Starting /dee2/code/volunteer_pipeline.sh SRR22215332 current disk space = 3055730012160 free memory = 1021775092 SRR22215332 SRAfilesize b2fbc692ca0bfa41667ce25bb1eb90f6 SRR22215332.sra SRR22215332.sra file validated SRR22215332 is paired end SRR22215332 is conventional basespace SRR22215332 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215332_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9655 37.0 37.0 37.0 37.0 37.0 2 35.98025 37.0 37.0 37.0 37.0 37.0 3 36.238 37.0 37.0 37.0 37.0 37.0 4 36.2655 37.0 37.0 37.0 37.0 37.0 5 36.321 37.0 37.0 37.0 37.0 37.0 6 36.402 37.0 37.0 37.0 37.0 37.0 7 36.1635 37.0 37.0 37.0 37.0 37.0 8 36.167 37.0 37.0 37.0 37.0 37.0 9 36.284 37.0 37.0 37.0 37.0 37.0 10-14 36.2689 37.0 37.0 37.0 37.0 37.0 15-19 36.241200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.158 37.0 37.0 37.0 37.0 37.0 25-29 36.115899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0575 37.0 37.0 37.0 37.0 37.0 35-39 35.971199999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9644 37.0 37.0 37.0 37.0 37.0 45-49 35.932500000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.874399999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.822500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.7891 37.0 37.0 37.0 37.0 37.0 65-69 35.793 37.0 37.0 37.0 37.0 37.0 70-74 35.809 37.0 37.0 37.0 37.0 37.0 75-79 35.7695 37.0 37.0 37.0 37.0 37.0 80-84 35.7725 37.0 37.0 37.0 37.0 37.0 85-89 35.6466 37.0 37.0 37.0 37.0 37.0 90-94 35.6393 37.0 37.0 37.0 37.0 37.0 95-99 35.623099999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.489599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5375 37.0 37.0 37.0 37.0 37.0 110-114 35.558299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.439600000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.46939999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.2515 37.0 37.0 37.0 29.8 37.0 130-134 35.322900000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.3339 37.0 37.0 37.0 32.2 37.0 140-144 35.194100000000006 37.0 37.0 37.0 27.4 37.0 145-149 35.1679 37.0 37.0 37.0 27.4 37.0 150-151 34.90225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 2.0 22 3.0 23 5.0 24 4.0 25 8.0 26 17.0 27 22.0 28 29.0 29 39.0 30 43.0 31 75.0 32 110.0 33 124.0 34 201.0 35 483.0 36 2655.0 37 178.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.747363134103466 12.556504269211452 16.825715720743347 37.870416875941736 2 29.581348708949612 14.13888192529456 33.9934820757082 22.286287290047632 3 24.975 23.05 23.625 28.349999999999998 4 26.200000000000003 26.424999999999997 22.125 25.25 5 25.8 31.525 23.7 18.975 6 18.45 35.099999999999994 24.5 21.95 7 13.125 29.849999999999998 39.050000000000004 17.974999999999998 8 17.25 26.325 32.125 24.3 9 17.875 22.975 34.4 24.75 10-14 18.740000000000002 32.055 27.305 21.9 15-19 19.29 29.959999999999997 27.755000000000003 22.994999999999997 20-24 19.45 30.835 27.095000000000002 22.62 25-29 19.08 30.39 27.77 22.759999999999998 30-34 19.835 29.95 27.73 22.485 35-39 19.744999999999997 29.895 27.615000000000002 22.745 40-44 19.365 29.815 27.505000000000003 23.315 45-49 19.49 29.195 27.705000000000002 23.61 50-54 19.205 30.335 27.075 23.385 55-59 19.265 30.0 28.075 22.66 60-64 19.515 29.104999999999997 27.685 23.695 65-69 19.3 29.185 27.855 23.66 70-74 19.525000000000002 29.744999999999997 27.675 23.055 75-79 19.705000000000002 29.830000000000002 26.810000000000002 23.655 80-84 18.915000000000003 29.895 27.095000000000002 24.095 85-89 19.575 29.205 27.16 24.060000000000002 90-94 19.46 29.830000000000002 27.35 23.36 95-99 19.74 29.720000000000002 27.16 23.380000000000003 100-104 20.14 29.360000000000003 27.105 23.395 105-109 20.01 28.275 27.644999999999996 24.07 110-114 19.84 28.910000000000004 27.92 23.330000000000002 115-119 20.005 28.875 27.255000000000003 23.865 120-124 19.75 29.595 27.12 23.535 125-129 19.935 29.020000000000003 27.685 23.36 130-134 20.06 29.075 27.785 23.080000000000002 135-139 21.005 28.660000000000004 27.425 22.91 140-144 20.794999999999998 29.110000000000003 26.455000000000002 23.64 145-149 20.885 28.78 26.655 23.68 150-151 20.6875 29.312500000000004 25.424999999999997 24.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 3.5 24 4.5 25 8.5 26 11.0 27 13.0 28 22.5 29 32.0 30 43.0 31 51.0 32 55.0 33 68.0 34 88.5 35 101.5 36 119.5 37 130.5 38 147.5 39 182.0 40 203.5 41 210.0 42 210.5 43 225.0 44 238.0 45 230.0 46 228.0 47 230.0 48 203.0 49 179.5 50 164.5 51 127.5 52 92.0 53 83.0 54 69.5 55 49.0 56 41.5 57 32.0 58 24.0 59 15.0 60 7.5 61 8.5 62 7.0 63 6.0 64 6.0 65 4.0 66 2.5 67 3.5 68 3.0 69 1.5 70 1.0 71 1.5 72 2.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.32432432432432 85.39999999999999 2 7.243243243243243 13.4 3 0.43243243243243246 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATATA 10 0.006830828 145.0 4 ACAATAT 10 0.006830828 145.0 3 >>END_MODULE SRR22215332 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215332_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6445 37.0 37.0 37.0 37.0 37.0 2 36.0305 37.0 37.0 37.0 37.0 37.0 3 35.9385 37.0 37.0 37.0 37.0 37.0 4 36.1115 37.0 37.0 37.0 37.0 37.0 5 35.9895 37.0 37.0 37.0 37.0 37.0 6 35.959 37.0 37.0 37.0 37.0 37.0 7 35.975 37.0 37.0 37.0 37.0 37.0 8 36.023 37.0 37.0 37.0 37.0 37.0 9 36.102 37.0 37.0 37.0 37.0 37.0 10-14 36.05970000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.0521 37.0 37.0 37.0 37.0 37.0 20-24 36.0353 37.0 37.0 37.0 37.0 37.0 25-29 35.9958 37.0 37.0 37.0 37.0 37.0 30-34 35.875299999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.890100000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.829299999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.8331 37.0 37.0 37.0 37.0 37.0 50-54 35.773399999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.727 37.0 37.0 37.0 37.0 37.0 60-64 35.72089999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.729 37.0 37.0 37.0 37.0 37.0 70-74 35.7192 37.0 37.0 37.0 37.0 37.0 75-79 35.628499999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.554899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.5426 37.0 37.0 37.0 37.0 37.0 90-94 35.477 37.0 37.0 37.0 37.0 37.0 95-99 35.53359999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.3289 37.0 37.0 37.0 37.0 37.0 105-109 35.4351 37.0 37.0 37.0 37.0 37.0 110-114 35.3401 37.0 37.0 37.0 34.6 37.0 115-119 35.3334 37.0 37.0 37.0 32.2 37.0 120-124 35.2255 37.0 37.0 37.0 29.8 37.0 125-129 35.1542 37.0 37.0 37.0 27.4 37.0 130-134 35.119800000000005 37.0 37.0 37.0 25.0 37.0 135-139 35.1118 37.0 37.0 37.0 27.4 37.0 140-144 34.906200000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.8252 37.0 37.0 37.0 25.0 37.0 150-151 34.71425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.0 22 7.0 23 6.0 24 8.0 25 15.0 26 14.0 27 22.0 28 25.0 29 35.0 30 48.0 31 61.0 32 82.0 33 135.0 34 272.0 35 718.0 36 2361.0 37 183.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.825 20.075000000000003 15.9 32.2 2 26.424999999999997 26.674999999999997 32.15 14.75 3 21.475 31.674999999999997 29.2 17.65 4 26.6 33.15 22.5 17.75 5 26.150000000000002 36.95 22.95 13.950000000000001 6 20.474999999999998 41.225 22.425 15.875 7 19.575 20.225 40.125 20.075000000000003 8 22.55 24.525 29.25 23.674999999999997 9 24.05 23.150000000000002 29.125 23.674999999999997 10-14 24.05 28.549999999999997 27.015 20.385 15-19 23.990000000000002 27.68 28.255000000000003 20.075000000000003 20-24 24.16 27.994999999999997 27.71 20.135 25-29 23.705000000000002 28.67 28.189999999999998 19.435 30-34 24.145 27.505000000000003 28.565 19.785 35-39 23.79 27.79 28.185 20.235 40-44 23.705000000000002 27.965 28.335 19.994999999999997 45-49 23.255 27.63 28.634999999999998 20.48 50-54 23.369999999999997 28.310000000000002 28.285 20.035 55-59 23.74 28.505000000000003 27.88 19.875 60-64 23.84 27.884999999999998 28.42 19.855 65-69 23.705000000000002 28.499999999999996 28.355000000000004 19.439999999999998 70-74 23.865 27.860000000000003 28.744999999999997 19.53 75-79 23.830000000000002 27.3 29.4 19.470000000000002 80-84 23.62 27.994999999999997 28.410000000000004 19.975 85-89 24.215 28.294999999999998 28.125 19.365 90-94 23.57 28.22 28.63 19.580000000000002 95-99 23.74 28.185 29.04 19.035 100-104 23.69 27.860000000000003 28.895 19.555 105-109 23.87 27.915 28.675 19.54 110-114 23.369999999999997 27.715 29.575000000000003 19.34 115-119 24.135 27.205000000000002 29.43 19.23 120-124 23.69 27.235 29.675 19.400000000000002 125-129 23.47 28.275 28.88 19.375 130-134 23.51 27.72 29.34 19.43 135-139 23.465 27.855 29.175 19.505 140-144 24.665 27.36 28.59 19.384999999999998 145-149 24.935 27.395000000000003 28.360000000000003 19.31 150-151 24.05 28.512500000000003 28.1 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 1.5 23 1.5 24 2.0 25 2.5 26 7.0 27 8.0 28 9.5 29 16.0 30 19.5 31 25.0 32 39.5 33 50.0 34 58.0 35 79.0 36 103.0 37 126.0 38 144.0 39 167.5 40 207.5 41 240.0 42 261.0 43 265.5 44 257.0 45 257.5 46 261.5 47 255.0 48 216.5 49 168.0 50 149.5 51 130.0 52 105.5 53 89.0 54 70.0 55 51.0 56 38.5 57 29.5 58 19.5 59 11.5 60 8.5 61 9.5 62 8.5 63 7.0 64 4.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.37425635478637 85.39999999999999 2 7.111952406706328 13.15 3 0.48674959437533805 1.35 4 0.027041644131963225 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATTG 10 0.006830828 145.0 5 CCCCCCC 40 0.0076550315 18.125 95-99 >>END_MODULE Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682060 spots for SRR22215332.sra Written 1682060 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra Read 1682052 spots for SRR22215332.sra Written 1682052 spots for SRR22215332.sra SRR ids: ['SRR22215332.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s5wcxjp7 SRR22215332.sra spots: 33641048 blocks: [[1, 1682052], [1682053, 3364104], [3364105, 5046156], [5046157, 6728208], [6728209, 8410260], [8410261, 10092312], [10092313, 11774364], [11774365, 13456416], [13456417, 15138468], [15138469, 16820520], [16820521, 18502572], [18502573, 20184624], [20184625, 21866676], [21866677, 23548728], [23548729, 25230780], [25230781, 26912832], [26912833, 28594884], [28594885, 30276936], [30276937, 31958988], [31958989, 33641048]] SRR22215332 file size 11410999 SRR22215332 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215332 SRR22215332_1.fastq SRR22215332_2.fastq Input file: SRR22215332_1.fastq Paired file: SRR22215332_2.fastq trimmed: SRR22215332-trimmed-pair1.fastq, SRR22215332-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:38:44 2025 >> started Tue Feb 11 08:39:40 2025 >> done (56.269s) 33641048 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 24623 ( 0.07%) empty read pairs filtered out after trimming by size control 33616355 (99.93%) read pairs available; of these: 3468087 (10.32%) trimmed read pairs available after processing 30148268 (89.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 3 0.00% 23 0 0.00% 24 2 0.00% 25 1 0.00% 26 5 0.00% 27 3 0.00% 28 6 0.00% 29 6 0.00% 30 1 0.00% 31 3 0.00% 32 5 0.00% 33 6 0.00% 34 7 0.00% 35 8 0.00% 36 7 0.00% 37 6 0.00% 38 8 0.00% 39 2 0.00% 40 5 0.00% 41 4 0.00% 42 15 0.00% 43 3 0.00% 44 11 0.00% 45 15 0.00% 46 15 0.00% 47 10 0.00% 48 15 0.00% 49 21 0.00% 50 27 0.00% 51 22 0.00% 52 10 0.00% 53 32 0.00% 54 23 0.00% 55 19 0.00% 56 30 0.00% 57 37 0.00% 58 39 0.00% 59 41 0.00% 60 44 0.00% 61 58 0.00% 62 50 0.00% 63 65 0.00% 64 59 0.00% 65 69 0.00% 66 66 0.00% 67 70 0.00% 68 98 0.00% 69 80 0.00% 70 122 0.00% 71 128 0.00% 72 147 0.00% 73 140 0.00% 74 144 0.00% 75 227 0.00% 76 223 0.00% 77 228 0.00% 78 255 0.00% 79 291 0.00% 80 369 0.00% 81 381 0.00% 82 462 0.00% 83 493 0.00% 84 529 0.00% 85 585 0.00% 86 656 0.00% 87 767 0.00% 88 819 0.00% 89 919 0.00% 90 1049 0.00% 91 1155 0.00% 92 1209 0.00% 93 1421 0.00% 94 1556 0.00% 95 1664 0.00% 96 1821 0.01% 97 1972 0.01% 98 2086 0.01% 99 2320 0.01% 100 2651 0.01% 101 2803 0.01% 102 3204 0.01% 103 3579 0.01% 104 3992 0.01% 105 4295 0.01% 106 5013 0.01% 107 5365 0.02% 108 6197 0.02% 109 6762 0.02% 110 7371 0.02% 111 8402 0.02% 112 9358 0.03% 113 10466 0.03% 114 11737 0.03% 115 13762 0.04% 116 15296 0.05% 117 17522 0.05% 118 19971 0.06% 119 22151 0.07% 120 24554 0.07% 121 27688 0.08% 122 30748 0.09% 123 33557 0.10% 124 37850 0.11% 125 41801 0.12% 126 47194 0.14% 127 51738 0.15% 128 57004 0.17% 129 62827 0.19% 130 68761 0.20% 131 75210 0.22% 132 79538 0.24% 133 85215 0.25% 134 91517 0.27% 135 98403 0.29% 136 106059 0.32% 137 113786 0.34% 138 121439 0.36% 139 129464 0.39% 140 137041 0.41% 141 143425 0.43% 142 150073 0.45% 143 155676 0.46% 144 162649 0.48% 145 169762 0.50% 146 176403 0.52% 147 181168 0.54% 148 191913 0.57% 149 199638 0.59% 150 210804 0.63% 151 30148268 89.68% 33616355 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=3.4 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=493.82 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=22.3 sequence=ATCATCAACTATGAACATTTAATACATGAAGCGCAACCCAAAAAACAGACAATGGAGGAGGCAAATCGATGTAGAGATCTAGGCATTCACATGTATAGGATGGTCACATCACACATTAAAGCAAGCTCACTTGTAGGTCCCCATACCCACACCAACATCTCCACCGTATGGCTGGAAGCTGTCACTGGCCTTGGAATAGCAAATATAGTAGAGCTCGGACACTATGGCTGTGAACAAAGTAAAAGCAGCTCCTGCCCCAAAAACTCCCTTCCTCAATGATGGGCAATCCAGGGTTTCACCGAAAAAATTCTTGTAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.83 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=4.5 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=275.48 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=23.8 sequence=AAGAAGAAAAAGGACAAGAAGAAGAATGAAGATGGCCATAGCAGCAGCAGTGACAGCGACTAAAAATCTTGCA SRR22215332 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 09:01:26 Started mapping on | Feb 11 09:01:29 Finished on | Feb 11 09:04:08 Mapping speed, Million of reads per hour | 761.12 Number of input reads | 33616271 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 26364296 Uniquely mapped reads % | 78.43% Average mapped length | 276.61 Number of splices: Total | 19189796 Number of splices: Annotated (sjdb) | 18762055 Number of splices: GT/AG | 18877645 Number of splices: GC/AG | 231181 Number of splices: AT/AC | 24299 Number of splices: Non-canonical | 56671 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 546549 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 200423 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.15% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6705427 6705427 6705427 N_multimapping 546549 546549 546549 N_noFeature 1035046 25976605 1160503 N_ambiguous 533059 5332 266999 UnstrandedReadsAssigned:24796191 PositiveStrandReadsAssigned:382359 NegativeStrandReadsAssigned:24936794 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215332 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215332-trimmed-pair1.fastq SRR22215332-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,616,271 reads, 30,990,120 reads pseudoaligned [quant] estimated average fragment length: 174.699 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR22215332.ke.tsv 34699 SRR22215332.se.tsv 87100 total ==> SRR22215332.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1844.3 1109 20.4345 Potri.005G024800.1.v4.1 1035 861.301 265 10.4558 Potri.004G059700.1.v4.1 961 787.305 55 2.37402 Potri.007G009000.2.v4.1 1416 1242.3 0 0 Potri.003G141000.2.v4.1 2943 2769.3 445 5.46078 Potri.016G087400.1.v4.1 270 97.9998 1767.42 612.885 Potri.015G069301.1.v4.1 564 390.348 0 0 Potri.010G195200.1.v4.1 1773 1599.3 128 2.71985 Potri.012G127500.1.v4.1 977 803.301 7848 332.006 ==> SRR22215332.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2764 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 560 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 79 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR22215332 completed mapping pipeline successfully