Starting /dee2/code/volunteer_pipeline.sh SRR21835920 current disk space = 3088677396480 free memory = 1498808848 SRR21835920 SRAfilesize 0f51db9be5bacb1ddf3a9f857c0091ee SRR21835920.sra SRR21835920.sra file validated SRR21835920 is paired end SRR21835920 is conventional basespace SRR21835920 read1 length is 101-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21835920_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.628 37.0 37.0 37.0 37.0 37.0 2 36.643 37.0 37.0 37.0 37.0 37.0 3 36.6865 37.0 37.0 37.0 37.0 37.0 4 36.741 37.0 37.0 37.0 37.0 37.0 5 36.7 37.0 37.0 37.0 37.0 37.0 6 36.6595 37.0 37.0 37.0 37.0 37.0 7 36.636 37.0 37.0 37.0 37.0 37.0 8 36.7615 37.0 37.0 37.0 37.0 37.0 9 36.609 37.0 37.0 37.0 37.0 37.0 10-14 36.6701 37.0 37.0 37.0 37.0 37.0 15-19 36.6383 37.0 37.0 37.0 37.0 37.0 20-24 36.5992 37.0 37.0 37.0 37.0 37.0 25-29 36.610200000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.583000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.539 37.0 37.0 37.0 37.0 37.0 40-44 36.501599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.5185 37.0 37.0 37.0 37.0 37.0 50-54 36.452999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4439 37.0 37.0 37.0 37.0 37.0 60-64 36.4272 37.0 37.0 37.0 37.0 37.0 65-69 36.4572 37.0 37.0 37.0 37.0 37.0 70-74 36.4233 37.0 37.0 37.0 37.0 37.0 75-79 36.318200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.36900000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2435 37.0 37.0 37.0 37.0 37.0 90-94 36.208299999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2539 37.0 37.0 37.0 37.0 37.0 100-104 36.07623060258156 37.0 37.0 37.0 37.0 37.0 105-109 36.18025128546486 37.0 37.0 37.0 37.0 37.0 110-114 36.11427809994045 37.0 37.0 37.0 37.0 37.0 115-119 36.00291932712715 37.0 37.0 37.0 37.0 37.0 120-124 35.96790656147569 37.0 37.0 37.0 37.0 37.0 125-129 35.94204742704268 37.0 37.0 37.0 37.0 37.0 130-134 35.94594671509808 37.0 37.0 37.0 37.0 37.0 135-139 35.84559730641887 37.0 37.0 37.0 37.0 37.0 140-144 35.819083804658206 37.0 37.0 37.0 37.0 37.0 145-149 35.81604174581106 37.0 37.0 37.0 37.0 37.0 150 35.807874015748034 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 0.0 25 1.0 26 4.0 27 5.0 28 8.0 29 9.0 30 20.0 31 24.0 32 36.0 33 64.0 34 97.0 35 324.0 36 3139.0 37 266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.894447223611806 15.032516258129064 13.806903451725864 32.266133066533264 2 19.7 21.349999999999998 34.675 24.275 3 22.075 24.725 27.825 25.374999999999996 4 26.674999999999997 28.7 20.825 23.799999999999997 5 23.525 32.525 23.7 20.25 6 18.099999999999998 36.3 26.55 19.05 7 16.275000000000002 20.25 44.4 19.075 8 17.7 22.55 31.225 28.525 9 20.200000000000003 23.974999999999998 32.45 23.375 10-14 20.655 30.385 26.939999999999998 22.02 15-19 20.94 28.294999999999998 28.499999999999996 22.264999999999997 20-24 21.41 28.665000000000003 28.115000000000002 21.81 25-29 21.98 28.23 27.155 22.634999999999998 30-34 21.27 28.499999999999996 27.775 22.455 35-39 21.195 28.249999999999996 28.335 22.220000000000002 40-44 21.349999999999998 28.12 28.165000000000003 22.365 45-49 22.189999999999998 28.549999999999997 27.189999999999998 22.07 50-54 21.740000000000002 28.000000000000004 28.09 22.17 55-59 21.395 28.03 28.189999999999998 22.384999999999998 60-64 21.404999999999998 28.12 28.435 22.040000000000003 65-69 21.75 28.444999999999997 27.185 22.62 70-74 21.59 27.87 27.584999999999997 22.955000000000002 75-79 21.9 27.655 27.794999999999998 22.650000000000002 80-84 21.625 28.585 27.045 22.745 85-89 21.215 28.08 27.439999999999998 23.265 90-94 21.26 27.755000000000003 28.33 22.655 95-99 21.595 28.389999999999997 27.395000000000003 22.62 100-104 21.045522761380692 27.363681840920464 29.10455227613807 22.486243121560783 105-109 21.93619472129013 28.837582010317025 26.899383983572893 22.32683928481995 110-114 22.344487991156665 28.685559240277357 27.188222289217162 21.78173047934881 115-119 21.63088398346941 27.33091422235662 27.693780868864025 23.34442092530995 120-124 21.90886075949367 27.326582278481016 28.637974683544304 22.126582278481013 125-129 22.271895956106484 27.794147530989637 27.33184312131681 22.602113391587075 130-134 21.63030179445351 28.104608482871125 27.910889070146823 22.354200652528547 135-139 21.89579281400348 27.715221619408332 28.590439144231755 21.79854642235643 140-144 22.015655577299412 28.494180657122257 27.76805026264291 21.722113502935418 145-149 21.96649444183498 27.9056416679714 28.234434528469286 21.893429361724337 150 21.25984251968504 27.42782152230971 27.926509186351705 23.38582677165354 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 5.0 27 7.0 28 9.0 29 10.0 30 14.5 31 20.5 32 28.0 33 38.5 34 53.5 35 77.5 36 84.0 37 94.0 38 144.5 39 189.5 40 213.5 41 228.0 42 239.0 43 281.5 44 284.5 45 256.0 46 258.5 47 252.0 48 229.0 49 179.5 50 150.0 51 140.0 52 108.5 53 89.5 54 72.0 55 49.5 56 35.5 57 35.0 58 33.0 59 22.5 60 20.5 61 14.0 62 8.0 63 6.0 64 2.5 65 0.5 66 0.5 67 3.0 68 3.0 69 1.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 3.0 102-103 1.0 104-105 1.0 106-107 4.0 108-109 2.0 110-111 11.0 112-113 1.0 114-115 6.0 116-117 5.0 118-119 8.0 120-121 8.0 122-123 7.0 124-125 4.0 126-127 3.0 128-129 6.0 130-131 6.0 132-133 9.0 134-135 1.0 136-137 12.0 138-139 9.0 140-141 7.0 142-143 16.0 144-145 18.0 146-147 37.0 148-149 5.0 150-151 3810.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 76.525 #Duplication Level Percentage of deduplicated Percentage of total 1 77.03364913426984 58.95 2 17.216595883698137 26.35 3 4.214309049330285 9.675 4 1.1760862463247306 3.5999999999999996 5 0.29402156158118264 1.125 6 0.06533812479581835 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGCATCAAGAACTGAATGATTGACTTCCATATTACTTCCCATGACTGG 6 0.15 No Hit CAGGTTGGTGAGCAAAAGTCCATATCCCACTTCGCCAGCAGGAAAAGAGG 6 0.15 No Hit CAATGGATACCCACAAGAGGATATTTGGTTTCAAGATCATATTTTTCGTA 5 0.125 No Hit AATCTATCAACTCTAAGCTTCCTAGCACAGAACAATTTAGGTGTCTTGAC 5 0.125 No Hit TACTGAACGATCAAAGGATCCACTGAGAAGAACTTGTGGCTCATGATGAT 5 0.125 No Hit GCTCTTCAGAGAGCTGCAAAGTTCTTGGGACAGGCATGAGATCTTTTTTT 5 0.125 No Hit GGCCGCCCCCCCAGCTGTGGTATCTTCTGGCTTGCAACTACTTGTATCGG 5 0.125 No Hit GAATGTTTATGCTAAATGCAAGTTTATTGCCCAGTGCTTTGTCTACGGGG 5 0.125 No Hit CCTGAGCATCATATTTGCTAACTCAAAAAAAAAAAAGAAGGGCAAAAGTA 5 0.125 No Hit GATTATGTTAAGAACATGATTACTGGTGCTGCTCAAATGGATGGAGCTAT 5 0.125 No Hit CCGCACTAAAGAAGCCTAGAGCAAAAGTTCCACTAGCAGAAATTATGGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR21835920 read2 length is 101-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21835920_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101-150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4265 37.0 37.0 37.0 37.0 37.0 2 36.403 37.0 37.0 37.0 37.0 37.0 3 36.388 37.0 37.0 37.0 37.0 37.0 4 36.527 37.0 37.0 37.0 37.0 37.0 5 36.378 37.0 37.0 37.0 37.0 37.0 6 36.487 37.0 37.0 37.0 37.0 37.0 7 36.426 37.0 37.0 37.0 37.0 37.0 8 36.4915 37.0 37.0 37.0 37.0 37.0 9 36.4465 37.0 37.0 37.0 37.0 37.0 10-14 36.4354 37.0 37.0 37.0 37.0 37.0 15-19 36.4212 37.0 37.0 37.0 37.0 37.0 20-24 36.3726 37.0 37.0 37.0 37.0 37.0 25-29 36.281099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3119 37.0 37.0 37.0 37.0 37.0 35-39 36.31949999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.231700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1718 37.0 37.0 37.0 37.0 37.0 50-54 36.271300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2418 37.0 37.0 37.0 37.0 37.0 60-64 36.1182 37.0 37.0 37.0 37.0 37.0 65-69 36.1871 37.0 37.0 37.0 37.0 37.0 70-74 36.132799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0794 37.0 37.0 37.0 37.0 37.0 80-84 36.063 37.0 37.0 37.0 37.0 37.0 85-89 35.94199999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.970299999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9354 37.0 37.0 37.0 37.0 37.0 100-104 35.90056304448056 37.0 37.0 37.0 37.0 37.0 105-109 35.85115466692575 37.0 37.0 37.0 37.0 37.0 110-114 35.83029716395825 37.0 37.0 37.0 37.0 37.0 115-119 35.77240444398255 37.0 37.0 37.0 37.0 37.0 120-124 35.65653428699311 37.0 37.0 37.0 37.0 37.0 125-129 35.61825980630619 37.0 37.0 37.0 37.0 37.0 130-134 35.363699800053396 37.0 37.0 37.0 32.2 37.0 135-139 35.599528064405035 37.0 37.0 37.0 37.0 37.0 140-144 35.4916535908077 37.0 37.0 37.0 37.0 37.0 145-149 35.24754192998128 37.0 37.0 37.0 29.8 37.0 150 35.15275590551181 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 2.0 24 5.0 25 4.0 26 5.0 27 10.0 28 11.0 29 12.0 30 15.0 31 21.0 32 42.0 33 64.0 34 159.0 35 736.0 36 2803.0 37 107.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.574999999999996 16.25 13.450000000000001 32.725 2 21.45 23.65 31.275 23.625 3 23.5 26.55 26.525 23.425 4 26.6 30.2 20.925 22.275 5 23.3 34.300000000000004 22.325 20.075000000000003 6 18.3 38.5 25.25 17.95 7 16.625 20.925 42.65 19.8 8 18.975 23.474999999999998 32.225 25.324999999999996 9 19.75 24.375 30.7 25.174999999999997 10-14 21.175 30.175 27.08 21.57 15-19 21.07 28.08 28.785 22.065 20-24 21.525 28.53 27.794999999999998 22.15 25-29 21.279999999999998 28.189999999999998 27.994999999999997 22.535 30-34 20.84 28.93 27.994999999999997 22.235 35-39 21.22 28.62 28.299999999999997 21.86 40-44 21.285 28.01 28.294999999999998 22.41 45-49 22.325 27.54 28.42 21.715 50-54 21.55 27.915 28.599999999999998 21.935 55-59 22.125 27.91 27.785 22.18 60-64 21.175 27.52 28.560000000000002 22.745 65-69 21.18 28.04 27.675 23.105 70-74 21.685 27.68 28.060000000000002 22.575 75-79 21.575 28.025 28.035 22.365 80-84 21.775 27.6 28.1 22.525000000000002 85-89 21.945 27.92 27.755000000000003 22.38 90-94 21.775 28.139999999999997 27.639999999999997 22.445 95-99 21.98 28.89 27.845 21.285 100-104 22.321160580290144 27.85392696348174 27.63881940970485 22.18609304652326 105-109 21.76090549406521 28.03125156508239 27.65563179245755 22.552211148394854 110-114 21.440056275751182 28.077580142699226 28.35393427796201 22.12842930358758 115-119 21.963511742767867 28.041528071766958 27.90545307932668 22.089507106138495 120-124 21.30126582278481 28.415189873417724 27.26582278481013 23.01772151898734 125-129 21.55049786628734 27.78906726275147 28.29709408656777 22.363340784393415 130-134 22.226753670473084 27.6305057096248 27.472471451876018 22.6702691680261 135-139 22.33084246084553 27.84317739789129 27.996724332070837 21.829255809192343 140-144 22.262848903079615 27.556905963538984 28.241837470388298 21.938407662993097 145-149 22.519701476958407 27.62381921611607 27.670789624758623 22.185689682166903 150 22.598425196850393 27.48031496062992 28.083989501312335 21.83727034120735 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.5 23 1.5 24 1.0 25 1.0 26 2.0 27 7.0 28 11.0 29 12.0 30 10.0 31 15.0 32 31.5 33 47.0 34 54.0 35 72.0 36 90.5 37 101.0 38 143.5 39 182.5 40 212.0 41 242.5 42 244.5 43 266.5 44 284.0 45 264.0 46 269.0 47 242.5 48 201.5 49 188.0 50 168.0 51 141.0 52 107.0 53 93.0 54 82.0 55 56.0 56 34.5 57 24.5 58 18.0 59 23.5 60 19.5 61 7.5 62 5.0 63 3.0 64 3.0 65 3.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 1.5 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 100-101 3.0 102-103 1.0 104-105 1.0 106-107 4.0 108-109 2.0 110-111 11.0 112-113 1.0 114-115 6.0 116-117 5.0 118-119 8.0 120-121 8.0 122-123 7.0 124-125 4.0 126-127 3.0 128-129 6.0 130-131 6.0 132-133 9.0 134-135 1.0 136-137 12.0 138-139 9.0 140-141 7.0 142-143 16.0 144-145 18.0 146-147 37.0 148-149 5.0 150-151 3810.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 77.25 #Duplication Level Percentage of deduplicated Percentage of total 1 77.96116504854369 60.224999999999994 2 16.63430420711974 25.7 3 3.8511326860841426 8.924999999999999 4 1.1650485436893203 3.5999999999999996 5 0.3236245954692557 1.25 6 0.06472491909385113 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGTGACTCTTCTACAGTTGAAGTTAGAAGTGCCCCTGTTTCAAGTAAGA 6 0.15 No Hit GAATAATACGACAATGTTAAGAACCTAATACGATAGAAGTTTTACATGAT 6 0.15 No Hit TTGCAACATATAATATACTTCTTGATGGGCTTGTAAAAAACGGTAGGATT 5 0.125 No Hit GGGGGCCAAAAGATTCACTACTATTTTGGCGAAGCCAAAAAATTGTTCAC 5 0.125 No Hit TCGCATTCTCTAAACCTCTGCAGCCCAAAAACCTCAGAGTATGGCTGGAA 5 0.125 No Hit GGATGAAACAAGTGATGGTGATTCAAACATATACGTTCACCATGAGGTTC 5 0.125 No Hit CTTTCTTTCAGGCTCACAAATAGATAATTGGGTTCTGTGTTTTGCTGCTT 5 0.125 No Hit GGGTCAGAAGACCATTTTCCACTGTAAATTGTTCTAGCACCAGTGTCACA 5 0.125 No Hit GGGAATCCAAATGGTGAGGGTTAACATTGTAAAGATTATATATGTTGCGG 5 0.125 No Hit GAGGAATTGGTATATAATTATCAACATTATCCATAAGTTCATATATTTTA 5 0.125 No Hit GTAGCTTTCTCCAATTTCTTTTACACAGTCAAAAACCCTTTAGCAAAACC 5 0.125 No Hit AAGCGACCCAAATATTCAAAGTTTACACAACAAGAACTTCCTGCTTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169877 spots for SRR21835920.sra Written 1169877 spots for SRR21835920.sra Read 1169883 spots for SRR21835920.sra Written 1169883 spots for SRR21835920.sra SRR ids: ['SRR21835920.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_55e32cf1 SRR21835920.sra spots: 23397546 blocks: [[1, 1169877], [1169878, 2339754], [2339755, 3509631], [3509632, 4679508], [4679509, 5849385], [5849386, 7019262], [7019263, 8189139], [8189140, 9359016], [9359017, 10528893], [10528894, 11698770], [11698771, 12868647], [12868648, 14038524], [14038525, 15208401], [15208402, 16378278], [16378279, 17548155], [17548156, 18718032], [18718033, 19887909], [19887910, 21057786], [21057787, 22227663], [22227664, 23397546]] SRR21835920 file size 7841689 SRR21835920 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21835920 SRR21835920_1.fastq SRR21835920_2.fastq Input file: SRR21835920_1.fastq Paired file: SRR21835920_2.fastq trimmed: SRR21835920-trimmed-pair1.fastq, SRR21835920-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:37:58 2025 >> started Thu Feb 13 17:38:27 2025 >> done (29.360s) 23397546 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 23397546 (100.00%) read pairs available; of these: 1004 ( 0.00%) trimmed read pairs available after processing 23396542 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 1 0.00% 78 0 0.00% 79 0 0.00% 80 1 0.00% 81 1 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 1 0.00% 87 0 0.00% 88 0 0.00% 89 3 0.00% 90 0 0.00% 91 1 0.00% 92 1 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 2 0.00% 98 0 0.00% 99 0 0.00% 100 11426 0.05% 101 11739 0.05% 102 12295 0.05% 103 12028 0.05% 104 12498 0.05% 105 12637 0.05% 106 12748 0.05% 107 12898 0.06% 108 13106 0.06% 109 13204 0.06% 110 13498 0.06% 111 13803 0.06% 112 13940 0.06% 113 14531 0.06% 114 14491 0.06% 115 15106 0.06% 116 15418 0.07% 117 15388 0.07% 118 15425 0.07% 119 15546 0.07% 120 15721 0.07% 121 16395 0.07% 122 17005 0.07% 123 17328 0.07% 124 17785 0.08% 125 17908 0.08% 126 17852 0.08% 127 17825 0.08% 128 18096 0.08% 129 19069 0.08% 130 19545 0.08% 131 20050 0.09% 132 19993 0.09% 133 20519 0.09% 134 20739 0.09% 135 22008 0.09% 136 19217 0.08% 137 22393 0.10% 138 24699 0.11% 139 26324 0.11% 140 30109 0.13% 141 38398 0.16% 142 48670 0.21% 143 106186 0.45% 144 28480 0.12% 145 60121 0.26% 146 188683 0.81% 147 22511 0.10% 148 22491 0.10% 149 23189 0.10% 150 22166499 94.74% 23397546 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=37 prefix-density=0.12 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=107.43 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=14.1 sequence=AAAAGAAAAGAAAA criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=29 prefix-density=0.13 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=213.59 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=24.5 sequence=AGCAGCAGCAGC SRR21835920 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:39:10 Started mapping on | Feb 13 17:39:10 Finished on | Feb 13 17:41:32 Mapping speed, Million of reads per hour | 593.18 Number of input reads | 23397546 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21739372 Uniquely mapped reads % | 92.91% Average mapped length | 295.99 Number of splices: Total | 21488180 Number of splices: Annotated (sjdb) | 21070587 Number of splices: GT/AG | 21112090 Number of splices: GC/AG | 315173 Number of splices: AT/AC | 14702 Number of splices: Non-canonical | 46215 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.69 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 529000 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 204267 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1129174 1129174 1129174 N_multimapping 529000 529000 529000 N_noFeature 741595 11358569 10968018 N_ambiguous 270681 57275 59474 UnstrandedReadsAssigned:20727096 PositiveStrandReadsAssigned:10323528 NegativeStrandReadsAssigned:10711880 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR21835920 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR21835920-trimmed-pair1.fastq SRR21835920-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,397,546 reads, 21,383,542 reads pseudoaligned [quant] estimated average fragment length: 281.758 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR21835920.ke.tsv 34699 SRR21835920.se.tsv 87100 total ==> SRR21835920.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.24 942 25.054 Potri.005G024800.1.v4.1 1035 754.242 188 11.5168 Potri.004G059700.1.v4.1 961 680.256 46 3.12443 Potri.007G009000.2.v4.1 1416 1135.24 0 0 Potri.003G141000.2.v4.1 2943 2662.24 857.957 14.8903 Potri.016G087400.1.v4.1 270 61.5931 950 712.652 Potri.015G069301.1.v4.1 564 284.587 0 0 Potri.010G195200.1.v4.1 1773 1492.24 48 1.48624 Potri.012G127500.1.v4.1 977 696.242 2412 160.067 ==> SRR21835920.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1649 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 63 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 224 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR21835920 completed mapping pipeline successfully