Starting /dee2/code/volunteer_pipeline.sh SRR22215330 current disk space = 3055803748352 free memory = 1481409412 SRR22215330 SRAfilesize 2bf6cfeb8892a17afcb8fae236f23af3 SRR22215330.sra SRR22215330.sra file validated SRR22215330 is paired end SRR22215330 is conventional basespace SRR22215330 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215330_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.92575 37.0 37.0 37.0 37.0 37.0 2 36.02375 37.0 37.0 37.0 37.0 37.0 3 36.2395 37.0 37.0 37.0 37.0 37.0 4 36.327 37.0 37.0 37.0 37.0 37.0 5 36.2925 37.0 37.0 37.0 37.0 37.0 6 36.3215 37.0 37.0 37.0 37.0 37.0 7 36.3215 37.0 37.0 37.0 37.0 37.0 8 36.1515 37.0 37.0 37.0 37.0 37.0 9 36.2835 37.0 37.0 37.0 37.0 37.0 10-14 36.2355 37.0 37.0 37.0 37.0 37.0 15-19 36.199 37.0 37.0 37.0 37.0 37.0 20-24 36.214600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.153600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0899 37.0 37.0 37.0 37.0 37.0 35-39 36.0242 37.0 37.0 37.0 37.0 37.0 40-44 35.9976 37.0 37.0 37.0 37.0 37.0 45-49 35.913599999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.9004 37.0 37.0 37.0 37.0 37.0 55-59 35.7864 37.0 37.0 37.0 37.0 37.0 60-64 35.7687 37.0 37.0 37.0 37.0 37.0 65-69 35.7259 37.0 37.0 37.0 37.0 37.0 70-74 35.776799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.8409 37.0 37.0 37.0 37.0 37.0 80-84 35.7299 37.0 37.0 37.0 37.0 37.0 85-89 35.7828 37.0 37.0 37.0 37.0 37.0 90-94 35.6594 37.0 37.0 37.0 37.0 37.0 95-99 35.69500000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.615899999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5606 37.0 37.0 37.0 37.0 37.0 110-114 35.50670000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.5974 37.0 37.0 37.0 37.0 37.0 120-124 35.44969999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.43 37.0 37.0 37.0 37.0 37.0 130-134 35.370999999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3828 37.0 37.0 37.0 34.6 37.0 140-144 35.272800000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.283500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.061 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 1.0 23 5.0 24 6.0 25 8.0 26 16.0 27 19.0 28 29.0 29 34.0 30 55.0 31 80.0 32 81.0 33 122.0 34 212.0 35 430.0 36 2700.0 37 198.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.530253577705246 11.69972382626161 17.951292995229725 33.818729600803415 2 31.555221637866264 15.552216378662658 29.07588279489106 23.816679188580014 3 27.55 21.15 23.849999999999998 27.450000000000003 4 26.55 27.075 21.099999999999998 25.275 5 26.575 32.775 22.825 17.825 6 19.45 35.375 24.224999999999998 20.95 7 13.125 30.099999999999998 37.1 19.675 8 16.225 27.325 31.424999999999997 25.025 9 18.3 24.5 33.475 23.724999999999998 10-14 19.485 32.12 26.619999999999997 21.775 15-19 19.63 30.145 28.000000000000004 22.225 20-24 19.495 30.955 26.924999999999997 22.625 25-29 18.91 30.55 27.63 22.91 30-34 19.62 30.975 27.18 22.225 35-39 19.48 30.075000000000003 27.439999999999998 23.005 40-44 19.03 30.654999999999998 27.395000000000003 22.919999999999998 45-49 19.05 29.955 28.04 22.955000000000002 50-54 18.865000000000002 30.875000000000004 26.900000000000002 23.36 55-59 19.365 30.080000000000002 27.644999999999996 22.91 60-64 19.615 30.035 27.200000000000003 23.150000000000002 65-69 19.665 30.645 26.76 22.93 70-74 19.99 29.134999999999998 27.265 23.61 75-79 20.25 29.099999999999998 27.51 23.14 80-84 20.005 29.225 27.534999999999997 23.235 85-89 20.169999999999998 29.12 27.195000000000004 23.515 90-94 19.77 29.725 27.565 22.939999999999998 95-99 20.19 29.485 27.189999999999998 23.135 100-104 20.3 29.395 27.005000000000003 23.3 105-109 20.685000000000002 28.95 26.93 23.435 110-114 19.869999999999997 29.64 27.045 23.445 115-119 20.015 29.104999999999997 27.634999999999998 23.244999999999997 120-124 20.51 28.305000000000003 27.875 23.31 125-129 20.505000000000003 29.095 26.76 23.64 130-134 20.645 28.845 27.284999999999997 23.225 135-139 20.665 29.365000000000002 27.495000000000005 22.475 140-144 21.315 28.810000000000002 26.615 23.26 145-149 21.990000000000002 29.255 26.02 22.735 150-151 21.512500000000003 28.3875 26.937499999999996 23.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 3.5 22 3.5 23 2.5 24 3.5 25 8.0 26 12.0 27 11.0 28 16.5 29 28.5 30 42.5 31 51.5 32 56.5 33 66.0 34 81.0 35 103.0 36 123.5 37 147.0 38 160.5 39 182.0 40 194.5 41 207.0 42 234.0 43 243.0 44 254.5 45 235.5 46 223.0 47 220.5 48 198.0 49 165.0 50 135.5 51 112.5 52 90.0 53 84.5 54 71.5 55 47.5 56 37.5 57 26.5 58 11.5 59 12.0 60 13.0 61 10.0 62 5.5 63 3.5 64 4.0 65 7.0 66 6.5 67 4.5 68 7.0 69 9.0 70 7.0 71 4.0 72 1.5 73 1.0 74 1.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.94022180146064 85.9 2 6.3565052745469295 11.75 3 0.5680281309169597 1.575 4 0.08114687584527995 0.3 5 0.027048958615093318 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027048958615093318 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 11 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCGCGTATGC 5 0.125 TruSeq Adapter, Index 11 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7625 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138-139 4.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATAC 10 0.006830828 145.0 3 ACCAATA 10 0.006830828 145.0 2 CAACATA 10 0.006830828 145.0 5 TCTTGGC 10 0.006830828 145.0 5 CACCAAT 10 0.006830828 145.0 1 GGCAGCT 10 0.006830828 145.0 9 >>END_MODULE SRR22215330 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215330_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.517 37.0 37.0 37.0 37.0 37.0 2 35.9825 37.0 37.0 37.0 37.0 37.0 3 35.9615 37.0 37.0 37.0 37.0 37.0 4 35.9615 37.0 37.0 37.0 37.0 37.0 5 35.9165 37.0 37.0 37.0 37.0 37.0 6 35.9115 37.0 37.0 37.0 37.0 37.0 7 35.936 37.0 37.0 37.0 37.0 37.0 8 36.015 37.0 37.0 37.0 37.0 37.0 9 36.0135 37.0 37.0 37.0 37.0 37.0 10-14 35.95119999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.8564 37.0 37.0 37.0 37.0 37.0 20-24 35.8612 37.0 37.0 37.0 37.0 37.0 25-29 35.7166 37.0 37.0 37.0 37.0 37.0 30-34 35.6487 37.0 37.0 37.0 37.0 37.0 35-39 35.64820000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.617200000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.5975 37.0 37.0 37.0 37.0 37.0 50-54 35.5575 37.0 37.0 37.0 37.0 37.0 55-59 35.423899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.4181 37.0 37.0 37.0 37.0 37.0 65-69 35.4326 37.0 37.0 37.0 37.0 37.0 70-74 35.44070000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.4552 37.0 37.0 37.0 37.0 37.0 80-84 35.265100000000004 37.0 37.0 37.0 34.6 37.0 85-89 35.394600000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.3108 37.0 37.0 37.0 37.0 37.0 95-99 35.2727 37.0 37.0 37.0 34.6 37.0 100-104 35.2832 37.0 37.0 37.0 34.6 37.0 105-109 35.211800000000004 37.0 37.0 37.0 29.8 37.0 110-114 35.1929 37.0 37.0 37.0 29.8 37.0 115-119 35.121900000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.9858 37.0 37.0 37.0 25.0 37.0 125-129 35.035 37.0 37.0 37.0 25.0 37.0 130-134 34.9657 37.0 37.0 37.0 25.0 37.0 135-139 34.971199999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.7967 37.0 37.0 37.0 25.0 37.0 145-149 34.7629 37.0 37.0 37.0 25.0 37.0 150-151 34.67975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 4.0 17 2.0 18 1.0 19 2.0 20 2.0 21 5.0 22 5.0 23 10.0 24 21.0 25 22.0 26 22.0 27 22.0 28 32.0 29 35.0 30 53.0 31 68.0 32 92.0 33 131.0 34 258.0 35 772.0 36 2240.0 37 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.175 20.625 17.825 29.375 2 29.425 27.05 29.65 13.875000000000002 3 21.625 31.900000000000002 30.2 16.275000000000002 4 26.325 32.95 22.35 18.375 5 26.5 35.9 22.45 15.15 6 20.825 40.375 22.025 16.775000000000002 7 21.475 18.0 41.8 18.725 8 23.95 23.150000000000002 29.099999999999998 23.799999999999997 9 24.375 24.15 28.199999999999996 23.275000000000002 10-14 24.615000000000002 28.59 26.490000000000002 20.305 15-19 24.135 28.205000000000002 27.665 19.994999999999997 20-24 23.82 28.23 27.900000000000002 20.05 25-29 24.615000000000002 27.625 27.855 19.905 30-34 23.71 28.294999999999998 28.08 19.915 35-39 23.925 28.51 27.860000000000003 19.705000000000002 40-44 24.33 28.720000000000002 27.83 19.12 45-49 24.325 27.900000000000002 27.750000000000004 20.025000000000002 50-54 23.97 27.560000000000002 28.37 20.1 55-59 24.285 27.51 28.249999999999996 19.955000000000002 60-64 23.77 27.88 28.595 19.755 65-69 24.02 27.235 28.52 20.225 70-74 23.455000000000002 27.839999999999996 28.804999999999996 19.900000000000002 75-79 24.48 27.900000000000002 28.610000000000003 19.009999999999998 80-84 24.044999999999998 27.345000000000002 28.945 19.665 85-89 24.035 28.4 27.950000000000003 19.615 90-94 23.48 27.065 28.925 20.53 95-99 23.595 27.83 29.470000000000002 19.105 100-104 24.15 27.79 28.53 19.53 105-109 23.02 28.294999999999998 28.925 19.759999999999998 110-114 23.865 27.450000000000003 29.415000000000003 19.27 115-119 24.335 27.92 28.599999999999998 19.145 120-124 24.275 27.325 29.165000000000003 19.235 125-129 24.11 27.33 29.645 18.915000000000003 130-134 24.58 27.36 29.13 18.93 135-139 24.43 27.74 28.999999999999996 18.83 140-144 24.125 27.639999999999997 29.185 19.05 145-149 25.019999999999996 28.360000000000003 28.175 18.445 150-151 24.9125 27.700000000000003 28.299999999999997 19.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 2.5 22 3.5 23 1.5 24 1.0 25 2.5 26 3.5 27 5.5 28 10.5 29 14.5 30 18.0 31 30.0 32 43.5 33 50.5 34 65.5 35 91.5 36 107.5 37 124.5 38 150.5 39 177.5 40 203.0 41 236.0 42 240.5 43 245.0 44 267.5 45 263.0 46 246.5 47 226.5 48 212.0 49 193.0 50 158.0 51 112.5 52 95.5 53 91.0 54 67.0 55 44.5 56 28.5 57 25.0 58 28.0 59 20.5 60 13.0 61 8.0 62 6.0 63 7.0 64 4.0 65 3.5 66 4.5 67 2.5 68 1.0 69 1.0 70 0.5 71 0.0 72 1.5 73 2.5 74 1.0 75 0.5 76 1.0 77 1.5 78 1.0 79 0.5 80 0.5 81 1.0 82 1.0 83 1.0 84 2.0 85 1.0 86 1.0 87 1.5 88 1.0 89 1.5 90 2.5 91 1.5 92 0.5 93 1.0 94 0.5 95 0.5 96 2.5 97 2.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.11272531611515 86.52499999999999 2 6.2953995157385 11.700000000000001 3 0.48426150121065376 1.35 4 0.08071025020177562 0.3 5 0.026903416733925208 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.275 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCAAG 10 0.006830828 145.0 5 TTTTTTT 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716541 spots for SRR22215330.sra Written 1716541 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra Read 1716533 spots for SRR22215330.sra Written 1716533 spots for SRR22215330.sra SRR ids: ['SRR22215330.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmp_l313 SRR22215330.sra spots: 34330668 blocks: [[1, 1716533], [1716534, 3433066], [3433067, 5149599], [5149600, 6866132], [6866133, 8582665], [8582666, 10299198], [10299199, 12015731], [12015732, 13732264], [13732265, 15448797], [15448798, 17165330], [17165331, 18881863], [18881864, 20598396], [20598397, 22314929], [22314930, 24031462], [24031463, 25747995], [25747996, 27464528], [27464529, 29181061], [29181062, 30897594], [30897595, 32614127], [32614128, 34330668]] SRR22215330 file size 11645362 SRR22215330 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215330 SRR22215330_1.fastq SRR22215330_2.fastq Input file: SRR22215330_1.fastq Paired file: SRR22215330_2.fastq trimmed: SRR22215330-trimmed-pair1.fastq, SRR22215330-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:20:24 2025 >> started Tue Feb 11 08:21:02 2025 >> done (38.303s) 34330668 read pairs processed; of these: 339 ( 0.00%) short read pairs filtered out after trimming by size control 121616 ( 0.35%) empty read pairs filtered out after trimming by size control 34208713 (99.64%) read pairs available; of these: 3255070 ( 9.52%) trimmed read pairs available after processing 30953643 (90.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 7 0.00% 21 9 0.00% 22 5 0.00% 23 3 0.00% 24 4 0.00% 25 10 0.00% 26 4 0.00% 27 13 0.00% 28 8 0.00% 29 32 0.00% 30 8 0.00% 31 18 0.00% 32 7 0.00% 33 16 0.00% 34 11 0.00% 35 13 0.00% 36 9 0.00% 37 6 0.00% 38 8 0.00% 39 13 0.00% 40 12 0.00% 41 14 0.00% 42 11 0.00% 43 14 0.00% 44 17 0.00% 45 13 0.00% 46 16 0.00% 47 11 0.00% 48 23 0.00% 49 31 0.00% 50 20 0.00% 51 28 0.00% 52 18 0.00% 53 27 0.00% 54 33 0.00% 55 29 0.00% 56 28 0.00% 57 27 0.00% 58 53 0.00% 59 30 0.00% 60 32 0.00% 61 42 0.00% 62 33 0.00% 63 34 0.00% 64 56 0.00% 65 38 0.00% 66 60 0.00% 67 66 0.00% 68 63 0.00% 69 73 0.00% 70 92 0.00% 71 105 0.00% 72 100 0.00% 73 136 0.00% 74 116 0.00% 75 156 0.00% 76 143 0.00% 77 190 0.00% 78 229 0.00% 79 228 0.00% 80 272 0.00% 81 303 0.00% 82 333 0.00% 83 398 0.00% 84 433 0.00% 85 510 0.00% 86 583 0.00% 87 600 0.00% 88 680 0.00% 89 755 0.00% 90 827 0.00% 91 890 0.00% 92 1014 0.00% 93 1201 0.00% 94 1242 0.00% 95 1447 0.00% 96 1590 0.00% 97 1796 0.01% 98 2006 0.01% 99 2095 0.01% 100 2371 0.01% 101 2676 0.01% 102 2709 0.01% 103 3172 0.01% 104 3484 0.01% 105 3938 0.01% 106 4355 0.01% 107 4889 0.01% 108 5275 0.02% 109 5940 0.02% 110 6543 0.02% 111 7079 0.02% 112 8017 0.02% 113 8996 0.03% 114 10075 0.03% 115 11276 0.03% 116 12709 0.04% 117 14295 0.04% 118 16060 0.05% 119 18094 0.05% 120 20498 0.06% 121 23054 0.07% 122 25792 0.08% 123 28350 0.08% 124 32035 0.09% 125 35561 0.10% 126 39700 0.12% 127 43790 0.13% 128 49445 0.14% 129 54122 0.16% 130 60046 0.18% 131 65298 0.19% 132 70873 0.21% 133 76890 0.22% 134 83380 0.24% 135 90721 0.27% 136 97499 0.29% 137 105695 0.31% 138 112994 0.33% 139 121858 0.36% 140 128852 0.38% 141 136700 0.40% 142 146048 0.43% 143 150925 0.44% 144 158636 0.46% 145 167324 0.49% 146 173446 0.51% 147 181534 0.53% 148 190121 0.56% 149 198612 0.58% 150 211681 0.62% 151 30953643 90.48% 34208713 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.8 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=467.02 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.9 sequence=ATCATCAACTATGAACATTTAATACATGAAGCGCAACCCAAAAAACAGACAATGGAGGAGGCAAATCGATGTAGAGATCTAGGCATTCACATGTATAGGATGGTCACATCACACATTAAAGCAAGCTCACTTGTAGGTCCCCATACCCACACCAACATCTCCACCGTATGGCTGGAAGCTGTCACTGGCCTTGGAATAGCAAATATAGTAGAGCTCGGACACTATGGCTGTGAACAAAGTAAAAGCAGCTCCTGCCCCAAAAACTCCCTTCCTCAATGATGGGCAATCCAGGGTTTCACCGAAAAAATTCTTGTACCTGGTGTGGTAGGCATTCCTTACTGAACCCGCAAGCAAGCATATCTCAGCAATGAAGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.17 fanout-score-rank=15 prefix-density=0.27 prefix-fanout=4.2 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=39 fanout-score=122.27 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.7 sequence=TGCAGCTGCAGAATACCAGCCTCATGGATTTGGTACCAGCGGAGGGAAACTTACGGGGCAGAAGGAAGTTGCTGCTTTCCTTGGGCATGTTGGAAGCAAAACCTCATGTGGTTATGGAGTGGCCACTGGAGGACCATTGGCATGGGGTTTGTGCTACAACAAGGAAATGAGTCCCAGCAAGACATACTGCGATGATTACTACAAGTACACCTATCCTTGCACTCCCGGAGTTTCGTATCACGGCAGGGGTGCGCTGCCTCTTTACTGGAACTACAACTATGGCAAAACTGGGGAAGCCCTGAAGACTGATCTGTTGAACCATCCAGAATACCTCGAAAACAATGCTACACTAGCTTTCCAGGCTGCTATTTGGAAGTGGATGACACCAGAAAAGAAGCATCTCCCTTCAGCACACGATGTATTTGTTGGCAAATGGAAACCTACCAAGAATGACACTTTGGCCAAGAGGGTACCTGGATTTGGCACCACCATGAATGTTCTGTATGGGGAT SRR22215330 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:21:45 Started mapping on | Feb 11 08:21:45 Finished on | Feb 11 08:24:39 Mapping speed, Million of reads per hour | 707.77 Number of input reads | 34208713 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 32450249 Uniquely mapped reads % | 94.86% Average mapped length | 298.28 Number of splices: Total | 24070202 Number of splices: Annotated (sjdb) | 23541036 Number of splices: GT/AG | 23698802 Number of splices: GC/AG | 289301 Number of splices: AT/AC | 28352 Number of splices: Non-canonical | 53747 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.19 Insertion rate per base | 0.02% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 649706 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 260373 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1108758 1108758 1108758 N_multimapping 649706 649706 649706 N_noFeature 1228763 31963274 1377706 N_ambiguous 482685 1994 143549 UnstrandedReadsAssigned:30738801 PositiveStrandReadsAssigned:484981 NegativeStrandReadsAssigned:30928994 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215330 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215330-trimmed-pair1.fastq SRR22215330-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,208,713 reads, 31,575,367 reads pseudoaligned [quant] estimated average fragment length: 196.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,339 rounds 52401 SRR22215330.ke.tsv 34699 SRR22215330.se.tsv 87100 total ==> SRR22215330.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.94 1436 24.534 Potri.005G024800.1.v4.1 1035 839.935 354 13.1263 Potri.004G059700.1.v4.1 961 765.935 34 1.38252 Potri.007G009000.2.v4.1 1416 1220.94 0 0 Potri.003G141000.2.v4.1 2943 2747.94 541.139 6.1332 Potri.016G087400.1.v4.1 270 80.2998 2152.89 835.008 Potri.015G069301.1.v4.1 564 368.993 0 0 Potri.010G195200.1.v4.1 1773 1577.94 137 2.70406 Potri.012G127500.1.v4.1 977 781.935 6371 253.759 ==> SRR22215330.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3121 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 717 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22215330 completed mapping pipeline successfully