Starting /dee2/code/volunteer_pipeline.sh SRR22215331 current disk space = 3055874646016 free memory = 1149850444 SRR22215331 SRAfilesize 71e6fc2218419069decba7e7ff4fde5a SRR22215331.sra SRR22215331.sra file validated SRR22215331 is paired end SRR22215331 is conventional basespace SRR22215331 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215331_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.98425 37.0 37.0 37.0 37.0 37.0 2 35.9365 37.0 37.0 37.0 37.0 37.0 3 36.2 37.0 37.0 37.0 37.0 37.0 4 36.155 37.0 37.0 37.0 37.0 37.0 5 36.193 37.0 37.0 37.0 37.0 37.0 6 36.202 37.0 37.0 37.0 37.0 37.0 7 36.1995 37.0 37.0 37.0 37.0 37.0 8 36.192 37.0 37.0 37.0 37.0 37.0 9 36.1935 37.0 37.0 37.0 37.0 37.0 10-14 36.2402 37.0 37.0 37.0 37.0 37.0 15-19 36.15259999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.209199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.134 37.0 37.0 37.0 37.0 37.0 30-34 35.983799999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.9294 37.0 37.0 37.0 37.0 37.0 40-44 35.8834 37.0 37.0 37.0 37.0 37.0 45-49 35.81179999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.7615 37.0 37.0 37.0 37.0 37.0 55-59 35.646499999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.5792 37.0 37.0 37.0 37.0 37.0 65-69 35.5588 37.0 37.0 37.0 37.0 37.0 70-74 35.5503 37.0 37.0 37.0 37.0 37.0 75-79 35.6742 37.0 37.0 37.0 37.0 37.0 80-84 35.626799999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.5848 37.0 37.0 37.0 37.0 37.0 90-94 35.5101 37.0 37.0 37.0 37.0 37.0 95-99 35.4764 37.0 37.0 37.0 37.0 37.0 100-104 35.46470000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.37779999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.4079 37.0 37.0 37.0 37.0 37.0 115-119 35.3984 37.0 37.0 37.0 34.6 37.0 120-124 35.2282 37.0 37.0 37.0 32.2 37.0 125-129 35.2318 37.0 37.0 37.0 32.2 37.0 130-134 35.2336 37.0 37.0 37.0 32.2 37.0 135-139 35.183299999999996 37.0 37.0 37.0 29.8 37.0 140-144 35.0767 37.0 37.0 37.0 25.0 37.0 145-149 35.023999999999994 37.0 37.0 37.0 25.0 37.0 150-151 34.732749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 1.0 23 2.0 24 7.0 25 12.0 26 18.0 27 22.0 28 30.0 29 40.0 30 62.0 31 89.0 32 120.0 33 153.0 34 228.0 35 475.0 36 2599.0 37 140.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.74956041195679 11.27857322280834 19.09068073348405 32.88118563175082 2 32.41482965931864 14.453907815631261 30.285571142284567 22.84569138276553 3 26.775 21.15 25.2 26.875 4 29.125 25.45 21.2 24.224999999999998 5 27.950000000000003 29.325000000000003 23.3 19.425 6 18.575 33.074999999999996 26.974999999999998 21.375 7 14.025000000000002 31.7 37.125 17.150000000000002 8 16.925 28.775000000000002 31.8 22.5 9 18.25 24.275 33.2 24.275 10-14 18.56 32.235 27.205000000000002 22.0 15-19 19.650000000000002 29.94 28.205000000000002 22.205 20-24 19.07 30.37 28.225 22.335 25-29 19.34 29.645 27.99 23.025000000000002 30-34 18.47 30.7 27.805000000000003 23.025000000000002 35-39 19.035 30.19 27.195000000000004 23.580000000000002 40-44 19.095000000000002 30.19 27.415 23.3 45-49 19.665 29.825000000000003 27.72 22.79 50-54 19.095000000000002 30.11 27.345000000000002 23.45 55-59 19.41 29.654999999999998 27.82 23.115 60-64 19.625 29.92 27.365000000000002 23.09 65-69 19.994999999999997 29.885 27.055 23.064999999999998 70-74 20.21 29.915000000000003 27.47 22.405 75-79 20.345 29.744999999999997 26.82 23.09 80-84 20.335 29.4 27.155 23.11 85-89 20.44 29.32 26.979999999999997 23.26 90-94 19.765 29.494999999999997 27.115000000000002 23.625 95-99 20.080000000000002 29.044999999999998 27.634999999999998 23.24 100-104 20.294999999999998 29.835 27.034999999999997 22.835 105-109 19.575 28.76 27.705000000000002 23.96 110-114 20.085 29.925 26.32 23.669999999999998 115-119 20.505000000000003 29.015 26.955000000000002 23.525 120-124 20.31 29.470000000000002 27.029999999999998 23.189999999999998 125-129 21.165 29.035 26.950000000000003 22.85 130-134 21.265 29.225 26.505000000000003 23.005 135-139 20.45 29.439999999999998 27.365000000000002 22.745 140-144 21.19 28.92 26.71 23.18 145-149 22.375 28.735 26.015 22.875 150-151 21.65 29.262500000000003 25.75 23.3375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 2.0 20 5.0 21 5.0 22 2.5 23 1.0 24 2.0 25 5.5 26 12.0 27 21.0 28 31.0 29 31.5 30 36.5 31 59.0 32 67.5 33 78.0 34 101.0 35 104.5 36 109.5 37 132.0 38 145.5 39 167.0 40 192.0 41 200.5 42 245.5 43 260.0 44 234.0 45 217.0 46 202.0 47 200.5 48 180.0 49 157.5 50 144.5 51 125.5 52 106.0 53 89.5 54 68.0 55 51.5 56 38.0 57 23.0 58 19.5 59 16.0 60 10.5 61 9.5 62 11.0 63 7.0 64 3.0 65 4.5 66 6.0 67 4.5 68 2.0 69 3.5 70 9.0 71 12.5 72 8.5 73 4.0 74 3.0 75 2.0 76 0.5 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.76920973475526 83.89999999999999 2 7.5198249931637955 13.750000000000002 3 0.5742411812961444 1.575 4 0.05468963631391851 0.2 5 0.027344818156959255 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027344818156959255 0.2 9 0.0 0.0 >10 0.027344818156959255 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCGCATCTCGTAT 10 0.25 TruSeq Adapter, Index 16 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCGCATCGCGTAT 8 0.2 TruSeq Adapter, Index 16 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCGCATCGCGTTT 5 0.125 TruSeq Adapter, Index 16 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.8999999999999999 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 3.225 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 85-89 >>END_MODULE SRR22215331 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215331_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8725 37.0 37.0 37.0 37.0 37.0 2 36.195 37.0 37.0 37.0 37.0 37.0 3 36.108 37.0 37.0 37.0 37.0 37.0 4 36.066 37.0 37.0 37.0 37.0 37.0 5 36.0265 37.0 37.0 37.0 37.0 37.0 6 36.028 37.0 37.0 37.0 37.0 37.0 7 36.1015 37.0 37.0 37.0 37.0 37.0 8 36.077 37.0 37.0 37.0 37.0 37.0 9 36.176 37.0 37.0 37.0 37.0 37.0 10-14 36.0168 37.0 37.0 37.0 37.0 37.0 15-19 35.983000000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.96660000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.7782 37.0 37.0 37.0 37.0 37.0 30-34 35.7767 37.0 37.0 37.0 37.0 37.0 35-39 35.7442 37.0 37.0 37.0 37.0 37.0 40-44 35.7441 37.0 37.0 37.0 37.0 37.0 45-49 35.693799999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.670100000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.6028 37.0 37.0 37.0 37.0 37.0 60-64 35.60530000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.4926 37.0 37.0 37.0 37.0 37.0 70-74 35.4644 37.0 37.0 37.0 37.0 37.0 75-79 35.5216 37.0 37.0 37.0 37.0 37.0 80-84 35.459900000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.4611 37.0 37.0 37.0 37.0 37.0 90-94 35.4371 37.0 37.0 37.0 37.0 37.0 95-99 35.417899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.416700000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.403499999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.3534 37.0 37.0 37.0 37.0 37.0 115-119 35.31529999999999 37.0 37.0 37.0 34.6 37.0 120-124 35.2199 37.0 37.0 37.0 29.8 37.0 125-129 35.1352 37.0 37.0 37.0 27.4 37.0 130-134 35.1106 37.0 37.0 37.0 25.0 37.0 135-139 35.147099999999995 37.0 37.0 37.0 27.4 37.0 140-144 34.9371 37.0 37.0 37.0 25.0 37.0 145-149 34.8852 37.0 37.0 37.0 25.0 37.0 150-151 34.774249999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 3.0 20 2.0 21 3.0 22 7.0 23 17.0 24 11.0 25 18.0 26 23.0 27 41.0 28 22.0 29 29.0 30 46.0 31 56.0 32 88.0 33 121.0 34 243.0 35 671.0 36 2386.0 37 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.45 22.025 16.1 28.425 2 28.549999999999997 28.65 28.675 14.124999999999998 3 24.625 32.275 26.35 16.75 4 26.200000000000003 36.875 21.275 15.65 5 27.500000000000004 36.15 22.025 14.325 6 21.675 39.625 23.3 15.4 7 21.6 19.825 38.875 19.7 8 23.025000000000002 24.975 28.749999999999996 23.25 9 25.95 23.175 29.675 21.2 10-14 24.625 28.1 26.66 20.615 15-19 24.81 27.925 27.72 19.545 20-24 24.865000000000002 27.845 27.675 19.615 25-29 24.72 28.03 27.755000000000003 19.495 30-34 24.465 28.360000000000003 27.365000000000002 19.81 35-39 23.855 27.834999999999997 28.675 19.634999999999998 40-44 23.580000000000002 28.000000000000004 28.34 20.080000000000002 45-49 24.85 27.52 27.66 19.97 50-54 23.915 27.83 28.43 19.825 55-59 23.735 27.955000000000002 28.360000000000003 19.950000000000003 60-64 23.835 27.87 28.199999999999996 20.095 65-69 24.19 27.97 28.275 19.564999999999998 70-74 23.46 27.805000000000003 28.76 19.975 75-79 24.62 27.224999999999998 28.804999999999996 19.35 80-84 24.310000000000002 27.625 28.43 19.634999999999998 85-89 23.885 27.3 29.015 19.8 90-94 24.29 27.450000000000003 28.410000000000004 19.85 95-99 23.785 27.68 29.099999999999998 19.435 100-104 23.724999999999998 27.68 29.38 19.215 105-109 23.885 28.055000000000003 28.815 19.245 110-114 23.555 27.994999999999997 28.95 19.5 115-119 24.445 27.415 28.910000000000004 19.23 120-124 24.55 27.925 28.74 18.785 125-129 24.19 27.6 29.14 19.07 130-134 24.21 28.065 28.605000000000004 19.12 135-139 24.645 27.905 28.435 19.015 140-144 24.32 28.294999999999998 28.185 19.2 145-149 25.314999999999998 27.950000000000003 28.065 18.67 150-151 25.124999999999996 28.712500000000002 27.962500000000002 18.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.5 20 2.0 21 1.0 22 2.0 23 3.5 24 3.0 25 3.0 26 6.5 27 10.5 28 14.0 29 17.5 30 26.0 31 26.5 32 29.0 33 44.5 34 63.0 35 75.0 36 99.0 37 128.0 38 160.5 39 189.5 40 179.5 41 187.0 42 237.0 43 268.5 44 265.0 45 260.5 46 259.0 47 233.5 48 206.5 49 192.5 50 157.5 51 133.0 52 113.5 53 79.5 54 63.5 55 49.0 56 35.0 57 28.0 58 19.0 59 15.5 60 13.0 61 11.0 62 9.5 63 8.5 64 7.0 65 5.0 66 3.0 67 3.0 68 3.0 69 3.0 70 2.0 71 0.5 72 0.5 73 0.5 74 0.5 75 1.5 76 2.0 77 0.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.5 86 1.5 87 1.0 88 1.0 89 1.5 90 2.0 91 3.0 92 2.5 93 2.0 94 3.0 95 3.5 96 2.0 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.50743846361915 85.5 2 6.84338652961861 12.65 3 0.5950770895320531 1.6500000000000001 4 0.054097917230186636 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.8999999999999999 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 4.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 60 0.004491891 14.500001 95-99 >>END_MODULE Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606383 spots for SRR22215331.sra Written 1606383 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra Read 1606374 spots for SRR22215331.sra Written 1606374 spots for SRR22215331.sra SRR ids: ['SRR22215331.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aum3mjqi SRR22215331.sra spots: 32127489 blocks: [[1, 1606374], [1606375, 3212748], [3212749, 4819122], [4819123, 6425496], [6425497, 8031870], [8031871, 9638244], [9638245, 11244618], [11244619, 12850992], [12850993, 14457366], [14457367, 16063740], [16063741, 17670114], [17670115, 19276488], [19276489, 20882862], [20882863, 22489236], [22489237, 24095610], [24095611, 25701984], [25701985, 27308358], [27308359, 28914732], [28914733, 30521106], [30521107, 32127489]] SRR22215331 file size 10896625 SRR22215331 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215331 SRR22215331_1.fastq SRR22215331_2.fastq Input file: SRR22215331_1.fastq Paired file: SRR22215331_2.fastq trimmed: SRR22215331-trimmed-pair1.fastq, SRR22215331-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:03:44 2025 >> started Tue Feb 11 08:04:20 2025 >> done (36.105s) 32127489 read pairs processed; of these: 398 ( 0.00%) short read pairs filtered out after trimming by size control 203594 ( 0.63%) empty read pairs filtered out after trimming by size control 31923497 (99.37%) read pairs available; of these: 3618392 (11.33%) trimmed read pairs available after processing 28305105 (88.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 24 0.00% 20 8 0.00% 21 11 0.00% 22 11 0.00% 23 8 0.00% 24 3 0.00% 25 10 0.00% 26 3 0.00% 27 26 0.00% 28 17 0.00% 29 77 0.00% 30 12 0.00% 31 23 0.00% 32 18 0.00% 33 5 0.00% 34 17 0.00% 35 18 0.00% 36 17 0.00% 37 9 0.00% 38 13 0.00% 39 10 0.00% 40 16 0.00% 41 18 0.00% 42 19 0.00% 43 24 0.00% 44 17 0.00% 45 25 0.00% 46 34 0.00% 47 23 0.00% 48 33 0.00% 49 43 0.00% 50 41 0.00% 51 42 0.00% 52 39 0.00% 53 33 0.00% 54 52 0.00% 55 40 0.00% 56 55 0.00% 57 37 0.00% 58 41 0.00% 59 43 0.00% 60 58 0.00% 61 53 0.00% 62 47 0.00% 63 60 0.00% 64 58 0.00% 65 77 0.00% 66 82 0.00% 67 77 0.00% 68 86 0.00% 69 105 0.00% 70 89 0.00% 71 114 0.00% 72 101 0.00% 73 129 0.00% 74 150 0.00% 75 180 0.00% 76 196 0.00% 77 215 0.00% 78 214 0.00% 79 266 0.00% 80 321 0.00% 81 301 0.00% 82 369 0.00% 83 393 0.00% 84 479 0.00% 85 566 0.00% 86 596 0.00% 87 617 0.00% 88 716 0.00% 89 779 0.00% 90 840 0.00% 91 956 0.00% 92 1065 0.00% 93 1165 0.00% 94 1354 0.00% 95 1574 0.00% 96 1713 0.01% 97 1762 0.01% 98 2066 0.01% 99 2193 0.01% 100 2408 0.01% 101 2709 0.01% 102 2993 0.01% 103 3334 0.01% 104 3772 0.01% 105 4344 0.01% 106 4850 0.02% 107 5351 0.02% 108 6019 0.02% 109 6802 0.02% 110 7709 0.02% 111 8458 0.03% 112 9510 0.03% 113 10785 0.03% 114 12022 0.04% 115 13839 0.04% 116 15772 0.05% 117 17825 0.06% 118 20419 0.06% 119 23134 0.07% 120 25287 0.08% 121 29001 0.09% 122 32119 0.10% 123 35376 0.11% 124 39937 0.13% 125 43846 0.14% 126 48279 0.15% 127 53880 0.17% 128 60101 0.19% 129 65833 0.21% 130 72182 0.23% 131 78494 0.25% 132 84160 0.26% 133 90234 0.28% 134 96819 0.30% 135 104051 0.33% 136 112009 0.35% 137 119653 0.37% 138 127326 0.40% 139 136558 0.43% 140 143822 0.45% 141 149941 0.47% 142 157727 0.49% 143 163481 0.51% 144 170837 0.54% 145 176524 0.55% 146 182895 0.57% 147 190171 0.60% 148 198599 0.62% 149 206880 0.65% 150 217109 0.68% 151 28305105 88.67% 31923497 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.0 sequence=TATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=364.18 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.8 sequence=ATCATCAACTATGAACATTTAATACATGAAGCGCAACCCAAAAAACAGACAATGGAGGAGGCAAATCGATGTAGAGATCTAGGCATTCACATGTATAGGATGGTCACATCACACATTAAAGCAAGCTCACTTGTAGGTCCCCATACCCACACCAACATCTCCACCGTATGGCTGGAAGCTGTCACTGGCCTTGGAATAGCAAATATAGTAGAGCTCGGACACTATGGCTGTGAACAAAGTAAAAGCAGCTCCTGCCCCAAAAACTCCCTTCCTCAATGATGGGCAATCCAGGGTTTCACCGAAAAAATTCTTGTACCTGGTGTGGTAGGCATTCCTTACTGAACCCGCAAGCAAGCATATCTCAGCAATGAAGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.90 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=4.5 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=91.06 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=16.3 sequence=TTGAAGATGGAA SRR22215331 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:05:02 Started mapping on | Feb 11 08:05:03 Finished on | Feb 11 08:08:08 Mapping speed, Million of reads per hour | 621.21 Number of input reads | 31923497 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 30141511 Uniquely mapped reads % | 94.42% Average mapped length | 297.72 Number of splices: Total | 21202044 Number of splices: Annotated (sjdb) | 20721470 Number of splices: GT/AG | 20877323 Number of splices: GC/AG | 247601 Number of splices: AT/AC | 26332 Number of splices: Non-canonical | 50788 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.22 Insertion rate per base | 0.02% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621368 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 277854 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1160618 1160618 1160618 N_multimapping 621368 621368 621368 N_noFeature 1145487 29649112 1284467 N_ambiguous 492545 1923 138241 UnstrandedReadsAssigned:28503479 PositiveStrandReadsAssigned:490476 NegativeStrandReadsAssigned:28718803 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215331 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215331-trimmed-pair1.fastq SRR22215331-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,923,497 reads, 29,366,078 reads pseudoaligned [quant] estimated average fragment length: 193.441 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR22215331.ke.tsv 34699 SRR22215331.se.tsv 87100 total ==> SRR22215331.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.56 1184 21.0524 Potri.005G024800.1.v4.1 1035 842.559 349 13.4453 Potri.004G059700.1.v4.1 961 768.565 59 2.49183 Potri.007G009000.2.v4.1 1416 1223.56 0 0 Potri.003G141000.2.v4.1 2943 2750.56 478 5.64096 Potri.016G087400.1.v4.1 270 82.3964 2332 918.685 Potri.015G069301.1.v4.1 564 371.631 0 0 Potri.010G195200.1.v4.1 1773 1580.56 101 2.07423 Potri.012G127500.1.v4.1 977 784.565 4682 193.709 ==> SRR22215331.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2998 Potri.001G233950.v4.1 12 Potri.001G122700.v4.1 668 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 129 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR22215331 completed mapping pipeline successfully