Starting /dee2/code/volunteer_pipeline.sh SRR21683879 current disk space = 3049189289984 free memory = 1301738828 SRR21683879 SRAfilesize b65766e1aefeefcaffd6f45768b3b63f SRR21683879.sra SRR21683879.sra file validated SRR21683879 is paired end SRR21683879 is conventional basespace SRR21683879 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42875 37.0 37.0 37.0 37.0 37.0 2 36.4955 37.0 37.0 37.0 37.0 37.0 3 36.5395 37.0 37.0 37.0 37.0 37.0 4 36.55 37.0 37.0 37.0 37.0 37.0 5 36.5745 37.0 37.0 37.0 37.0 37.0 6 36.5115 37.0 37.0 37.0 37.0 37.0 7 36.462 37.0 37.0 37.0 37.0 37.0 8 36.4615 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-14 36.5197 37.0 37.0 37.0 37.0 37.0 15-19 36.4595 37.0 37.0 37.0 37.0 37.0 20-24 36.4074 37.0 37.0 37.0 37.0 37.0 25-29 36.3156 37.0 37.0 37.0 37.0 37.0 30-34 36.322 37.0 37.0 37.0 37.0 37.0 35-39 36.2545 37.0 37.0 37.0 37.0 37.0 40-44 36.2967 37.0 37.0 37.0 37.0 37.0 45-49 36.2604 37.0 37.0 37.0 37.0 37.0 50-54 36.230199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.171699999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.1414 37.0 37.0 37.0 37.0 37.0 65-69 36.0665 37.0 37.0 37.0 37.0 37.0 70-74 36.1438 37.0 37.0 37.0 37.0 37.0 75-79 36.0369 37.0 37.0 37.0 37.0 37.0 80-84 36.0447 37.0 37.0 37.0 37.0 37.0 85-89 35.999399999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.9111 37.0 37.0 37.0 37.0 37.0 95-99 35.966100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8059 37.0 37.0 37.0 37.0 37.0 105-109 35.868 37.0 37.0 37.0 37.0 37.0 110-114 35.7223 37.0 37.0 37.0 37.0 37.0 115-119 35.7059 37.0 37.0 37.0 37.0 37.0 120-124 35.714 37.0 37.0 37.0 37.0 37.0 125-129 35.6391 37.0 37.0 37.0 37.0 37.0 130-134 35.5825 37.0 37.0 37.0 37.0 37.0 135-139 35.4987 37.0 37.0 37.0 37.0 37.0 140-144 35.5458 37.0 37.0 37.0 37.0 37.0 145-149 35.413 37.0 37.0 37.0 37.0 37.0 150 35.401 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 1.0 23 1.0 24 6.0 25 5.0 26 7.0 27 17.0 28 17.0 29 29.0 30 50.0 31 58.0 32 82.0 33 114.0 34 158.0 35 300.0 36 2652.0 37 499.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.193895421566175 18.01351013259945 21.391043282461847 35.40155116337253 2 20.375 28.000000000000004 35.199999999999996 16.425 3 21.375 32.15 25.474999999999998 21.0 4 23.400000000000002 36.449999999999996 19.775000000000002 20.375 5 21.75 36.9 21.075 20.275000000000002 6 17.05 36.875 23.849999999999998 22.225 7 15.35 16.725 44.0 23.925 8 19.45 21.85 28.575 30.125 9 20.474999999999998 21.975 28.725 28.825 10-14 21.175 29.15 26.63 23.044999999999998 15-19 21.695 27.97 28.42 21.915000000000003 20-24 22.045 29.015 28.110000000000003 20.830000000000002 25-29 21.425 28.895 28.17 21.51 30-34 20.575 28.985 28.395 22.045 35-39 21.44 28.825 27.87 21.865000000000002 40-44 22.03 28.575 27.755000000000003 21.64 45-49 21.42 28.79 27.905 21.884999999999998 50-54 21.64 29.354999999999997 27.435 21.57 55-59 21.935 27.97 28.305000000000003 21.790000000000003 60-64 21.58 28.715000000000003 27.74 21.965 65-69 21.955 28.43 27.450000000000003 22.165000000000003 70-74 22.06 28.515 27.894999999999996 21.529999999999998 75-79 21.475 28.465 28.27 21.790000000000003 80-84 21.81 29.255 26.985 21.95 85-89 21.740000000000002 28.694999999999997 27.584999999999997 21.98 90-94 22.045 27.965 27.985 22.005 95-99 21.615000000000002 28.749999999999996 27.034999999999997 22.6 100-104 22.02 28.345 27.735 21.9 105-109 21.94 28.044999999999998 27.845 22.17 110-114 21.745 27.725 28.105000000000004 22.425 115-119 21.845 27.950000000000003 28.005000000000003 22.2 120-124 21.735 28.605000000000004 27.52 22.14 125-129 21.515 28.485 28.035 21.965 130-134 21.335 28.310000000000002 28.02 22.335 135-139 21.93 27.98 27.915 22.175 140-144 22.045 28.555000000000003 28.095 21.305 145-149 22.34 27.975 28.08 21.605 150 22.525000000000002 28.449999999999996 27.224999999999998 21.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 3.0 25 5.5 26 8.5 27 12.0 28 11.5 29 13.0 30 22.0 31 30.0 32 37.0 33 52.5 34 74.0 35 89.5 36 98.5 37 104.0 38 138.0 39 174.0 40 197.0 41 230.0 42 257.5 43 274.0 44 262.5 45 241.0 46 255.0 47 247.0 48 198.5 49 183.5 50 163.5 51 130.0 52 111.5 53 90.0 54 69.5 55 49.0 56 34.0 57 30.0 58 23.0 59 15.5 60 16.0 61 14.5 62 7.0 63 4.0 64 6.0 65 5.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.925 #Duplication Level Percentage of deduplicated Percentage of total 1 88.78268203542311 78.95 2 10.120888389091931 18.0 3 0.9558616811920156 2.55 4 0.1405678942929435 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.2374999999999998 0.0 0.0 0.0 0.0 132-133 1.375 0.0 0.0 0.0 0.0 134-135 1.4875 0.0 0.0 0.0 0.0 136-137 1.7625000000000002 0.0 0.0 0.0 0.0 138 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAAG 10 0.006973645 144.0 5 >>END_MODULE SRR21683879 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683879_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2785 37.0 37.0 37.0 37.0 37.0 2 36.2985 37.0 37.0 37.0 37.0 37.0 3 36.472 37.0 37.0 37.0 37.0 37.0 4 36.3855 37.0 37.0 37.0 37.0 37.0 5 36.459 37.0 37.0 37.0 37.0 37.0 6 36.3675 37.0 37.0 37.0 37.0 37.0 7 36.439 37.0 37.0 37.0 37.0 37.0 8 36.464 37.0 37.0 37.0 37.0 37.0 9 36.4575 37.0 37.0 37.0 37.0 37.0 10-14 36.4397 37.0 37.0 37.0 37.0 37.0 15-19 36.38719999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4317 37.0 37.0 37.0 37.0 37.0 25-29 36.3745 37.0 37.0 37.0 37.0 37.0 30-34 36.3654 37.0 37.0 37.0 37.0 37.0 35-39 36.3112 37.0 37.0 37.0 37.0 37.0 40-44 36.3284 37.0 37.0 37.0 37.0 37.0 45-49 36.2778 37.0 37.0 37.0 37.0 37.0 50-54 36.2438 37.0 37.0 37.0 37.0 37.0 55-59 36.2051 37.0 37.0 37.0 37.0 37.0 60-64 36.2309 37.0 37.0 37.0 37.0 37.0 65-69 36.16850000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.135400000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.106199999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.096199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0351 37.0 37.0 37.0 37.0 37.0 90-94 35.9439 37.0 37.0 37.0 37.0 37.0 95-99 35.919399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9347 37.0 37.0 37.0 37.0 37.0 105-109 35.9105 37.0 37.0 37.0 37.0 37.0 110-114 35.881 37.0 37.0 37.0 37.0 37.0 115-119 35.7875 37.0 37.0 37.0 37.0 37.0 120-124 35.7266 37.0 37.0 37.0 37.0 37.0 125-129 35.7247 37.0 37.0 37.0 37.0 37.0 130-134 35.6238 37.0 37.0 37.0 37.0 37.0 135-139 35.601099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5313 37.0 37.0 37.0 37.0 37.0 145-149 35.5219 37.0 37.0 37.0 37.0 37.0 150 35.448 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 0.0 19 0.0 20 4.0 21 1.0 22 2.0 23 1.0 24 1.0 25 8.0 26 5.0 27 13.0 28 16.0 29 25.0 30 32.0 31 44.0 32 66.0 33 98.0 34 148.0 35 365.0 36 2764.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.95 17.125 22.05 34.875 2 21.175 28.299999999999997 33.7 16.825000000000003 3 22.05 33.7 24.099999999999998 20.150000000000002 4 23.200000000000003 36.925000000000004 19.25 20.625 5 21.4 37.824999999999996 21.2 19.575 6 17.299999999999997 37.225 22.2 23.275000000000002 7 15.225 15.625 43.425000000000004 25.724999999999998 8 20.849999999999998 20.724999999999998 29.25 29.175 9 20.225 23.075000000000003 27.800000000000004 28.9 10-14 21.095 29.125 26.365 23.415 15-19 21.13 28.025 28.305000000000003 22.54 20-24 20.885 29.255 27.43 22.43 25-29 21.025 28.87 27.66 22.445 30-34 20.630000000000003 29.37 27.875 22.125 35-39 21.815 28.1 27.76 22.325 40-44 21.72 29.29 27.639999999999997 21.349999999999998 45-49 21.175 28.985 27.650000000000002 22.189999999999998 50-54 21.39 28.59 27.43 22.59 55-59 21.8 27.810000000000002 28.055000000000003 22.335 60-64 21.495 29.59 26.56 22.355 65-69 21.89 28.395 28.07 21.645 70-74 21.345 27.67 28.110000000000003 22.875 75-79 21.6 28.355000000000004 27.955000000000002 22.09 80-84 21.41 28.525 27.634999999999998 22.43 85-89 21.355 28.660000000000004 27.67 22.314999999999998 90-94 21.965 28.139999999999997 27.855 22.040000000000003 95-99 21.34 28.744999999999997 28.134999999999998 21.78 100-104 21.54 28.485 27.92 22.055 105-109 21.66 27.245 28.685 22.41 110-114 22.295 27.99 27.779999999999998 21.935 115-119 21.465 28.749999999999996 28.02 21.765 120-124 22.215 28.43 27.965 21.39 125-129 22.3 28.549999999999997 27.245 21.905 130-134 22.8 28.51 27.62 21.07 135-139 22.264999999999997 28.28 28.375 21.08 140-144 22.759999999999998 28.76 27.310000000000002 21.17 145-149 23.085 27.544999999999998 27.755000000000003 21.615000000000002 150 22.425 28.199999999999996 27.05 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 1.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 1.0 25 4.0 26 7.5 27 9.0 28 12.0 29 14.5 30 25.0 31 32.5 32 34.0 33 42.5 34 57.0 35 70.5 36 88.0 37 128.0 38 155.0 39 162.5 40 195.0 41 237.0 42 255.0 43 251.5 44 252.0 45 252.0 46 244.0 47 237.5 48 225.5 49 199.5 50 170.0 51 134.5 52 108.5 53 98.5 54 74.5 55 54.0 56 38.0 57 27.0 58 28.5 59 21.0 60 15.0 61 9.0 62 3.0 63 3.5 64 3.5 65 3.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 88.78898567013206 79.0 2 10.227592020230402 18.2 3 0.7867378477100309 2.1 4 0.19668446192750771 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.6499999999999999 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.5625 0.0 0.0 0.0 0.0 136-137 1.8125 0.0 0.0 0.0 0.0 138 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAAAAT 10 0.006973645 144.0 8 >>END_MODULE Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899385 spots for SRR21683879.sra Written 899385 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra Read 899366 spots for SRR21683879.sra Written 899366 spots for SRR21683879.sra SRR ids: ['SRR21683879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_il6i69er SRR21683879.sra spots: 17987339 blocks: [[1, 899366], [899367, 1798732], [1798733, 2698098], [2698099, 3597464], [3597465, 4496830], [4496831, 5396196], [5396197, 6295562], [6295563, 7194928], [7194929, 8094294], [8094295, 8993660], [8993661, 9893026], [9893027, 10792392], [10792393, 11691758], [11691759, 12591124], [12591125, 13490490], [13490491, 14389856], [14389857, 15289222], [15289223, 16188588], [16188589, 17087954], [17087955, 17987339]] SRR21683879 file size 6056052 SRR21683879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21683879 SRR21683879_1.fastq SRR21683879_2.fastq Input file: SRR21683879_1.fastq Paired file: SRR21683879_2.fastq trimmed: SRR21683879-trimmed-pair1.fastq, SRR21683879-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:21:48 2025 >> started Wed Feb 12 04:22:09 2025 >> done (20.522s) 17987339 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 100 ( 0.00%) empty read pairs filtered out after trimming by size control 17987134 (100.00%) read pairs available; of these: 462485 ( 2.57%) trimmed read pairs available after processing 17524649 (97.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 6 0.00% 21 6 0.00% 22 12 0.00% 23 8 0.00% 24 11 0.00% 25 12 0.00% 26 8 0.00% 27 8 0.00% 28 19 0.00% 29 10 0.00% 30 6 0.00% 31 13 0.00% 32 20 0.00% 33 14 0.00% 34 14 0.00% 35 12 0.00% 36 10 0.00% 37 24 0.00% 38 16 0.00% 39 14 0.00% 40 16 0.00% 41 23 0.00% 42 36 0.00% 43 33 0.00% 44 28 0.00% 45 35 0.00% 46 43 0.00% 47 51 0.00% 48 62 0.00% 49 58 0.00% 50 97 0.00% 51 117 0.00% 52 117 0.00% 53 119 0.00% 54 99 0.00% 55 104 0.00% 56 160 0.00% 57 191 0.00% 58 270 0.00% 59 325 0.00% 60 352 0.00% 61 331 0.00% 62 343 0.00% 63 327 0.00% 64 279 0.00% 65 299 0.00% 66 279 0.00% 67 363 0.00% 68 454 0.00% 69 487 0.00% 70 569 0.00% 71 503 0.00% 72 564 0.00% 73 591 0.00% 74 595 0.00% 75 551 0.00% 76 631 0.00% 77 731 0.00% 78 777 0.00% 79 856 0.00% 80 900 0.01% 81 980 0.01% 82 1114 0.01% 83 1155 0.01% 84 1243 0.01% 85 1231 0.01% 86 1463 0.01% 87 1419 0.01% 88 1482 0.01% 89 1593 0.01% 90 1717 0.01% 91 1811 0.01% 92 2071 0.01% 93 2141 0.01% 94 2206 0.01% 95 2417 0.01% 96 2500 0.01% 97 2718 0.02% 98 2786 0.02% 99 2885 0.02% 100 2868 0.02% 101 3282 0.02% 102 3298 0.02% 103 3523 0.02% 104 3737 0.02% 105 3937 0.02% 106 3913 0.02% 107 4125 0.02% 108 4160 0.02% 109 4412 0.02% 110 4518 0.03% 111 4815 0.03% 112 4932 0.03% 113 5248 0.03% 114 5420 0.03% 115 5452 0.03% 116 5725 0.03% 117 5961 0.03% 118 6067 0.03% 119 6243 0.03% 120 6630 0.04% 121 6620 0.04% 122 7043 0.04% 123 7313 0.04% 124 7186 0.04% 125 7685 0.04% 126 7872 0.04% 127 8279 0.05% 128 8255 0.05% 129 8758 0.05% 130 9120 0.05% 131 9422 0.05% 132 9475 0.05% 133 9909 0.06% 134 10214 0.06% 135 10834 0.06% 136 10825 0.06% 137 11247 0.06% 138 11290 0.06% 139 12139 0.07% 140 12360 0.07% 141 12655 0.07% 142 13057 0.07% 143 13708 0.08% 144 13769 0.08% 145 14716 0.08% 146 14877 0.08% 147 15304 0.09% 148 15779 0.09% 149 16556 0.09% 150 17524649 97.43% 17987134 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=20 prefix-density=0.13 prefix-fanout=3.4 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=298.43 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=28.8 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=4.40 fanout-score-rank=24 prefix-density=0.13 prefix-fanout=3.3 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=297.52 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=29.1 sequence=AAGAAGAAGAAA SRR21683879 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:23:03 Started mapping on | Feb 12 04:23:03 Finished on | Feb 12 04:27:33 Mapping speed, Million of reads per hour | 239.83 Number of input reads | 17987134 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15535344 Uniquely mapped reads % | 86.37% Average mapped length | 291.15 Number of splices: Total | 14662563 Number of splices: Annotated (sjdb) | 14215021 Number of splices: GT/AG | 14332991 Number of splices: GC/AG | 210117 Number of splices: AT/AC | 9728 Number of splices: Non-canonical | 109727 Mismatch rate per base, % | 1.96% Deletion rate per base | 0.12% Deletion average length | 3.24 Insertion rate per base | 0.08% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 906164 % of reads mapped to multiple loci | 5.04% Number of reads mapped to too many loci | 42004 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.10% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1545626 1545626 1545626 N_multimapping 906164 906164 906164 N_noFeature 460939 7840837 7963689 N_ambiguous 353364 81763 80506 UnstrandedReadsAssigned:14721041 PositiveStrandReadsAssigned:7612744 NegativeStrandReadsAssigned:7491149 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR21683879 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21683879-trimmed-pair1.fastq SRR21683879-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,987,134 reads, 14,283,019 reads pseudoaligned [quant] estimated average fragment length: 250.166 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR21683879.ke.tsv 34699 SRR21683879.se.tsv 87100 total ==> SRR21683879.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.83 1840 64.9715 Potri.005G024800.1.v4.1 1035 785.834 302 24.0032 Potri.004G059700.1.v4.1 961 711.834 5 0.438716 Potri.007G009000.2.v4.1 1416 1166.83 0 0 Potri.003G141000.2.v4.1 2943 2693.83 101.068 2.34334 Potri.016G087400.1.v4.1 270 54.6547 255.347 291.807 Potri.015G069301.1.v4.1 564 314.984 0 0 Potri.010G195200.1.v4.1 1773 1523.83 35 1.43457 Potri.012G127500.1.v4.1 977 727.834 166 14.2452 ==> SRR21683879.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 77 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR21683879 completed mapping pipeline successfully