Starting /dee2/code/volunteer_pipeline.sh SRR21683880 current disk space = 3049169268736 free memory = 1320266680 SRR21683880 SRAfilesize 351d9c177b9abb687b1ca1c28f2748df SRR21683880.sra SRR21683880.sra file validated SRR21683880 is paired end SRR21683880 is conventional basespace SRR21683880 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.51775 37.0 37.0 37.0 37.0 37.0 2 36.54 37.0 37.0 37.0 37.0 37.0 3 36.6435 37.0 37.0 37.0 37.0 37.0 4 36.6245 37.0 37.0 37.0 37.0 37.0 5 36.6315 37.0 37.0 37.0 37.0 37.0 6 36.623 37.0 37.0 37.0 37.0 37.0 7 36.503 37.0 37.0 37.0 37.0 37.0 8 36.6225 37.0 37.0 37.0 37.0 37.0 9 36.617 37.0 37.0 37.0 37.0 37.0 10-14 36.6055 37.0 37.0 37.0 37.0 37.0 15-19 36.58 37.0 37.0 37.0 37.0 37.0 20-24 36.5938 37.0 37.0 37.0 37.0 37.0 25-29 36.5079 37.0 37.0 37.0 37.0 37.0 30-34 36.4919 37.0 37.0 37.0 37.0 37.0 35-39 36.5115 37.0 37.0 37.0 37.0 37.0 40-44 36.4159 37.0 37.0 37.0 37.0 37.0 45-49 36.399 37.0 37.0 37.0 37.0 37.0 50-54 36.418899999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.348 37.0 37.0 37.0 37.0 37.0 60-64 36.3334 37.0 37.0 37.0 37.0 37.0 65-69 36.3206 37.0 37.0 37.0 37.0 37.0 70-74 36.2915 37.0 37.0 37.0 37.0 37.0 75-79 36.258500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2729 37.0 37.0 37.0 37.0 37.0 85-89 36.2554 37.0 37.0 37.0 37.0 37.0 90-94 36.1616 37.0 37.0 37.0 37.0 37.0 95-99 36.175200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1629 37.0 37.0 37.0 37.0 37.0 105-109 36.039300000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9919 37.0 37.0 37.0 37.0 37.0 115-119 35.9113 37.0 37.0 37.0 37.0 37.0 120-124 35.950300000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.9271 37.0 37.0 37.0 37.0 37.0 130-134 35.8 37.0 37.0 37.0 37.0 37.0 135-139 35.8032 37.0 37.0 37.0 37.0 37.0 140-144 35.7713 37.0 37.0 37.0 37.0 37.0 145-149 35.6123 37.0 37.0 37.0 37.0 37.0 150 35.6095 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 4.0 24 0.0 25 1.0 26 3.0 27 9.0 28 15.0 29 28.0 30 30.0 31 45.0 32 59.0 33 78.0 34 122.0 35 288.0 36 2730.0 37 584.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.00700175043761 19.30482620655164 21.955488872218055 30.732683170792697 2 22.225 25.474999999999998 36.325 15.975 3 21.9 30.45 27.6 20.05 4 22.475 36.225 20.9 20.4 5 22.975 38.224999999999994 21.625 17.175 6 17.05 37.2 25.05 20.7 7 16.775000000000002 14.649999999999999 45.7 22.875 8 20.5 20.325 27.3 31.874999999999996 9 19.225 22.35 29.775000000000002 28.65 10-14 21.04 28.67 27.700000000000003 22.59 15-19 21.52 27.950000000000003 28.46 22.07 20-24 21.51 28.744999999999997 27.71 22.035 25-29 21.52 28.925 27.74 21.815 30-34 21.075 28.575 28.549999999999997 21.8 35-39 21.21 29.575000000000003 27.375 21.84 40-44 21.48 29.465000000000003 27.450000000000003 21.605 45-49 21.78 28.665000000000003 27.485 22.07 50-54 21.485000000000003 28.435 28.065 22.015 55-59 22.66 28.42 27.339999999999996 21.58 60-64 22.115000000000002 29.085 27.16 21.64 65-69 21.995 28.435 27.334999999999997 22.235 70-74 21.685 28.439999999999998 27.744999999999997 22.13 75-79 21.935 28.76 26.985 22.32 80-84 21.51 28.189999999999998 28.03 22.27 85-89 21.42 27.944999999999997 28.384999999999998 22.25 90-94 21.295 27.91 28.525 22.27 95-99 21.535 28.09 27.83 22.545 100-104 22.395 28.575 27.150000000000002 21.88 105-109 21.8 28.285 27.700000000000003 22.215 110-114 21.865000000000002 28.615000000000002 27.725 21.795 115-119 22.225 27.99 28.055000000000003 21.73 120-124 21.805 28.035 28.02 22.14 125-129 21.42 28.360000000000003 27.785 22.435 130-134 21.765 28.675 27.18 22.38 135-139 22.11 28.365000000000002 27.650000000000002 21.875 140-144 22.42 27.875 27.794999999999998 21.91 145-149 21.97 28.18 27.505000000000003 22.345000000000002 150 21.75 28.199999999999996 27.775 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 2.0 25 5.5 26 8.0 27 7.5 28 12.0 29 15.0 30 19.5 31 31.0 32 42.0 33 52.5 34 67.0 35 77.5 36 94.5 37 114.0 38 149.0 39 176.5 40 184.5 41 217.5 42 249.5 43 263.0 44 270.5 45 263.5 46 252.0 47 242.0 48 218.0 49 194.5 50 166.0 51 125.5 52 104.0 53 87.5 54 64.5 55 47.5 56 43.5 57 37.0 58 25.0 59 18.0 60 11.5 61 9.5 62 8.5 63 6.0 64 2.0 65 2.0 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.41603466955578 85.3 2 6.852654387865656 12.65 3 0.7042253521126761 1.95 4 0.027085590465872153 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.05 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.5499999999999998 0.0 0.0 0.0 0.0 136-137 1.8250000000000002 0.0 0.0 0.0 0.0 138 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR21683880 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21683880_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.512 37.0 37.0 37.0 37.0 37.0 2 36.48475 37.0 37.0 37.0 37.0 37.0 3 36.5405 37.0 37.0 37.0 37.0 37.0 4 36.55 37.0 37.0 37.0 37.0 37.0 5 36.631 37.0 37.0 37.0 37.0 37.0 6 36.582 37.0 37.0 37.0 37.0 37.0 7 36.531 37.0 37.0 37.0 37.0 37.0 8 36.6085 37.0 37.0 37.0 37.0 37.0 9 36.572 37.0 37.0 37.0 37.0 37.0 10-14 36.5733 37.0 37.0 37.0 37.0 37.0 15-19 36.554 37.0 37.0 37.0 37.0 37.0 20-24 36.5997 37.0 37.0 37.0 37.0 37.0 25-29 36.533300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5135 37.0 37.0 37.0 37.0 37.0 35-39 36.5039 37.0 37.0 37.0 37.0 37.0 40-44 36.4719 37.0 37.0 37.0 37.0 37.0 45-49 36.4912 37.0 37.0 37.0 37.0 37.0 50-54 36.4765 37.0 37.0 37.0 37.0 37.0 55-59 36.444 37.0 37.0 37.0 37.0 37.0 60-64 36.376400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3601 37.0 37.0 37.0 37.0 37.0 70-74 36.2981 37.0 37.0 37.0 37.0 37.0 75-79 36.282 37.0 37.0 37.0 37.0 37.0 80-84 36.2539 37.0 37.0 37.0 37.0 37.0 85-89 36.2753 37.0 37.0 37.0 37.0 37.0 90-94 36.2641 37.0 37.0 37.0 37.0 37.0 95-99 36.2158 37.0 37.0 37.0 37.0 37.0 100-104 36.1651 37.0 37.0 37.0 37.0 37.0 105-109 36.199799999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1107 37.0 37.0 37.0 37.0 37.0 115-119 36.0326 37.0 37.0 37.0 37.0 37.0 120-124 35.91179999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9563 37.0 37.0 37.0 37.0 37.0 130-134 35.8583 37.0 37.0 37.0 37.0 37.0 135-139 35.87669999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.757 37.0 37.0 37.0 37.0 37.0 145-149 35.7386 37.0 37.0 37.0 37.0 37.0 150 35.608 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 1.0 24 5.0 25 1.0 26 6.0 27 6.0 28 11.0 29 15.0 30 23.0 31 27.0 32 48.0 33 63.0 34 118.0 35 315.0 36 2903.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 17.05 21.575 34.050000000000004 2 21.305326331582897 26.456614153538382 34.583645911477866 17.65441360340085 3 21.525 31.125000000000004 25.8 21.55 4 23.75 36.325 20.424999999999997 19.5 5 22.900000000000002 35.8 22.15 19.15 6 17.275 35.925000000000004 24.95 21.85 7 15.275 15.325 45.225 24.175 8 19.025 21.3 28.199999999999996 31.474999999999998 9 19.125 24.6 29.25 27.025 10-14 21.235 28.499999999999996 26.805 23.46 15-19 20.61 28.060000000000002 28.884999999999998 22.445 20-24 21.740000000000002 27.98 28.28 22.0 25-29 21.135 29.065 28.01 21.790000000000003 30-34 21.54 28.744999999999997 27.915 21.8 35-39 21.395 29.110000000000003 27.49 22.005 40-44 22.040000000000003 28.205000000000002 27.99 21.765 45-49 21.88 28.425 27.525 22.17 50-54 21.525 29.325000000000003 27.029999999999998 22.12 55-59 22.24 27.88 27.82 22.06 60-64 21.46 28.384999999999998 27.76 22.395 65-69 21.634999999999998 28.715000000000003 27.365000000000002 22.285 70-74 21.81 28.255000000000003 27.544999999999998 22.39 75-79 21.84 27.544999999999998 28.28 22.335 80-84 22.16 28.610000000000003 27.24 21.990000000000002 85-89 21.815 28.000000000000004 28.189999999999998 21.995 90-94 21.89 28.225 27.889999999999997 21.995 95-99 22.255 28.01 27.77 21.965 100-104 22.555 28.904999999999998 26.88 21.66 105-109 21.705 28.23 27.77 22.295 110-114 22.455 27.894999999999996 27.775 21.875 115-119 22.37 27.79 28.27 21.57 120-124 21.965 28.01 28.139999999999997 21.884999999999998 125-129 22.39 27.765 28.005000000000003 21.84 130-134 21.965 27.91 28.23 21.895 135-139 22.6 27.584999999999997 28.08 21.735 140-144 22.27 27.93 28.410000000000004 21.39 145-149 23.31 27.73 27.685 21.275 150 23.1 27.200000000000003 28.775000000000002 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 2.0 21 5.0 22 4.0 23 3.5 24 3.0 25 3.5 26 6.5 27 8.0 28 14.0 29 18.0 30 17.0 31 27.0 32 39.5 33 44.0 34 55.0 35 79.0 36 86.5 37 98.5 38 133.0 39 164.0 40 190.0 41 211.0 42 237.5 43 247.0 44 261.5 45 286.5 46 274.5 47 245.0 48 227.0 49 206.5 50 161.0 51 124.5 52 116.0 53 102.5 54 79.5 55 54.0 56 43.5 57 33.5 58 21.0 59 18.5 60 12.5 61 8.5 62 5.0 63 3.5 64 5.0 65 3.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.3285443209542 85.15 2 6.9395500135538075 12.8 3 0.7047980482515587 1.95 4 0.02710761724044456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.05 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.5499999999999998 0.0 0.0 0.0 0.0 136-137 1.8250000000000002 0.0 0.0 0.0 0.0 138 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848898 spots for SRR21683880.sra Written 848898 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra Read 848891 spots for SRR21683880.sra Written 848891 spots for SRR21683880.sra SRR ids: ['SRR21683880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0c3iyae6 SRR21683880.sra spots: 16977827 blocks: [[1, 848891], [848892, 1697782], [1697783, 2546673], [2546674, 3395564], [3395565, 4244455], [4244456, 5093346], [5093347, 5942237], [5942238, 6791128], [6791129, 7640019], [7640020, 8488910], [8488911, 9337801], [9337802, 10186692], [10186693, 11035583], [11035584, 11884474], [11884475, 12733365], [12733366, 13582256], [13582257, 14431147], [14431148, 15280038], [15280039, 16128929], [16128930, 16977827]] SRR21683880 file size 5714948 SRR21683880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21683880 SRR21683880_1.fastq SRR21683880_2.fastq Input file: SRR21683880_1.fastq Paired file: SRR21683880_2.fastq trimmed: SRR21683880-trimmed-pair1.fastq, SRR21683880-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:30:22 2025 >> started Wed Feb 12 04:30:40 2025 >> done (18.033s) 16977827 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 111 ( 0.00%) empty read pairs filtered out after trimming by size control 16977636 (100.00%) read pairs available; of these: 519507 ( 3.06%) trimmed read pairs available after processing 16458129 (96.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 6 0.00% 21 12 0.00% 22 3 0.00% 23 9 0.00% 24 12 0.00% 25 6 0.00% 26 6 0.00% 27 12 0.00% 28 18 0.00% 29 19 0.00% 30 15 0.00% 31 8 0.00% 32 13 0.00% 33 10 0.00% 34 14 0.00% 35 15 0.00% 36 17 0.00% 37 12 0.00% 38 18 0.00% 39 10 0.00% 40 22 0.00% 41 24 0.00% 42 32 0.00% 43 31 0.00% 44 24 0.00% 45 20 0.00% 46 34 0.00% 47 39 0.00% 48 46 0.00% 49 68 0.00% 50 77 0.00% 51 109 0.00% 52 100 0.00% 53 110 0.00% 54 89 0.00% 55 121 0.00% 56 134 0.00% 57 175 0.00% 58 218 0.00% 59 277 0.00% 60 262 0.00% 61 285 0.00% 62 339 0.00% 63 292 0.00% 64 262 0.00% 65 294 0.00% 66 251 0.00% 67 371 0.00% 68 449 0.00% 69 509 0.00% 70 554 0.00% 71 522 0.00% 72 546 0.00% 73 550 0.00% 74 580 0.00% 75 602 0.00% 76 660 0.00% 77 657 0.00% 78 758 0.00% 79 845 0.00% 80 932 0.01% 81 1020 0.01% 82 1154 0.01% 83 1282 0.01% 84 1303 0.01% 85 1419 0.01% 86 1441 0.01% 87 1538 0.01% 88 1596 0.01% 89 1694 0.01% 90 1927 0.01% 91 2067 0.01% 92 2142 0.01% 93 2342 0.01% 94 2428 0.01% 95 2522 0.01% 96 2531 0.01% 97 2741 0.02% 98 2866 0.02% 99 3074 0.02% 100 3264 0.02% 101 3283 0.02% 102 3559 0.02% 103 3661 0.02% 104 3867 0.02% 105 4036 0.02% 106 4230 0.02% 107 4446 0.03% 108 4554 0.03% 109 4657 0.03% 110 4905 0.03% 111 5424 0.03% 112 5381 0.03% 113 5504 0.03% 114 5780 0.03% 115 6042 0.04% 116 6265 0.04% 117 6249 0.04% 118 6586 0.04% 119 6907 0.04% 120 7191 0.04% 121 7440 0.04% 122 7947 0.05% 123 8280 0.05% 124 8248 0.05% 125 8684 0.05% 126 9246 0.05% 127 9372 0.06% 128 9631 0.06% 129 9947 0.06% 130 9914 0.06% 131 10743 0.06% 132 11037 0.07% 133 11286 0.07% 134 11653 0.07% 135 12082 0.07% 136 12605 0.07% 137 13208 0.08% 138 13252 0.08% 139 13773 0.08% 140 14257 0.08% 141 14656 0.09% 142 15171 0.09% 143 15617 0.09% 144 16386 0.10% 145 17038 0.10% 146 17325 0.10% 147 17784 0.10% 148 18570 0.11% 149 18954 0.11% 150 16458129 96.94% 16977636 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=4.53 fanout-score-rank=18 prefix-density=0.13 prefix-fanout=3.3 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=166.29 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=20.3 sequence=GCAGCAGCAGCAA criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=21 prefix-density=0.13 prefix-fanout=3.5 sequence=CTCTCCACCTCCAAGGTGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=319.42 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=29.4 sequence=AAGAAGAAGAAA SRR21683880 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:31:38 Started mapping on | Feb 12 04:31:39 Finished on | Feb 12 04:36:23 Mapping speed, Million of reads per hour | 215.21 Number of input reads | 16977636 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14595102 Uniquely mapped reads % | 85.97% Average mapped length | 291.05 Number of splices: Total | 13756608 Number of splices: Annotated (sjdb) | 13335090 Number of splices: GT/AG | 13445549 Number of splices: GC/AG | 198278 Number of splices: AT/AC | 9047 Number of splices: Non-canonical | 103734 Mismatch rate per base, % | 1.95% Deletion rate per base | 0.12% Deletion average length | 3.24 Insertion rate per base | 0.08% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 849758 % of reads mapped to multiple loci | 5.01% Number of reads mapped to too many loci | 24279 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.66% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1532776 1532776 1532776 N_multimapping 849758 849758 849758 N_noFeature 430388 7381290 7471199 N_ambiguous 321110 74146 74627 UnstrandedReadsAssigned:13843604 PositiveStrandReadsAssigned:7139666 NegativeStrandReadsAssigned:7049276 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR21683880 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21683880-trimmed-pair1.fastq SRR21683880-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,977,636 reads, 13,456,040 reads pseudoaligned [quant] estimated average fragment length: 239.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR21683880.ke.tsv 34699 SRR21683880.se.tsv 87100 total ==> SRR21683880.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.09 1748.65 63.4872 Potri.005G024800.1.v4.1 1035 796.095 282 22.8806 Potri.004G059700.1.v4.1 961 722.095 4 0.357807 Potri.007G009000.2.v4.1 1416 1177.09 0 0 Potri.003G141000.2.v4.1 2943 2704.09 99.0744 2.36659 Potri.016G087400.1.v4.1 270 56.5524 248 283.259 Potri.015G069301.1.v4.1 564 325.212 0 0 Potri.010G195200.1.v4.1 1773 1534.09 42 1.7684 Potri.012G127500.1.v4.1 977 738.095 169 14.7896 ==> SRR21683880.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 77 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR21683880 completed mapping pipeline successfully