47 28.675 27.27 22.585 20-24 21.310000000000002 28.945 27.715 22.03 25-29 20.525 28.78 28.810000000000002 21.884999999999998 30-34 21.310000000000002 28.54 28.46 21.69 35-39 21.759999999999998 29.659999999999997 26.88 21.7 40-44 22.285 28.285 27.644999999999996 21.785 45-49 21.310000000000002 29.12 27.084999999999997 22.485 50-54 21.785 28.244999999999997 27.800000000000004 22.17 55-59 21.52 28.410000000000004 27.98 22.09 60-64 21.77 28.389999999999997 28.055000000000003 21.785 65-69 21.33 28.435 27.74 22.495 70-74 22.105 28.22 27.72 21.955 75-79 21.725 28.144999999999996 27.950000000000003 22.18 80-84 21.59 28.53 27.67 22.21 85-89 22.025 28.060000000000002 27.67 22.245 90-94 21.815 28.29 27.894999999999996 22.0 95-99 21.67 27.72 28.67 21.94 100-104 22.435 27.894999999999996 28.01 21.66 105-109 21.645 29.28 27.35 21.725 110-114 22.105 28.915000000000003 27.439999999999998 21.54 115-119 21.86 29.025000000000002 27.715 21.4 120-124 22.189999999999998 27.625 28.18 22.005 125-129 22.005 28.595 27.415 21.985 130-134 22.065 28.315 28.005000000000003 21.615000000000002 135-139 22.095000000000002 28.28 28.16 21.465 140-144 21.959999999999997 28.615000000000002 27.57 21.855 145-149 21.94 28.27 27.74 22.05 150 22.0 26.375 29.299999999999997 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 1.5 22 2.0 23 3.0 24 3.5 25 6.5 26 8.5 27 10.0 28 13.0 29 12.5 30 18.0 31 36.0 32 43.5 33 37.5 34 56.5 35 85.0 36 91.0 37 113.5 38 153.5 39 178.5 40 197.0 41 200.5 42 216.0 43 262.5 44 274.5 45 259.0 46 260.0 47 256.5 48 229.5 49 192.5 50 159.0 51 126.0 52 97.5 53 84.0 54 68.0 55 56.0 56 51.5 57 36.0 58 25.5 59 19.5 60 16.5 61 12.5 62 5.5 63 4.5 64 2.5 65 2.5 66 4.0 67 2.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.725 #Duplication Level Percentage of deduplicated Percentage of total 1 87.54630948988316 76.8 2 11.114277571957823 19.5 3 1.1684240524365916 3.075 4 0.14249073810202337 0.5 5 0.028498147620404674 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAGCACAACCATGTCCTTAGATCCCACCCCCTCAGAAGCCCAATACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR21683877 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683877_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3835 37.0 37.0 37.0 37.0 37.0 2 36.2725 37.0 37.0 37.0 37.0 37.0 3 36.4105 37.0 37.0 37.0 37.0 37.0 4 36.389 37.0 37.0 37.0 37.0 37.0 5 36.4525 37.0 37.0 37.0 37.0 37.0 6 36.279 37.0 37.0 37.0 37.0 37.0 7 36.268 37.0 37.0 37.0 37.0 37.0 8 36.346 37.0 37.0 37.0 37.0 37.0 9 36.3825 37.0 37.0 37.0 37.0 37.0 10-14 36.4099 37.0 37.0 37.0 37.0 37.0 15-19 36.395599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3686 37.0 37.0 37.0 37.0 37.0 25-29 36.3645 37.0 37.0 37.0 37.0 37.0 30-34 36.3017 37.0 37.0 37.0 37.0 37.0 35-39 36.2846 37.0 37.0 37.0 37.0 37.0 40-44 36.250800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2008 37.0 37.0 37.0 37.0 37.0 50-54 36.1837 37.0 37.0 37.0 37.0 37.0 55-59 36.1845 37.0 37.0 37.0 37.0 37.0 60-64 36.0502 37.0 37.0 37.0 37.0 37.0 65-69 36.098800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.05159999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.015499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9997 37.0 37.0 37.0 37.0 37.0 85-89 35.953900000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9277 37.0 37.0 37.0 37.0 37.0 95-99 35.8942 37.0 37.0 37.0 37.0 37.0 100-104 35.8655 37.0 37.0 37.0 37.0 37.0 105-109 35.805 37.0 37.0 37.0 37.0 37.0 110-114 35.791000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7377 37.0 37.0 37.0 37.0 37.0 120-124 35.6391 37.0 37.0 37.0 37.0 37.0 125-129 35.6636 37.0 37.0 37.0 37.0 37.0 130-134 35.527699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5096 37.0 37.0 37.0 37.0 37.0 140-144 35.404700000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3818 37.0 37.0 37.0 37.0 37.0 150 35.363 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 0.0 20 3.0 21 3.0 22 1.0 23 2.0 24 2.0 25 11.0 26 13.0 27 16.0 28 17.0 29 26.0 30 32.0 31 44.0 32 64.0 33 87.0 34 162.0 35 389.0 36 2736.0 37 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.825 17.675 22.225 34.275 2 22.725 26.125 34.1 17.05 3 22.0 30.775000000000002 25.8 21.425 4 22.375 37.35 18.5 21.775 5 22.2 36.125 22.6 19.075 6 16.3 37.6 24.425 21.675 7 15.775 14.924999999999999 44.2 25.1 8 19.625 20.474999999999998 28.299999999999997 31.6 9 18.825 23.325000000000003 29.799999999999997 28.050000000000004 10-14 20.955 28.565 27.41 23.07 15-19 21.13 27.705000000000002 28.249999999999996 22.915 20-24 21.325 29.285 27.665 21.725 25-29 21.345 28.65 27.575 22.43 30-34 21.13 29.32 28.000000000000004 21.55 35-39 21.375 29.354999999999997 27.474999999999998 21.795 40-44 21.61 28.694999999999997 27.534999999999997 22.16 45-49 21.775 28.62 27.705000000000002 21.9 50-54 21.195 28.83 28.075 21.9 55-59 22.015 28.82 27.450000000000003 21.715 60-64 21.72 29.07 27.450000000000003 21.759999999999998 65-69 21.105 28.084999999999997 28.4 22.41 70-74 21.98 27.99 27.88 22.15 75-79 21.85 27.57 28.16 22.42 80-84 21.66 28.194999999999997 27.474999999999998 22.67 85-89 21.665 28.665000000000003 27.52 22.15 90-94 21.895 28.470000000000002 27.505000000000003 22.13 95-99 22.02 27.634999999999998 28.535 21.81 100-104 22.1 28.325 27.615000000000002 21.959999999999997 105-109 21.795 28.095 27.805000000000003 22.305 110-114 22.095000000000002 28.199999999999996 28.1 21.605 115-119 21.51 28.365000000000002 28.34 21.785 120-124 22.009999999999998 27.834999999999997 28.205000000000002 21.95 125-129 21.83 27.939999999999998 28.610000000000003 21.62 130-134 22.23 27.985 28.005000000000003 21.78 135-139 22.900000000000002 27.834999999999997 28.205000000000002 21.060000000000002 140-144 22.685 28.244999999999997 27.015 22.055 145-149 22.61 27.68 27.905 21.805 150 22.175 27.950000000000003 27.925 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 1.0 25 3.0 26 7.0 27 9.0 28 11.5 29 13.0 30 16.5 31 30.0 32 37.5 33 45.0 34 53.0 35 67.5 36 91.0 37 123.0 38 143.0 39 173.0 40 219.5 41 243.5 42 265.0 43 263.0 44 260.5 45 253.0 46 240.5 47 236.5 48 213.0 49 189.5 50 174.5 51 146.5 52 106.5 53 80.5 54 64.5 55 47.5 56 34.5 57 30.0 58 29.0 59 24.5 60 11.5 61 5.0 62 9.5 63 8.5 64 2.5 65 1.5 66 2.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.55 #Duplication Level Percentage of deduplicated Percentage of total 1 87.2644203312393 76.4 2 11.393489434608794 19.950000000000003 3 1.227869788692176 3.225 4 0.08566533409480297 0.3 5 0.028555111364934323 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTTCCTTGTACTCTTCATGCAGTTTCCCTCCCCACTCTTTTATTTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.05 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAACT 10 0.006973645 144.0 1 TAACTTC 10 0.006973645 144.0 2 TCCCGGT 10 0.006973645 144.0 8 CCCCCCC 40 0.007966741 18.0 130-134 >>END_MODULE Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028497 spots for SRR21683877.sra Written 1028497 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra Read 1028495 spots for SRR21683877.sra Written 1028495 spots for SRR21683877.sra SRR ids: ['SRR21683877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1ldmct_b SRR21683877.sra spots: 20569902 blocks: [[1, 1028495], [1028496, 2056990], [2056991, 3085485], [3085486, 4113980], [4113981, 5142475], [5142476, 6170970], [6170971, 7199465], [7199466, 8227960], [8227961, 9256455], [9256456, 10284950], [10284951, 11313445], [11313446, 12341940], [12341941, 13370435], [13370436, 14398930], [14398931, 15427425], [15427426, 16455920], [16455921, 17484415], [17484416, 18512910], [18512911, 19541405], [19541406, 20569902]] SRR21683877 file size 6928676 SRR21683877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21683877 SRR21683877_1.fastq SRR21683877_2.fastq Input file: SRR21683877_1.fastq Paired file: SRR21683877_2.fastq trimmed: SRR21683877-trimmed-pair1.fastq, SRR21683877-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:33:20 2025 >> started Wed Feb 12 04:33:47 2025 >> done (26.621s) 20569902 read pairs processed; of these: 153 ( 0.00%) short read pairs filtered out after trimming by size control 142 ( 0.00%) empty read pairs filtered out after trimming by size control 20569607 (100.00%) read pairs available; of these: 490337 ( 2.38%) trimmed read pairs available after processing 20079270 (97.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 21 0.00% 21 8 0.00% 22 10 0.00% 23 9 0.00% 24 7 0.00% 25 10 0.00% 26 15 0.00% 27 20 0.00% 28 25 0.00% 29 19 0.00% 30 17 0.00% 31 22 0.00% 32 28 0.00% 33 23 0.00% 34 24 0.00% 35 23 0.00% 36 22 0.00% 37 15 0.00% 38 21 0.00% 39 20 0.00% 40 29 0.00% 41 20 0.00% 42 38 0.00% 43 38 0.00% 44 45 0.00% 45 34 0.00% 46 39 0.00% 47 58 0.00% 48 60 0.00% 49 80 0.00% 50 94 0.00% 51 122 0.00% 52 124 0.00% 53 115 0.00% 54 104 0.00% 55 152 0.00% 56 163 0.00% 57 186 0.00% 58 272 0.00% 59 345 0.00% 60 299 0.00% 61 335 0.00% 62 349 0.00% 63 320 0.00% 64 268 0.00% 65 288 0.00% 66 348 0.00% 67 435 0.00% 68 432 0.00% 69 497 0.00% 70 499 0.00% 71 600 0.00% 72 577 0.00% 73 609 0.00% 74 658 0.00% 75 685 0.00% 76 606 0.00% 77 691 0.00% 78 770 0.00% 79 929 0.00% 80 965 0.00% 81 1146 0.01% 82 1195 0.01% 83 1210 0.01% 84 1312 0.01% 85 1357 0.01% 86 1436 0.01% 87 1570 0.01% 88 1599 0.01% 89 1786 0.01% 90 1977 0.01% 91 1911 0.01% 92 2145 0.01% 93 2374 0.01% 94 2540 0.01% 95 2718 0.01% 96 2647 0.01% 97 2708 0.01% 98 2916 0.01% 99 2918 0.01% 100 3200 0.02% 101 3482 0.02% 102 3554 0.02% 103 3834 0.02% 104 3863 0.02% 105 3937 0.02% 106 4319 0.02% 107 4353 0.02% 108 4319 0.02% 109 4666 0.02% 110 4938 0.02% 111 5067 0.02% 112 5333 0.03% 113 5347 0.03% 114 5966 0.03% 115 5963 0.03% 116 6121 0.03% 117 6474 0.03% 118 6421 0.03% 119 6705 0.03% 120 6858 0.03% 121 7293 0.04% 122 7517 0.04% 123 7686 0.04% 124 7973 0.04% 125 8289 0.04% 126 8539 0.04% 127 8697 0.04% 128 8844 0.04% 129 9239 0.04% 130 9694 0.05% 131 9609 0.05% 132 10175 0.05% 133 10634 0.05% 134 11062 0.05% 135 11025 0.05% 136 11726 0.06% 137 12031 0.06% 138 12066 0.06% 139 12293 0.06% 140 13029 0.06% 141 13354 0.06% 142 13836 0.07% 143 14429 0.07% 144 14896 0.07% 145 15063 0.07% 146 15712 0.08% 147 16165 0.08% 148 16587 0.08% 149 17032 0.08% 150 20079270 97.62% 20569607 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=14.48 fanout-score-rank=11 prefix-density=0.19 prefix-fanout=6.9 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=325.53 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=33.3 sequence=TCATCATCAACAAT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.80 fanout-score-rank=26 prefix-density=0.12 prefix-fanout=3.4 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=300.73 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=31.6 sequence=TCATCATCAACA SRR21683877 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:34:44 Started mapping on | Feb 12 04:34:44 Finished on | Feb 12 04:39:57 Mapping speed, Million of reads per hour | 236.58 Number of input reads | 20569607 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17954561 Uniquely mapped reads % | 87.29% Average mapped length | 291.45 Number of splices: Total | 17207476 Number of splices: Annotated (sjdb) | 16708985 Number of splices: GT/AG | 16829190 Number of splices: GC/AG | 246877 Number of splices: AT/AC | 10839 Number of splices: Non-canonical | 120570 Mismatch rate per base, % | 1.95% Deletion rate per base | 0.12% Deletion average length | 3.25 Insertion rate per base | 0.08% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 999064 % of reads mapped to multiple loci | 4.86% Number of reads mapped to too many loci | 33981 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.47% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1615982 1615982 1615982 N_multimapping 999064 999064 999064 N_noFeature 502564 9053853 9171404 N_ambiguous 398695 84998 82584 UnstrandedReadsAssigned:17053302 PositiveStrandReadsAssigned:8815710 NegativeStrandReadsAssigned:8700573 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR21683877 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21683877-trimmed-pair1.fastq SRR21683877-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,569,607 reads, 16,406,215 reads pseudoaligned [quant] estimated average fragment length: 253.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR21683877.ke.tsv 34699 SRR21683877.se.tsv 87100 total ==> SRR21683877.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.25 2017.86 63.5472 Potri.005G024800.1.v4.1 1035 782.255 263 18.6905 Potri.004G059700.1.v4.1 961 708.255 0 0 Potri.007G009000.2.v4.1 1416 1163.25 0 0 Potri.003G141000.2.v4.1 2943 2690.25 116 2.39705 Potri.016G087400.1.v4.1 270 53.3504 273 284.47 Potri.015G069301.1.v4.1 564 311.402 0 0 Potri.010G195200.1.v4.1 1773 1520.25 38 1.38957 Potri.012G127500.1.v4.1 977 724.255 123 9.44118 ==> SRR21683877.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 111 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 117 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 75 SRR21683877 completed mapping pipeline successfully