Starting /dee2/code/volunteer_pipeline.sh SRR22215329 current disk space = 3055554068480 free memory = 1580282104 SRR22215329 SRAfilesize ab35f37c277d9333af6f7387bee4e4e1 SRR22215329.sra SRR22215329.sra file validated SRR22215329 is paired end SRR22215329 is conventional basespace SRR22215329 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215329_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.01575 37.0 37.0 37.0 37.0 37.0 2 36.01025 37.0 37.0 37.0 37.0 37.0 3 36.34 37.0 37.0 37.0 37.0 37.0 4 36.3115 37.0 37.0 37.0 37.0 37.0 5 36.307 37.0 37.0 37.0 37.0 37.0 6 36.3785 37.0 37.0 37.0 37.0 37.0 7 36.3515 37.0 37.0 37.0 37.0 37.0 8 36.218 37.0 37.0 37.0 37.0 37.0 9 36.3 37.0 37.0 37.0 37.0 37.0 10-14 36.3289 37.0 37.0 37.0 37.0 37.0 15-19 36.3343 37.0 37.0 37.0 37.0 37.0 20-24 36.22430000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.156 37.0 37.0 37.0 37.0 37.0 30-34 36.096799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.052 37.0 37.0 37.0 37.0 37.0 40-44 36.0249 37.0 37.0 37.0 37.0 37.0 45-49 35.973 37.0 37.0 37.0 37.0 37.0 50-54 35.8871 37.0 37.0 37.0 37.0 37.0 55-59 35.8502 37.0 37.0 37.0 37.0 37.0 60-64 35.849000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.786699999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8112 37.0 37.0 37.0 37.0 37.0 75-79 35.8529 37.0 37.0 37.0 37.0 37.0 80-84 35.7519 37.0 37.0 37.0 37.0 37.0 85-89 35.761700000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.6601 37.0 37.0 37.0 37.0 37.0 95-99 35.684900000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.702600000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.574 37.0 37.0 37.0 37.0 37.0 110-114 35.6054 37.0 37.0 37.0 37.0 37.0 115-119 35.6074 37.0 37.0 37.0 37.0 37.0 120-124 35.44680000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.4834 37.0 37.0 37.0 37.0 37.0 130-134 35.469100000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.422399999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.3149 37.0 37.0 37.0 37.0 37.0 145-149 35.286100000000005 37.0 37.0 37.0 32.2 37.0 150-151 35.10425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 0.0 20 0.0 21 1.0 22 0.0 23 2.0 24 5.0 25 11.0 26 12.0 27 21.0 28 28.0 29 43.0 30 53.0 31 69.0 32 83.0 33 108.0 34 207.0 35 398.0 36 2732.0 37 223.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.217707549535994 11.888638073739653 18.159016804615 33.73463757210936 2 32.7815400050163 12.114371708051166 31.30173062452972 23.80235766240281 3 28.299999999999997 20.75 23.5 27.450000000000003 4 29.099999999999998 24.675 20.525 25.7 5 27.400000000000002 30.125 23.425 19.05 6 18.65 32.800000000000004 26.424999999999997 22.125 7 13.325000000000001 30.225 38.45 18.0 8 16.725 26.825 32.65 23.799999999999997 9 18.2 24.375 31.525 25.900000000000002 10-14 18.970000000000002 31.665 27.715 21.65 15-19 19.965 29.48 27.779999999999998 22.775000000000002 20-24 18.98 29.970000000000002 27.794999999999998 23.255 25-29 19.265 29.78 27.3 23.655 30-34 19.305 29.955 27.515 23.225 35-39 19.66 29.15 27.455000000000002 23.735 40-44 18.85 30.325000000000003 27.150000000000002 23.674999999999997 45-49 19.675 29.49 27.57 23.265 50-54 19.689999999999998 29.13 27.325 23.855 55-59 19.55 29.435 28.294999999999998 22.720000000000002 60-64 19.105 29.12 27.845 23.93 65-69 19.515 29.475 27.275 23.735 70-74 19.994999999999997 28.849999999999998 27.51 23.645 75-79 19.89 29.255 27.750000000000004 23.105 80-84 19.939999999999998 28.82 27.6 23.64 85-89 20.39 28.444999999999997 27.395000000000003 23.77 90-94 20.145 28.73 27.295 23.830000000000002 95-99 20.365 28.63 27.284999999999997 23.72 100-104 20.080000000000002 28.42 27.395000000000003 24.104999999999997 105-109 20.22 28.499999999999996 27.37 23.91 110-114 19.865 28.875 27.095000000000002 24.165 115-119 19.900000000000002 29.82 26.775 23.505000000000003 120-124 20.435 28.775000000000002 27.36 23.43 125-129 19.945 28.615000000000002 27.485 23.955000000000002 130-134 20.794999999999998 28.345 27.544999999999998 23.315 135-139 20.419999999999998 27.96 27.87 23.75 140-144 21.125 28.48 26.56 23.835 145-149 20.605 28.595 26.855 23.945 150-151 21.1375 29.262500000000003 26.174999999999997 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 2.0 23 3.5 24 6.0 25 8.5 26 11.0 27 16.5 28 17.5 29 18.5 30 28.0 31 42.0 32 48.0 33 59.5 34 72.5 35 80.0 36 107.5 37 130.5 38 141.5 39 172.0 40 204.0 41 214.0 42 235.0 43 245.5 44 239.0 45 230.0 46 233.5 47 239.5 48 212.5 49 180.5 50 158.0 51 126.0 52 103.0 53 93.5 54 74.5 55 58.5 56 49.5 57 33.5 58 13.5 59 10.0 60 12.0 61 10.5 62 9.0 63 5.5 64 1.5 65 3.0 66 4.0 67 4.5 68 7.0 69 6.5 70 3.5 71 1.5 72 1.5 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.85792349726776 84.05 2 7.295081967213115 13.350000000000001 3 0.7650273224043715 2.1 4 0.0273224043715847 0.1 5 0.0 0.0 6 0.0273224043715847 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0273224043715847 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 10 0.25 TruSeq Adapter, Index 6 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCGCGTATGC 6 0.15 TruSeq Adapter, Index 6 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAA 10 0.0068343505 144.975 3 >>END_MODULE SRR22215329 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215329_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8825 37.0 37.0 37.0 37.0 37.0 2 36.202 37.0 37.0 37.0 37.0 37.0 3 36.179 37.0 37.0 37.0 37.0 37.0 4 36.074 37.0 37.0 37.0 37.0 37.0 5 36.0285 37.0 37.0 37.0 37.0 37.0 6 36.137 37.0 37.0 37.0 37.0 37.0 7 36.1565 37.0 37.0 37.0 37.0 37.0 8 36.2045 37.0 37.0 37.0 37.0 37.0 9 36.2595 37.0 37.0 37.0 37.0 37.0 10-14 36.158 37.0 37.0 37.0 37.0 37.0 15-19 36.079499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.115399999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.0153 37.0 37.0 37.0 37.0 37.0 30-34 35.997499999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.98960000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.9282 37.0 37.0 37.0 37.0 37.0 45-49 35.869899999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.8534 37.0 37.0 37.0 37.0 37.0 55-59 35.754 37.0 37.0 37.0 37.0 37.0 60-64 35.769400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.6668 37.0 37.0 37.0 37.0 37.0 70-74 35.6885 37.0 37.0 37.0 37.0 37.0 75-79 35.640499999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.625299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.5878 37.0 37.0 37.0 37.0 37.0 90-94 35.6009 37.0 37.0 37.0 37.0 37.0 95-99 35.63430000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.5662 37.0 37.0 37.0 37.0 37.0 105-109 35.583299999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.5253 37.0 37.0 37.0 37.0 37.0 115-119 35.428999999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.4392 37.0 37.0 37.0 37.0 37.0 125-129 35.3423 37.0 37.0 37.0 37.0 37.0 130-134 35.263999999999996 37.0 37.0 37.0 32.2 37.0 135-139 35.272800000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.2144 37.0 37.0 37.0 27.4 37.0 145-149 35.0865 37.0 37.0 37.0 25.0 37.0 150-151 34.997749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 3.0 21 0.0 22 3.0 23 7.0 24 10.0 25 12.0 26 19.0 27 22.0 28 27.0 29 27.0 30 31.0 31 61.0 32 67.0 33 116.0 34 222.0 35 712.0 36 2459.0 37 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.45 21.875 16.225 28.449999999999996 2 27.0 30.025000000000002 28.825 14.149999999999999 3 23.45 32.6 27.025 16.925 4 26.724999999999998 34.225 22.425 16.625 5 27.075 36.675000000000004 21.175 15.075 6 20.849999999999998 40.65 22.375 16.125 7 22.125 19.575 41.025 17.275 8 23.75 23.75 29.15 23.35 9 25.6 24.025 28.875 21.5 10-14 24.51 29.38 25.46 20.65 15-19 24.45 27.88 27.38 20.29 20-24 23.775 28.720000000000002 27.255000000000003 20.25 25-29 24.345 27.66 27.815 20.18 30-34 24.255 27.985 27.855 19.905 35-39 24.45 27.700000000000003 27.834999999999997 20.015 40-44 24.27 27.889999999999997 28.405 19.435 45-49 23.765 28.744999999999997 27.705000000000002 19.785 50-54 24.77 27.55 27.88 19.8 55-59 23.875 28.52 28.194999999999997 19.41 60-64 23.615 27.66 28.555000000000003 20.169999999999998 65-69 23.810000000000002 28.075 28.335 19.78 70-74 23.94 27.205000000000002 29.21 19.645000000000003 75-79 24.555 27.98 27.915 19.55 80-84 24.545 28.050000000000004 27.639999999999997 19.765 85-89 24.175 27.235 28.955 19.634999999999998 90-94 24.455 27.24 28.935 19.37 95-99 23.724999999999998 28.34 28.48 19.455 100-104 24.34 27.439999999999998 28.465 19.755 105-109 23.599999999999998 27.33 28.59 20.48 110-114 23.94 28.060000000000002 28.535 19.465 115-119 24.145 27.46 28.749999999999996 19.645000000000003 120-124 24.759999999999998 28.275 28.139999999999997 18.825 125-129 24.26 28.24 28.4 19.1 130-134 24.45 28.000000000000004 28.625 18.925 135-139 24.224999999999998 28.255000000000003 28.125 19.395 140-144 24.025 28.455000000000002 28.475 19.045 145-149 25.124999999999996 27.834999999999997 28.025 19.015 150-151 25.55 27.737499999999997 28.462500000000002 18.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 2.5 25 2.5 26 4.0 27 5.5 28 8.0 29 13.0 30 17.5 31 21.0 32 33.0 33 44.0 34 51.0 35 74.0 36 94.0 37 96.5 38 126.0 39 171.0 40 201.0 41 232.5 42 276.0 43 280.0 44 269.0 45 270.0 46 265.5 47 253.5 48 227.0 49 194.0 50 153.0 51 124.5 52 109.0 53 94.5 54 66.0 55 41.5 56 34.5 57 30.0 58 23.5 59 17.5 60 11.5 61 9.5 62 8.5 63 5.5 64 3.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 1.0 72 1.5 73 2.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.5 81 1.0 82 0.0 83 2.5 84 2.5 85 0.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.8322896814593 84.325 2 7.432616389872039 13.65 3 0.7350939286686632 2.025 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.9 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTAA 10 0.006830828 145.0 5 >>END_MODULE Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947513 spots for SRR22215329.sra Written 1947513 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra Read 1947498 spots for SRR22215329.sra Written 1947498 spots for SRR22215329.sra SRR ids: ['SRR22215329.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_weiq6aqh SRR22215329.sra spots: 38949975 blocks: [[1, 1947498], [1947499, 3894996], [3894997, 5842494], [5842495, 7789992], [7789993, 9737490], [9737491, 11684988], [11684989, 13632486], [13632487, 15579984], [15579985, 17527482], [17527483, 19474980], [19474981, 21422478], [21422479, 23369976], [23369977, 25317474], [25317475, 27264972], [27264973, 29212470], [29212471, 31159968], [31159969, 33107466], [33107467, 35054964], [35054965, 37002462], [37002463, 38949975]] SRR22215329 file size 13215205 SRR22215329 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215329 SRR22215329_1.fastq SRR22215329_2.fastq Input file: SRR22215329_1.fastq Paired file: SRR22215329_2.fastq trimmed: SRR22215329-trimmed-pair1.fastq, SRR22215329-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:06:01 2025 >> started Tue Feb 11 09:06:45 2025 >> done (43.558s) 38949975 read pairs processed; of these: 384 ( 0.00%) short read pairs filtered out after trimming by size control 139888 ( 0.36%) empty read pairs filtered out after trimming by size control 38809703 (99.64%) read pairs available; of these: 4173812 (10.75%) trimmed read pairs available after processing 34635891 (89.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 23 0.00% 20 3 0.00% 21 6 0.00% 22 9 0.00% 23 6 0.00% 24 4 0.00% 25 6 0.00% 26 6 0.00% 27 19 0.00% 28 10 0.00% 29 52 0.00% 30 11 0.00% 31 22 0.00% 32 13 0.00% 33 18 0.00% 34 12 0.00% 35 16 0.00% 36 16 0.00% 37 11 0.00% 38 17 0.00% 39 12 0.00% 40 17 0.00% 41 12 0.00% 42 15 0.00% 43 14 0.00% 44 24 0.00% 45 19 0.00% 46 33 0.00% 47 31 0.00% 48 38 0.00% 49 36 0.00% 50 39 0.00% 51 36 0.00% 52 38 0.00% 53 50 0.00% 54 48 0.00% 55 50 0.00% 56 49 0.00% 57 47 0.00% 58 47 0.00% 59 53 0.00% 60 49 0.00% 61 67 0.00% 62 51 0.00% 63 83 0.00% 64 74 0.00% 65 84 0.00% 66 72 0.00% 67 93 0.00% 68 110 0.00% 69 128 0.00% 70 132 0.00% 71 149 0.00% 72 182 0.00% 73 157 0.00% 74 212 0.00% 75 234 0.00% 76 297 0.00% 77 313 0.00% 78 359 0.00% 79 354 0.00% 80 404 0.00% 81 482 0.00% 82 510 0.00% 83 587 0.00% 84 660 0.00% 85 742 0.00% 86 874 0.00% 87 916 0.00% 88 1003 0.00% 89 1118 0.00% 90 1212 0.00% 91 1368 0.00% 92 1511 0.00% 93 1703 0.00% 94 1887 0.00% 95 1967 0.01% 96 2351 0.01% 97 2560 0.01% 98 2806 0.01% 99 3064 0.01% 100 3391 0.01% 101 3695 0.01% 102 3941 0.01% 103 4352 0.01% 104 4844 0.01% 105 5386 0.01% 106 5975 0.02% 107 6717 0.02% 108 7235 0.02% 109 8128 0.02% 110 9278 0.02% 111 10005 0.03% 112 11134 0.03% 113 12377 0.03% 114 13660 0.04% 115 15814 0.04% 116 17700 0.05% 117 19795 0.05% 118 22608 0.06% 119 25434 0.07% 120 28241 0.07% 121 31436 0.08% 122 35187 0.09% 123 38690 0.10% 124 43615 0.11% 125 48109 0.12% 126 53791 0.14% 127 60834 0.16% 128 67159 0.17% 129 72577 0.19% 130 80802 0.21% 131 87978 0.23% 132 94910 0.24% 133 101660 0.26% 134 109774 0.28% 135 118295 0.30% 136 125698 0.32% 137 135250 0.35% 138 145181 0.37% 139 157241 0.41% 140 165629 0.43% 141 174826 0.45% 142 184895 0.48% 143 190589 0.49% 144 197820 0.51% 145 206815 0.53% 146 215253 0.55% 147 224096 0.58% 148 233949 0.60% 149 243396 0.63% 150 256726 0.66% 151 34635891 89.25% 38809703 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=3.4 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=207.57 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.6 sequence=AAGCAAAGACAGACGGTCACATTTGATCCACAAAACACATCACTCGAAAATAAAGTCACGTCTGAAACAGGTATCAATGTATATCGCGTTTTTTCGAAGATGAATAGTATTGTTGTTCAGGGAATAAGCTTGCTACCAGCAACATCGACAACGAATCTATATCTCACATCATTTTTCTCAAGCCTCTCGAATGCTGTGTTGATATAATCCATTTTGATCACTTCAATCATGGAGGCCAATCCCTTTTCCTTGCAGAACTCAAGCATCTCCTCTGTCTCCTTCATGCTCCCTATGAAGCTCCCGGTGATTGACTTTCTCCCAAGCATAACCATAGGCGTAACAAACTGCAATGGGGCATTAATAACACCCATCAAGATCAGCTTGCCATCAAGCTTCAATAGAGAAAGGTAAGGCTCGAGAGGGTGAACCACAGGCACAGTATCGATGATATAGTCAAGTTGATCAGCAGCTTTTTGCATGCTTTCCACATCCGAGCTGACCAAGTATTCAT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.6 sequence=TGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=89.91 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=6.6 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTTATCTGTATTATCATTATT SRR22215329 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:07:26 Started mapping on | Feb 11 09:07:26 Finished on | Feb 11 09:10:49 Mapping speed, Million of reads per hour | 688.25 Number of input reads | 38809703 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 36882944 Uniquely mapped reads % | 95.04% Average mapped length | 298.03 Number of splices: Total | 28317911 Number of splices: Annotated (sjdb) | 27705698 Number of splices: GT/AG | 27893864 Number of splices: GC/AG | 335710 Number of splices: AT/AC | 29113 Number of splices: Non-canonical | 59224 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 681414 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 300623 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1245345 1245345 1245345 N_multimapping 681414 681414 681414 N_noFeature 1440625 36308933 1625454 N_ambiguous 569051 2021 178919 UnstrandedReadsAssigned:34873268 PositiveStrandReadsAssigned:571990 NegativeStrandReadsAssigned:35078571 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215329 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215329-trimmed-pair1.fastq SRR22215329-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,809,703 reads, 35,764,303 reads pseudoaligned [quant] estimated average fragment length: 193.985 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,270 rounds 52401 SRR22215329.ke.tsv 34699 SRR22215329.se.tsv 87100 total ==> SRR22215329.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.01 1780 27.8322 Potri.005G024800.1.v4.1 1035 842.015 874 29.62 Potri.004G059700.1.v4.1 961 768.015 84 3.12107 Potri.007G009000.2.v4.1 1416 1223.01 0 0 Potri.003G141000.2.v4.1 2943 2750.01 575 5.9666 Potri.016G087400.1.v4.1 270 82.1256 1828 635.173 Potri.015G069301.1.v4.1 564 371.053 0 0 Potri.010G195200.1.v4.1 1773 1580.01 80 1.44485 Potri.012G127500.1.v4.1 977 784.015 4202 152.942 ==> SRR22215329.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3431 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1024 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 150 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR22215329 completed mapping pipeline successfully