Starting /dee2/code/volunteer_pipeline.sh SRR22215333 current disk space = 3055168598016 free memory = 1576924908 SRR22215333 SRAfilesize 2bf809d3961c96c9104fceababce0a0f SRR22215333.sra SRR22215333.sra file validated SRR22215333 is paired end SRR22215333 is conventional basespace SRR22215333 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215333_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.88925 37.0 37.0 37.0 37.0 37.0 2 36.084 37.0 37.0 37.0 37.0 37.0 3 36.2725 37.0 37.0 37.0 37.0 37.0 4 36.2395 37.0 37.0 37.0 37.0 37.0 5 36.3 37.0 37.0 37.0 37.0 37.0 6 36.3105 37.0 37.0 37.0 37.0 37.0 7 36.316 37.0 37.0 37.0 37.0 37.0 8 36.355 37.0 37.0 37.0 37.0 37.0 9 36.266 37.0 37.0 37.0 37.0 37.0 10-14 36.3106 37.0 37.0 37.0 37.0 37.0 15-19 36.3266 37.0 37.0 37.0 37.0 37.0 20-24 36.2444 37.0 37.0 37.0 37.0 37.0 25-29 36.2388 37.0 37.0 37.0 37.0 37.0 30-34 36.1013 37.0 37.0 37.0 37.0 37.0 35-39 36.0479 37.0 37.0 37.0 37.0 37.0 40-44 36.0632 37.0 37.0 37.0 37.0 37.0 45-49 36.051300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.00269999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8917 37.0 37.0 37.0 37.0 37.0 60-64 35.8681 37.0 37.0 37.0 37.0 37.0 65-69 35.82940000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.8758 37.0 37.0 37.0 37.0 37.0 75-79 35.8233 37.0 37.0 37.0 37.0 37.0 80-84 35.735800000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.7223 37.0 37.0 37.0 37.0 37.0 90-94 35.629 37.0 37.0 37.0 37.0 37.0 95-99 35.6554 37.0 37.0 37.0 37.0 37.0 100-104 35.686600000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.6258 37.0 37.0 37.0 37.0 37.0 110-114 35.6702 37.0 37.0 37.0 37.0 37.0 115-119 35.6477 37.0 37.0 37.0 37.0 37.0 120-124 35.471199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.51559999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.4913 37.0 37.0 37.0 37.0 37.0 135-139 35.4883 37.0 37.0 37.0 37.0 37.0 140-144 35.3041 37.0 37.0 37.0 34.6 37.0 145-149 35.3014 37.0 37.0 37.0 32.2 37.0 150-151 35.0025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 0.0 22 0.0 23 0.0 24 0.0 25 4.0 26 13.0 27 19.0 28 22.0 29 33.0 30 55.0 31 69.0 32 93.0 33 146.0 34 181.0 35 475.0 36 2681.0 37 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.36691009821204 11.231427851926465 16.771594056912615 38.63006799294888 2 27.730460921843687 14.654308617234468 34.06813627254509 23.547094188376754 3 24.425 22.55 25.074999999999996 27.950000000000003 4 27.500000000000004 26.775 21.95 23.775 5 25.05 32.625 22.825 19.5 6 17.8 36.15 25.074999999999996 20.974999999999998 7 13.0 28.799999999999997 39.800000000000004 18.4 8 16.525000000000002 26.924999999999997 32.375 24.175 9 17.175 24.75 33.6 24.474999999999998 10-14 18.945 31.655 26.685 22.715 15-19 19.25 30.615 27.339999999999996 22.795 20-24 19.470000000000002 30.17 27.48 22.88 25-29 18.965 30.959999999999997 27.125 22.95 30-34 19.35 29.925 27.305 23.419999999999998 35-39 19.24 30.104999999999997 27.529999999999998 23.125 40-44 19.595000000000002 30.049999999999997 27.98 22.375 45-49 19.71 30.185000000000002 27.42 22.685 50-54 19.525000000000002 29.665000000000003 27.82 22.99 55-59 19.46 30.03 26.919999999999998 23.59 60-64 19.835 29.53 27.24 23.395 65-69 19.98 30.964999999999996 26.8 22.255 70-74 20.365 29.815 27.12 22.7 75-79 20.105 28.965000000000003 27.435 23.494999999999997 80-84 20.06 29.2 27.91 22.830000000000002 85-89 20.43 29.959999999999997 26.75 22.86 90-94 20.05 28.895 27.29 23.765 95-99 20.015 29.520000000000003 27.315 23.150000000000002 100-104 19.855 29.544999999999998 27.779999999999998 22.82 105-109 20.46 28.53 27.46 23.549999999999997 110-114 20.055 29.24 27.42 23.285 115-119 20.0 29.53 27.029999999999998 23.44 120-124 19.985 28.854999999999997 27.439999999999998 23.72 125-129 19.66 29.044999999999998 26.995 24.3 130-134 20.7 28.925 27.29 23.085 135-139 20.415 28.98 27.139999999999997 23.465 140-144 20.825 29.365000000000002 26.575 23.235 145-149 21.029999999999998 29.37 26.755000000000003 22.845 150-151 20.3625 29.175 26.25 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 1.5 18 1.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 6.5 25 10.0 26 10.0 27 10.5 28 15.0 29 29.0 30 50.0 31 58.5 32 56.0 33 64.0 34 83.5 35 105.5 36 130.5 37 149.5 38 155.0 39 168.0 40 189.0 41 188.5 42 196.0 43 229.5 44 267.0 45 260.5 46 225.0 47 208.5 48 189.0 49 177.5 50 159.0 51 122.0 52 95.5 53 76.5 54 60.0 55 42.5 56 33.5 57 31.0 58 25.0 59 21.5 60 17.5 61 13.0 62 9.5 63 13.0 64 10.5 65 3.0 66 2.5 67 2.5 68 2.0 69 3.5 70 3.0 71 1.0 72 1.5 73 2.5 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.52542372881356 83.7 2 7.736468015308912 14.149999999999999 3 0.6287588846364134 1.725 4 0.08201202843083652 0.3 5 0.027337342810278838 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 2.225 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR22215333 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215333_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9185 37.0 37.0 37.0 37.0 37.0 2 36.2105 37.0 37.0 37.0 37.0 37.0 3 36.2475 37.0 37.0 37.0 37.0 37.0 4 36.0895 37.0 37.0 37.0 37.0 37.0 5 36.1255 37.0 37.0 37.0 37.0 37.0 6 36.0535 37.0 37.0 37.0 37.0 37.0 7 36.143 37.0 37.0 37.0 37.0 37.0 8 36.2385 37.0 37.0 37.0 37.0 37.0 9 36.288 37.0 37.0 37.0 37.0 37.0 10-14 36.1555 37.0 37.0 37.0 37.0 37.0 15-19 36.1765 37.0 37.0 37.0 37.0 37.0 20-24 36.092 37.0 37.0 37.0 37.0 37.0 25-29 36.0569 37.0 37.0 37.0 37.0 37.0 30-34 35.9609 37.0 37.0 37.0 37.0 37.0 35-39 35.91029999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.971999999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.872 37.0 37.0 37.0 37.0 37.0 50-54 35.8781 37.0 37.0 37.0 37.0 37.0 55-59 35.7807 37.0 37.0 37.0 37.0 37.0 60-64 35.80400000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.761 37.0 37.0 37.0 37.0 37.0 70-74 35.7667 37.0 37.0 37.0 37.0 37.0 75-79 35.686299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.59609999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.611900000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.6202 37.0 37.0 37.0 37.0 37.0 95-99 35.604699999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.522400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.488600000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.5379 37.0 37.0 37.0 37.0 37.0 115-119 35.4355 37.0 37.0 37.0 37.0 37.0 120-124 35.3429 37.0 37.0 37.0 34.6 37.0 125-129 35.297000000000004 37.0 37.0 37.0 32.2 37.0 130-134 35.2082 37.0 37.0 37.0 32.2 37.0 135-139 35.20740000000001 37.0 37.0 37.0 32.2 37.0 140-144 35.089999999999996 37.0 37.0 37.0 27.4 37.0 145-149 35.0609 37.0 37.0 37.0 25.0 37.0 150-151 34.967 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 4.0 17 3.0 18 2.0 19 2.0 20 1.0 21 0.0 22 4.0 23 9.0 24 9.0 25 16.0 26 11.0 27 22.0 28 26.0 29 13.0 30 34.0 31 56.0 32 75.0 33 116.0 34 223.0 35 658.0 36 2491.0 37 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.275000000000002 21.825 17.375 30.525000000000002 2 27.55 27.474999999999998 31.4 13.575000000000001 3 21.45 30.275000000000002 29.7 18.575 4 25.6 33.925 23.175 17.299999999999997 5 27.400000000000002 35.575 22.125 14.899999999999999 6 19.85 38.675 23.400000000000002 18.075 7 21.2 19.125 41.325 18.35 8 23.549999999999997 22.675 29.375 24.4 9 24.575 22.05 30.0 23.375 10-14 24.185000000000002 28.46 26.595000000000002 20.76 15-19 23.26 27.860000000000003 28.310000000000002 20.57 20-24 23.7 28.595 27.400000000000002 20.305 25-29 23.549999999999997 28.58 27.700000000000003 20.169999999999998 30-34 23.32 28.405 28.185 20.09 35-39 23.865 27.685 28.904999999999998 19.545 40-44 23.36 28.360000000000003 27.87 20.41 45-49 23.405 27.845 28.475 20.275000000000002 50-54 23.525 28.384999999999998 28.105000000000004 19.985 55-59 23.905 28.34 28.26 19.495 60-64 23.48 27.85 28.875 19.794999999999998 65-69 23.29 28.410000000000004 28.59 19.71 70-74 23.77 27.66 28.585 19.985 75-79 23.205000000000002 27.43 29.354999999999997 20.01 80-84 23.845 27.445000000000004 28.660000000000004 20.05 85-89 23.494999999999997 27.245 29.835 19.425 90-94 24.205 27.584999999999997 28.76 19.45 95-99 23.56 28.194999999999997 28.96 19.285 100-104 23.865 27.975 28.544999999999998 19.615 105-109 23.544999999999998 26.950000000000003 29.635 19.869999999999997 110-114 23.14 27.944999999999997 29.195 19.72 115-119 23.615 27.185 29.049999999999997 20.150000000000002 120-124 23.335 27.689999999999998 29.15 19.825 125-129 22.975 27.54 29.59 19.895 130-134 23.61 27.76 29.365000000000002 19.265 135-139 23.71 28.299999999999997 29.020000000000003 18.970000000000002 140-144 24.54 27.935 28.225 19.3 145-149 25.119999999999997 28.165000000000003 27.794999999999998 18.92 150-151 24.05 29.062500000000004 28.1 18.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 3.5 23 4.0 24 4.0 25 8.5 26 8.0 27 6.5 28 9.5 29 12.0 30 19.5 31 34.0 32 48.5 33 52.0 34 59.5 35 87.0 36 114.0 37 126.0 38 142.5 39 177.5 40 211.0 41 229.5 42 250.0 43 258.0 44 248.0 45 255.0 46 253.0 47 235.0 48 218.5 49 179.0 50 134.0 51 127.0 52 111.0 53 78.0 54 60.0 55 47.5 56 38.5 57 26.5 58 22.0 59 22.5 60 16.5 61 9.5 62 8.5 63 7.0 64 4.5 65 4.0 66 3.0 67 2.0 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 1.0 86 1.5 87 0.5 88 0.5 89 1.5 90 1.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.89115646258503 84.425 2 7.428571428571429 13.65 3 0.6258503401360545 1.725 4 0.05442176870748299 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.7125 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 4.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371694 spots for SRR22215333.sra Written 2371694 spots for SRR22215333.sra Read 2371701 spots for SRR22215333.sra Written 2371701 spots for SRR22215333.sra SRR ids: ['SRR22215333.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qeh5a5hv SRR22215333.sra spots: 47433887 blocks: [[1, 2371694], [2371695, 4743388], [4743389, 7115082], [7115083, 9486776], [9486777, 11858470], [11858471, 14230164], [14230165, 16601858], [16601859, 18973552], [18973553, 21345246], [21345247, 23716940], [23716941, 26088634], [26088635, 28460328], [28460329, 30832022], [30832023, 33203716], [33203717, 35575410], [35575411, 37947104], [37947105, 40318798], [40318799, 42690492], [42690493, 45062186], [45062187, 47433887]] SRR22215333 file size 16098409 SRR22215333 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215333 SRR22215333_1.fastq SRR22215333_2.fastq Input file: SRR22215333_1.fastq Paired file: SRR22215333_2.fastq trimmed: SRR22215333-trimmed-pair1.fastq, SRR22215333-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:25:07 2025 >> started Tue Feb 11 09:26:03 2025 >> done (56.482s) 47433887 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 49523 ( 0.10%) empty read pairs filtered out after trimming by size control 47384239 (99.90%) read pairs available; of these: 5131135 (10.83%) trimmed read pairs available after processing 42253104 (89.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 5 0.00% 21 4 0.00% 22 6 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 12 0.00% 30 4 0.00% 31 9 0.00% 32 4 0.00% 33 3 0.00% 34 10 0.00% 35 8 0.00% 36 15 0.00% 37 10 0.00% 38 17 0.00% 39 11 0.00% 40 13 0.00% 41 14 0.00% 42 16 0.00% 43 15 0.00% 44 11 0.00% 45 15 0.00% 46 18 0.00% 47 15 0.00% 48 20 0.00% 49 30 0.00% 50 16 0.00% 51 23 0.00% 52 36 0.00% 53 24 0.00% 54 29 0.00% 55 30 0.00% 56 43 0.00% 57 38 0.00% 58 46 0.00% 59 52 0.00% 60 73 0.00% 61 47 0.00% 62 66 0.00% 63 72 0.00% 64 93 0.00% 65 106 0.00% 66 109 0.00% 67 132 0.00% 68 139 0.00% 69 186 0.00% 70 171 0.00% 71 213 0.00% 72 219 0.00% 73 222 0.00% 74 261 0.00% 75 306 0.00% 76 353 0.00% 77 375 0.00% 78 433 0.00% 79 450 0.00% 80 533 0.00% 81 585 0.00% 82 683 0.00% 83 776 0.00% 84 776 0.00% 85 895 0.00% 86 1014 0.00% 87 1124 0.00% 88 1314 0.00% 89 1424 0.00% 90 1654 0.00% 91 1794 0.00% 92 2026 0.00% 93 2206 0.00% 94 2602 0.01% 95 2813 0.01% 96 2898 0.01% 97 3374 0.01% 98 3638 0.01% 99 4013 0.01% 100 4264 0.01% 101 4626 0.01% 102 5104 0.01% 103 5660 0.01% 104 6282 0.01% 105 6948 0.01% 106 7560 0.02% 107 8379 0.02% 108 9297 0.02% 109 10197 0.02% 110 11353 0.02% 111 12451 0.03% 112 13636 0.03% 113 15257 0.03% 114 17107 0.04% 115 19443 0.04% 116 21822 0.05% 117 24282 0.05% 118 27246 0.06% 119 30638 0.06% 120 34272 0.07% 121 38342 0.08% 122 42168 0.09% 123 47373 0.10% 124 52392 0.11% 125 58700 0.12% 126 64879 0.14% 127 72738 0.15% 128 80118 0.17% 129 88504 0.19% 130 95628 0.20% 131 106031 0.22% 132 113980 0.24% 133 123253 0.26% 134 132375 0.28% 135 141391 0.30% 136 154428 0.33% 137 164735 0.35% 138 178065 0.38% 139 191191 0.40% 140 202827 0.43% 141 214378 0.45% 142 223991 0.47% 143 235985 0.50% 144 245639 0.52% 145 255818 0.54% 146 267570 0.56% 147 280001 0.59% 148 293659 0.62% 149 305728 0.65% 150 322592 0.68% 151 42253104 89.17% 47384239 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=3.2 sequence=GAAGCAAAAATGTCCTTAGGAAGTAGCACCTTCTCAATCTTATAAATGGCTAGCTGGTTGTCCGTGTATACCGTGCCAGATAAACTTGTATTGGTAAGTCCTGTGGTTATGTTCACCGAGTTTGGATAACTTGTGACATTAAGTGGTAACCTACTACCTGTTCCAGCCCATGTTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=83.26 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.7 sequence=CTATCATCAACTATGAACATTTAATACATGAAGCGCAACCCAAAAAACAGACAATGGAGGAGGCAAATCGATGTAGAGATCTAGGCATTCACATGTATAGGATGGTCACATCACACATTAAAGCAAGCTCACTTGTAGGTCCCCATACCCACACCAACATCTCCACCGTATGGCTGGAAGCTGTCACTGGCCTTGGAATAGCAAATATAGTAGAGCTCGGACACTATGGCTGTGAACAAAGTAAAAGCAGCTCCTGCCCCAAAAACTCCCTTCCTCAATGATGGGCAATCCAGGGTTTCACCGAAAAAATTCTTGTACCTGGTGTGGTAGGCATTCCTTACTGAACCCGCAAGCAAGCATATCTCAGCAATGAAGAAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=7.03 fanout-score-rank=17 prefix-density=0.28 prefix-fanout=4.2 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=78.66 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.6 sequence=TGCAGCTGCAGAATACCAGCCTCATGGATTTGGTACCAGCGGAGGGAAACTTACGGGGCAGAAGGAAGTTGCTGCTTTCCTTGGGCATGTTGGAAGCAAAACCTCATGTGGTTATGGAGTGGCCACTGGAGGACCATTGGCATGGGGTTTGTGCTACAACAAGGAAATGAGTCCCAGCAAGACATACTGCGATGATTACTACAAGTACACCTATCCTTGCACTCCCGGAGTTTCGTATCACGGCAGGGGTGCGCTGCCTCTTTACTGGAACTACAACTATGGCAAAACTGGGGAAGCCCTGAAGACTGATCTGTTGAACCATCCAGAATACCTCGAAAACAATGCTACACTAGCTTTCCAGGCTGCTATTTGGAAGTGGATGACACCAGAAAAGAAGCATCTCCCTTCAGCACACGATGTATTTGTTGGCAAATGGAAACCTACCAAGAATGACACTTTGGCCAAGAGGGTACCTGGATTTGGCACCACCATGAATGTTCTGTATGGGGAT SRR22215333 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:26:46 Started mapping on | Feb 11 09:26:46 Finished on | Feb 11 09:30:58 Mapping speed, Million of reads per hour | 676.92 Number of input reads | 47384239 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 44947558 Uniquely mapped reads % | 94.86% Average mapped length | 298.03 Number of splices: Total | 31978580 Number of splices: Annotated (sjdb) | 31300379 Number of splices: GT/AG | 31500815 Number of splices: GC/AG | 364117 Number of splices: AT/AC | 39073 Number of splices: Non-canonical | 74575 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.21 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 872839 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 568105 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1563842 1563842 1563842 N_multimapping 872839 872839 872839 N_noFeature 1688924 44229660 1895936 N_ambiguous 709088 2797 196873 UnstrandedReadsAssigned:42549546 PositiveStrandReadsAssigned:715101 NegativeStrandReadsAssigned:42854749 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215333 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215333-trimmed-pair1.fastq SRR22215333-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,384,239 reads, 43,749,410 reads pseudoaligned [quant] estimated average fragment length: 192.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR22215333.ke.tsv 34699 SRR22215333.se.tsv 87100 total ==> SRR22215333.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.85 1959 24.413 Potri.005G024800.1.v4.1 1035 843.846 442 11.9247 Potri.004G059700.1.v4.1 961 769.853 126 3.72608 Potri.007G009000.2.v4.1 1416 1224.85 0 0 Potri.003G141000.2.v4.1 2943 2751.85 461.042 3.81422 Potri.016G087400.1.v4.1 270 83.2767 2816 769.836 Potri.015G069301.1.v4.1 564 372.913 0 0 Potri.010G195200.1.v4.1 1773 1581.85 124 1.78462 Potri.012G127500.1.v4.1 977 785.853 5624 162.927 ==> SRR22215333.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4471 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1187 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 190 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR22215333 completed mapping pipeline successfully