Starting /dee2/code/volunteer_pipeline.sh SRR21683878 current disk space = 3049116532736 free memory = 1481349016 SRR21683878 SRAfilesize 1fb580e6e2933622ceadf8a8352227fd SRR21683878.sra SRR21683878.sra file validated SRR21683878 is paired end SRR21683878 is conventional basespace SRR21683878 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.504 37.0 37.0 37.0 37.0 37.0 2 36.517 37.0 37.0 37.0 37.0 37.0 3 36.58 37.0 37.0 37.0 37.0 37.0 4 36.632 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.5395 37.0 37.0 37.0 37.0 37.0 7 36.4705 37.0 37.0 37.0 37.0 37.0 8 36.5715 37.0 37.0 37.0 37.0 37.0 9 36.5105 37.0 37.0 37.0 37.0 37.0 10-14 36.572700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.522800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.51 37.0 37.0 37.0 37.0 37.0 25-29 36.4572 37.0 37.0 37.0 37.0 37.0 30-34 36.3952 37.0 37.0 37.0 37.0 37.0 35-39 36.404700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3878 37.0 37.0 37.0 37.0 37.0 45-49 36.3446 37.0 37.0 37.0 37.0 37.0 50-54 36.287499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.2727 37.0 37.0 37.0 37.0 37.0 60-64 36.2537 37.0 37.0 37.0 37.0 37.0 65-69 36.1486 37.0 37.0 37.0 37.0 37.0 70-74 36.199 37.0 37.0 37.0 37.0 37.0 75-79 36.183800000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.101400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1139 37.0 37.0 37.0 37.0 37.0 90-94 36.007600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.0197 37.0 37.0 37.0 37.0 37.0 100-104 35.9835 37.0 37.0 37.0 37.0 37.0 105-109 35.8885 37.0 37.0 37.0 37.0 37.0 110-114 35.8767 37.0 37.0 37.0 37.0 37.0 115-119 35.8095 37.0 37.0 37.0 37.0 37.0 120-124 35.8717 37.0 37.0 37.0 37.0 37.0 125-129 35.714600000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.6905 37.0 37.0 37.0 37.0 37.0 135-139 35.6801 37.0 37.0 37.0 37.0 37.0 140-144 35.632600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.523 37.0 37.0 37.0 37.0 37.0 150 35.4975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 1.0 22 0.0 23 3.0 24 2.0 25 3.0 26 11.0 27 14.0 28 18.0 29 20.0 30 39.0 31 45.0 32 56.0 33 85.0 34 164.0 35 337.0 36 2634.0 37 563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.876876876876878 18.21821821821822 21.846846846846844 33.05805805805806 2 21.175 27.0 36.075 15.75 3 20.525 31.45 27.800000000000004 20.225 4 22.5 36.075 20.025000000000002 21.4 5 22.900000000000002 37.4 20.5 19.2 6 17.724999999999998 37.85 22.525000000000002 21.9 7 16.925 14.774999999999999 43.075 25.224999999999998 8 18.85 21.55 29.225 30.375000000000004 9 19.325 20.875 29.549999999999997 30.25 10-14 20.48 28.79 27.595 23.135 15-19 20.89 28.185 27.87 23.055 20-24 21.55 28.71 27.825 21.915000000000003 25-29 20.575 28.67 28.494999999999997 22.259999999999998 30-34 20.87 29.24 27.625 22.264999999999997 35-39 21.23 29.599999999999998 27.33 21.84 40-44 21.445 28.494999999999997 27.55 22.509999999999998 45-49 21.19 28.185 28.549999999999997 22.075 50-54 21.295 28.765 27.750000000000004 22.189999999999998 55-59 21.16 28.53 28.035 22.275 60-64 21.415 28.775000000000002 27.800000000000004 22.009999999999998 65-69 21.060000000000002 28.694999999999997 28.12 22.125 70-74 21.845 28.32 27.58 22.255 75-79 21.935 28.09 27.985 21.990000000000002 80-84 21.64 28.605000000000004 27.37 22.384999999999998 85-89 21.685 28.225 28.310000000000002 21.78 90-94 21.705 28.12 28.21 21.965 95-99 20.94 28.794999999999998 28.04 22.225 100-104 21.695 28.499999999999996 27.339999999999996 22.465 105-109 21.625 28.28 28.115000000000002 21.98 110-114 21.61 28.694999999999997 27.525 22.17 115-119 22.015 27.395000000000003 28.205000000000002 22.384999999999998 120-124 22.075 27.825 27.950000000000003 22.15 125-129 21.63 28.315 28.305000000000003 21.75 130-134 22.165000000000003 28.37 27.625 21.84 135-139 21.72 27.565 27.85 22.865 140-144 21.915000000000003 28.78 27.529999999999998 21.775 145-149 22.03 28.63 27.565 21.775 150 22.025 27.474999999999998 28.349999999999998 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 4.5 23 4.0 24 2.0 25 4.5 26 8.0 27 11.5 28 11.0 29 12.5 30 23.0 31 36.0 32 42.5 33 47.0 34 56.0 35 74.0 36 97.0 37 109.5 38 137.5 39 169.5 40 187.5 41 230.0 42 265.5 43 263.5 44 282.5 45 276.5 46 256.5 47 229.5 48 193.5 49 183.5 50 164.5 51 140.0 52 113.5 53 87.5 54 66.5 55 54.5 56 37.5 57 28.0 58 23.0 59 13.0 60 9.0 61 8.5 62 8.0 63 5.0 64 2.5 65 5.5 66 3.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.9 #Duplication Level Percentage of deduplicated Percentage of total 1 88.83577052868391 78.975 2 9.955005624296962 17.7 3 1.0967379077615298 2.9250000000000003 4 0.11248593925759282 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.025 0.0 128-129 0.425 0.0 0.0 0.025 0.0 130-131 0.425 0.0 0.0 0.025 0.0 132-133 0.4375 0.0 0.0 0.025 0.0 134-135 0.5625 0.0 0.0 0.025 0.0 136-137 0.5874999999999999 0.0 0.0 0.025 0.0 138 0.6 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTTTT 10 0.006973645 144.0 2 >>END_MODULE SRR21683878 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683878_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.447 37.0 37.0 37.0 37.0 37.0 2 36.347 37.0 37.0 37.0 37.0 37.0 3 36.4915 37.0 37.0 37.0 37.0 37.0 4 36.3705 37.0 37.0 37.0 37.0 37.0 5 36.448 37.0 37.0 37.0 37.0 37.0 6 36.3895 37.0 37.0 37.0 37.0 37.0 7 36.399 37.0 37.0 37.0 37.0 37.0 8 36.477 37.0 37.0 37.0 37.0 37.0 9 36.471 37.0 37.0 37.0 37.0 37.0 10-14 36.47840000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.471799999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.448 37.0 37.0 37.0 37.0 37.0 25-29 36.3852 37.0 37.0 37.0 37.0 37.0 30-34 36.3543 37.0 37.0 37.0 37.0 37.0 35-39 36.331 37.0 37.0 37.0 37.0 37.0 40-44 36.3164 37.0 37.0 37.0 37.0 37.0 45-49 36.293099999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2804 37.0 37.0 37.0 37.0 37.0 55-59 36.17809999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1674 37.0 37.0 37.0 37.0 37.0 65-69 36.1752 37.0 37.0 37.0 37.0 37.0 70-74 36.126400000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.1001 37.0 37.0 37.0 37.0 37.0 80-84 36.0982 37.0 37.0 37.0 37.0 37.0 85-89 35.9987 37.0 37.0 37.0 37.0 37.0 90-94 35.9891 37.0 37.0 37.0 37.0 37.0 95-99 35.97859999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9269 37.0 37.0 37.0 37.0 37.0 105-109 35.8992 37.0 37.0 37.0 37.0 37.0 110-114 35.8429 37.0 37.0 37.0 37.0 37.0 115-119 35.74530000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7613 37.0 37.0 37.0 37.0 37.0 125-129 35.72109999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.6028 37.0 37.0 37.0 37.0 37.0 135-139 35.5624 37.0 37.0 37.0 37.0 37.0 140-144 35.5507 37.0 37.0 37.0 37.0 37.0 145-149 35.54100000000001 37.0 37.0 37.0 37.0 37.0 150 35.3325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.0 24 5.0 25 7.0 26 10.0 27 13.0 28 14.0 29 19.0 30 31.0 31 38.0 32 64.0 33 91.0 34 163.0 35 372.0 36 2822.0 37 343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.075 17.9 22.175 32.85 2 21.575 26.25 35.725 16.45 3 21.7 32.25 26.075 19.975 4 23.925 35.5 21.3 19.275000000000002 5 23.3 37.4 20.674999999999997 18.625 6 17.224999999999998 36.775000000000006 24.55 21.45 7 16.075 16.475 42.199999999999996 25.25 8 18.475 21.275 28.325 31.924999999999997 9 20.05 20.525 29.275000000000002 30.15 10-14 21.815 27.985 27.32 22.88 15-19 21.57 28.185 27.57 22.675 20-24 21.15 28.044999999999998 28.485 22.32 25-29 21.38 28.349999999999998 28.76 21.51 30-34 21.69 28.544999999999998 27.744999999999997 22.02 35-39 21.43 29.345 26.875 22.35 40-44 21.83 28.694999999999997 27.384999999999998 22.09 45-49 22.285 28.810000000000002 27.169999999999998 21.735 50-54 21.51 28.360000000000003 27.37 22.759999999999998 55-59 21.59 28.64 27.589999999999996 22.18 60-64 21.735 28.355000000000004 27.950000000000003 21.959999999999997 65-69 22.264999999999997 28.349999999999998 27.025 22.36 70-74 21.82 28.08 27.97 22.13 75-79 22.02 28.610000000000003 27.72 21.65 80-84 22.295 27.994999999999997 28.475 21.235 85-89 22.085 27.634999999999998 27.534999999999997 22.745 90-94 21.895 27.98 27.93 22.195 95-99 22.605 27.860000000000003 27.279999999999998 22.255 100-104 21.64 28.315 27.775 22.27 105-109 21.995 28.735 28.205000000000002 21.065 110-114 22.09 28.044999999999998 28.07 21.795 115-119 22.355 28.065 28.360000000000003 21.22 120-124 22.7 27.92 27.944999999999997 21.435000000000002 125-129 22.39 27.994999999999997 27.875 21.740000000000002 130-134 22.505 27.834999999999997 27.87 21.790000000000003 135-139 22.185 28.144999999999996 27.74 21.93 140-144 22.64 27.665 28.67 21.025 145-149 22.405 28.13 27.894999999999996 21.57 150 23.75 28.225 27.775 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 0.5 23 2.0 24 4.5 25 5.0 26 7.0 27 8.0 28 7.5 29 12.5 30 19.5 31 29.0 32 36.5 33 44.0 34 59.0 35 80.0 36 85.5 37 106.0 38 150.5 39 167.5 40 178.0 41 219.0 42 240.5 43 249.0 44 268.0 45 273.0 46 257.5 47 230.5 48 215.5 49 195.0 50 159.5 51 138.5 52 125.0 53 97.5 54 78.0 55 62.5 56 47.0 57 33.5 58 27.5 59 25.5 60 15.5 61 9.5 62 9.0 63 5.5 64 3.0 65 2.0 66 1.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.075 #Duplication Level Percentage of deduplicated Percentage of total 1 88.94190289082235 79.225 2 9.963513892786978 17.75 3 0.9823182711198428 2.625 4 0.11226494527083919 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0125 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.037500000000000006 0.0 0.0 0.025 0.0 88-89 0.075 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.15 0.0 0.0 0.025 0.0 94-95 0.15 0.0 0.0 0.025 0.0 96-97 0.15 0.0 0.0 0.025 0.0 98-99 0.175 0.0 0.0 0.025 0.0 100-101 0.2 0.0 0.0 0.025 0.0 102-103 0.2 0.0 0.0 0.025 0.0 104-105 0.2375 0.0 0.0 0.025 0.0 106-107 0.25 0.0 0.0 0.025 0.0 108-109 0.275 0.0 0.0 0.025 0.0 110-111 0.275 0.0 0.0 0.025 0.0 112-113 0.3 0.0 0.0 0.025 0.0 114-115 0.3 0.0 0.0 0.025 0.0 116-117 0.325 0.0 0.0 0.025 0.0 118-119 0.35 0.0 0.0 0.025 0.0 120-121 0.35 0.0 0.0 0.025 0.0 122-123 0.4 0.0 0.0 0.025 0.0 124-125 0.42500000000000004 0.0 0.0 0.025 0.0 126-127 0.4625 0.0 0.0 0.025 0.0 128-129 0.475 0.0 0.0 0.025 0.0 130-131 0.475 0.0 0.0 0.025 0.0 132-133 0.4875 0.0 0.0 0.025 0.0 134-135 0.6125 0.0 0.0 0.025 0.0 136-137 0.6375 0.0 0.0 0.025 0.0 138 0.65 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTAA 10 0.006973645 144.0 5 AAAAAAA 30 0.0015031899 23.999998 15-19 >>END_MODULE Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra Read 823114 spots for SRR21683878.sra Written 823114 spots for SRR21683878.sra SRR ids: ['SRR21683878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fatn6it9 SRR21683878.sra spots: 16462280 blocks: [[1, 823114], [823115, 1646228], [1646229, 2469342], [2469343, 3292456], [3292457, 4115570], [4115571, 4938684], [4938685, 5761798], [5761799, 6584912], [6584913, 7408026], [7408027, 8231140], [8231141, 9054254], [9054255, 9877368], [9877369, 10700482], [10700483, 11523596], [11523597, 12346710], [12346711, 13169824], [13169825, 13992938], [13992939, 14816052], [14816053, 15639166], [15639167, 16462280]] SRR21683878 file size 5540749 SRR21683878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21683878 SRR21683878_1.fastq SRR21683878_2.fastq Input file: SRR21683878_1.fastq Paired file: SRR21683878_2.fastq trimmed: SRR21683878-trimmed-pair1.fastq, SRR21683878-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:08:15 2025 >> started Wed Feb 12 04:08:33 2025 >> done (18.227s) 16462280 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 110 ( 0.00%) empty read pairs filtered out after trimming by size control 16462093 (100.00%) read pairs available; of these: 179113 ( 1.09%) trimmed read pairs available after processing 16282980 (98.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 17 0.00% 23 5 0.00% 24 6 0.00% 25 7 0.00% 26 18 0.00% 27 12 0.00% 28 12 0.00% 29 5 0.00% 30 7 0.00% 31 10 0.00% 32 11 0.00% 33 11 0.00% 34 18 0.00% 35 11 0.00% 36 11 0.00% 37 19 0.00% 38 17 0.00% 39 10 0.00% 40 11 0.00% 41 18 0.00% 42 24 0.00% 43 21 0.00% 44 17 0.00% 45 19 0.00% 46 17 0.00% 47 24 0.00% 48 26 0.00% 49 35 0.00% 50 46 0.00% 51 42 0.00% 52 51 0.00% 53 40 0.00% 54 51 0.00% 55 42 0.00% 56 59 0.00% 57 62 0.00% 58 77 0.00% 59 122 0.00% 60 104 0.00% 61 126 0.00% 62 120 0.00% 63 82 0.00% 64 102 0.00% 65 95 0.00% 66 126 0.00% 67 133 0.00% 68 124 0.00% 69 173 0.00% 70 158 0.00% 71 181 0.00% 72 185 0.00% 73 199 0.00% 74 183 0.00% 75 193 0.00% 76 200 0.00% 77 208 0.00% 78 262 0.00% 79 252 0.00% 80 261 0.00% 81 376 0.00% 82 377 0.00% 83 324 0.00% 84 375 0.00% 85 406 0.00% 86 439 0.00% 87 404 0.00% 88 454 0.00% 89 475 0.00% 90 565 0.00% 91 570 0.00% 92 672 0.00% 93 689 0.00% 94 680 0.00% 95 749 0.00% 96 772 0.00% 97 768 0.00% 98 836 0.01% 99 913 0.01% 100 901 0.01% 101 974 0.01% 102 1049 0.01% 103 1133 0.01% 104 1178 0.01% 105 1240 0.01% 106 1205 0.01% 107 1275 0.01% 108 1353 0.01% 109 1411 0.01% 110 1420 0.01% 111 1547 0.01% 112 1606 0.01% 113 1751 0.01% 114 1837 0.01% 115 1857 0.01% 116 1941 0.01% 117 1930 0.01% 118 2033 0.01% 119 2172 0.01% 120 2231 0.01% 121 2380 0.01% 122 2492 0.02% 123 2611 0.02% 124 2656 0.02% 125 2896 0.02% 126 2916 0.02% 127 3022 0.02% 128 3267 0.02% 129 3308 0.02% 130 3391 0.02% 131 3591 0.02% 132 3753 0.02% 133 3933 0.02% 134 3999 0.02% 135 4396 0.03% 136 4614 0.03% 137 4676 0.03% 138 4885 0.03% 139 4948 0.03% 140 5284 0.03% 141 5494 0.03% 142 5837 0.04% 143 5970 0.04% 144 6156 0.04% 145 6485 0.04% 146 6662 0.04% 147 6932 0.04% 148 7460 0.05% 149 7714 0.05% 150 16282980 98.91% 16462093 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.78 fanout-score-rank=17 prefix-density=0.14 prefix-fanout=3.9 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=189.67 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=21.2 sequence=GCAGCAGCAACA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=25 prefix-density=0.11 prefix-fanout=3.5 sequence=CCAGACCAGCAGAGGTTGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=20 fanout-score=303.33 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=29.2 sequence=AAGAAGAAGAAA SRR21683878 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:09:26 Started mapping on | Feb 12 04:09:27 Finished on | Feb 12 04:13:55 Mapping speed, Million of reads per hour | 221.13 Number of input reads | 16462093 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14203105 Uniquely mapped reads % | 86.28% Average mapped length | 291.89 Number of splices: Total | 13511727 Number of splices: Annotated (sjdb) | 13103512 Number of splices: GT/AG | 13208603 Number of splices: GC/AG | 194795 Number of splices: AT/AC | 9130 Number of splices: Non-canonical | 99199 Mismatch rate per base, % | 1.96% Deletion rate per base | 0.12% Deletion average length | 3.24 Insertion rate per base | 0.08% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 829326 % of reads mapped to multiple loci | 5.04% Number of reads mapped to too many loci | 38574 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.18% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1429662 1429662 1429662 N_multimapping 829326 829326 829326 N_noFeature 418125 7173963 7268392 N_ambiguous 328237 75140 74865 UnstrandedReadsAssigned:13456743 PositiveStrandReadsAssigned:6954002 NegativeStrandReadsAssigned:6859848 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR21683878 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21683878-trimmed-pair1.fastq SRR21683878-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,462,093 reads, 13,012,427 reads pseudoaligned [quant] estimated average fragment length: 258.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR21683878.ke.tsv 34699 SRR21683878.se.tsv 87100 total ==> SRR21683878.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.02 1658 62.989 Potri.005G024800.1.v4.1 1035 777.017 288 24.7833 Potri.004G059700.1.v4.1 961 703.022 10 0.951104 Potri.007G009000.2.v4.1 1416 1158.02 0 0 Potri.003G141000.2.v4.1 2943 2685.02 110.229 2.74503 Potri.016G087400.1.v4.1 270 47.4951 211 297.051 Potri.015G069301.1.v4.1 564 306.226 0 0 Potri.010G195200.1.v4.1 1773 1515.02 35 1.54471 Potri.012G127500.1.v4.1 977 719.017 155 14.4142 ==> SRR21683878.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 101 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR21683878 completed mapping pipeline successfully