Starting /dee2/code/volunteer_pipeline.sh SRR22215334 current disk space = 3055732948992 free memory = 1058361728 SRR22215334 SRAfilesize d5d63070bb52d62d37787c3fd0976f4e SRR22215334.sra SRR22215334.sra file validated SRR22215334 is paired end SRR22215334 is conventional basespace SRR22215334 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.91925 37.0 37.0 37.0 37.0 37.0 2 35.95825 37.0 37.0 37.0 37.0 37.0 3 36.3605 37.0 37.0 37.0 37.0 37.0 4 36.276 37.0 37.0 37.0 37.0 37.0 5 36.3635 37.0 37.0 37.0 37.0 37.0 6 36.2585 37.0 37.0 37.0 37.0 37.0 7 36.231 37.0 37.0 37.0 37.0 37.0 8 36.315 37.0 37.0 37.0 37.0 37.0 9 36.363 37.0 37.0 37.0 37.0 37.0 10-14 36.3064 37.0 37.0 37.0 37.0 37.0 15-19 36.290000000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.18470000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2123 37.0 37.0 37.0 37.0 37.0 30-34 36.0798 37.0 37.0 37.0 37.0 37.0 35-39 36.0398 37.0 37.0 37.0 37.0 37.0 40-44 35.971799999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.939 37.0 37.0 37.0 37.0 37.0 50-54 35.8964 37.0 37.0 37.0 37.0 37.0 55-59 35.82899999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.7391 37.0 37.0 37.0 37.0 37.0 65-69 35.627 37.0 37.0 37.0 37.0 37.0 70-74 35.7613 37.0 37.0 37.0 37.0 37.0 75-79 35.7734 37.0 37.0 37.0 37.0 37.0 80-84 35.6814 37.0 37.0 37.0 37.0 37.0 85-89 35.693400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.58220000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.6156 37.0 37.0 37.0 37.0 37.0 100-104 35.473699999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.495400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.49380000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.4895 37.0 37.0 37.0 37.0 37.0 120-124 35.3899 37.0 37.0 37.0 37.0 37.0 125-129 35.3654 37.0 37.0 37.0 37.0 37.0 130-134 35.2932 37.0 37.0 37.0 34.6 37.0 135-139 35.28940000000001 37.0 37.0 37.0 32.2 37.0 140-144 35.2857 37.0 37.0 37.0 32.2 37.0 145-149 35.1687 37.0 37.0 37.0 27.4 37.0 150-151 35.01925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 5.0 24 4.0 25 13.0 26 11.0 27 14.0 28 27.0 29 41.0 30 60.0 31 72.0 32 103.0 33 139.0 34 209.0 35 463.0 36 2657.0 37 178.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.823559023408 11.729171910395166 18.097155801661213 33.350113264535615 2 31.09159347553325 13.450439146800502 30.53952321204517 24.91844416562108 3 27.500000000000004 21.15 23.825 27.525 4 28.275 24.975 20.849999999999998 25.900000000000002 5 27.1 30.85 22.900000000000002 19.15 6 18.625 33.575 25.900000000000002 21.9 7 12.425 30.725 38.0 18.85 8 15.725 28.325 31.3 24.65 9 17.1 25.6 33.95 23.35 10-14 19.095000000000002 32.5 26.229999999999997 22.175 15-19 19.31 30.470000000000002 27.279999999999998 22.939999999999998 20-24 19.355 30.375000000000004 27.355 22.915 25-29 19.445 29.75 27.18 23.625 30-34 18.92 30.130000000000003 27.005000000000003 23.945 35-39 19.384999999999998 29.64 27.389999999999997 23.585 40-44 19.475 29.365000000000002 27.37 23.79 45-49 19.945 29.23 26.82 24.005000000000003 50-54 19.564999999999998 29.425 27.58 23.43 55-59 19.185 29.95 27.384999999999998 23.48 60-64 19.425 30.049999999999997 26.840000000000003 23.685000000000002 65-69 19.72 30.15 26.66 23.47 70-74 20.11 29.475 26.779999999999998 23.635 75-79 19.93 29.535 26.950000000000003 23.585 80-84 20.39 28.749999999999996 26.77 24.09 85-89 20.16 29.82 25.974999999999998 24.044999999999998 90-94 20.119999999999997 29.92 26.529999999999998 23.43 95-99 19.919999999999998 28.565 26.895000000000003 24.62 100-104 19.994999999999997 29.015 26.795 24.195 105-109 19.994999999999997 28.515 27.355 24.135 110-114 19.74 29.175 27.36 23.724999999999998 115-119 20.169999999999998 28.425 27.095000000000002 24.310000000000002 120-124 20.349999999999998 28.810000000000002 26.529999999999998 24.310000000000002 125-129 20.525 28.37 27.38 23.724999999999998 130-134 20.61 28.249999999999996 27.07 24.07 135-139 20.735 28.74 27.005000000000003 23.52 140-144 20.945 29.160000000000004 26.105 23.79 145-149 21.205 28.87 26.02 23.905 150-151 21.3625 28.675 25.9625 24.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.5 24 4.5 25 6.0 26 11.5 27 17.5 28 20.5 29 28.5 30 36.5 31 48.5 32 63.5 33 71.0 34 82.5 35 100.0 36 109.0 37 123.0 38 137.5 39 167.5 40 196.5 41 200.0 42 217.0 43 227.5 44 226.0 45 222.5 46 209.5 47 213.0 48 205.5 49 169.0 50 143.0 51 125.5 52 117.5 53 95.5 54 72.5 55 54.0 56 34.5 57 39.5 58 37.0 59 24.5 60 19.5 61 17.0 62 14.5 63 10.0 64 6.5 65 6.5 66 5.0 67 8.0 68 9.5 69 7.0 70 7.0 71 3.5 72 1.0 73 3.0 74 3.0 75 2.5 76 2.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.4877517691889 84.95 2 6.750136091453457 12.4 3 0.6532389765922699 1.7999999999999998 4 0.027218290691344585 0.1 5 0.027218290691344585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05443658138268917 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 13 0.325 TruSeq Adapter, Index 2 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCGCGTATGC 12 0.3 TruSeq Adapter, Index 2 (98% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 4.2875 0.0 0.0 0.0 0.0 138-139 5.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAA 10 0.006830828 145.0 4 >>END_MODULE SRR22215334 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22215334_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9205 37.0 37.0 37.0 37.0 37.0 2 36.279 37.0 37.0 37.0 37.0 37.0 3 36.257 37.0 37.0 37.0 37.0 37.0 4 36.1415 37.0 37.0 37.0 37.0 37.0 5 36.166 37.0 37.0 37.0 37.0 37.0 6 36.157 37.0 37.0 37.0 37.0 37.0 7 36.108 37.0 37.0 37.0 37.0 37.0 8 36.181 37.0 37.0 37.0 37.0 37.0 9 36.224 37.0 37.0 37.0 37.0 37.0 10-14 36.122 37.0 37.0 37.0 37.0 37.0 15-19 36.09140000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.053200000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.915099999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.8787 37.0 37.0 37.0 37.0 37.0 35-39 35.8428 37.0 37.0 37.0 37.0 37.0 40-44 35.7834 37.0 37.0 37.0 37.0 37.0 45-49 35.8035 37.0 37.0 37.0 37.0 37.0 50-54 35.757999999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.7718 37.0 37.0 37.0 37.0 37.0 60-64 35.75019999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.6885 37.0 37.0 37.0 37.0 37.0 70-74 35.6512 37.0 37.0 37.0 37.0 37.0 75-79 35.664199999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.6001 37.0 37.0 37.0 37.0 37.0 85-89 35.649699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.6209 37.0 37.0 37.0 37.0 37.0 95-99 35.6154 37.0 37.0 37.0 37.0 37.0 100-104 35.5572 37.0 37.0 37.0 37.0 37.0 105-109 35.585300000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.550799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.45889999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.422399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.3617 37.0 37.0 37.0 34.6 37.0 130-134 35.2821 37.0 37.0 37.0 32.2 37.0 135-139 35.2795 37.0 37.0 37.0 32.2 37.0 140-144 35.1158 37.0 37.0 37.0 25.0 37.0 145-149 35.1211 37.0 37.0 37.0 27.4 37.0 150-151 35.13125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 3.0 16 1.0 17 2.0 18 4.0 19 1.0 20 2.0 21 1.0 22 5.0 23 9.0 24 18.0 25 11.0 26 17.0 27 17.0 28 19.0 29 27.0 30 36.0 31 48.0 32 71.0 33 116.0 34 216.0 35 650.0 36 2508.0 37 216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5 22.1 16.45 26.950000000000003 2 29.075 26.924999999999997 29.425 14.575 3 24.45 30.15 28.675 16.725 4 28.000000000000004 34.625 21.575 15.8 5 26.724999999999998 35.575 22.725 14.975 6 21.65 39.45 22.45 16.45 7 22.175 18.0 41.199999999999996 18.625 8 22.775000000000002 25.575 27.950000000000003 23.7 9 25.6 23.775 27.6 23.025000000000002 10-14 25.03 28.849999999999998 26.5 19.62 15-19 24.834999999999997 28.005000000000003 27.61 19.55 20-24 24.875 27.944999999999997 27.43 19.75 25-29 24.525 28.084999999999997 27.345000000000002 20.044999999999998 30-34 24.445 28.22 27.83 19.505 35-39 24.915000000000003 27.785 27.905 19.395 40-44 24.404999999999998 27.939999999999998 28.02 19.634999999999998 45-49 24.905 26.955000000000002 28.055000000000003 20.085 50-54 25.205 27.405 27.92 19.470000000000002 55-59 25.074999999999996 27.515 28.035 19.375 60-64 24.5 27.725 28.18 19.595000000000002 65-69 24.240000000000002 27.685 28.67 19.405 70-74 24.485 27.765 28.28 19.470000000000002 75-79 24.740000000000002 27.67 28.315 19.275000000000002 80-84 24.825 27.52 28.315 19.34 85-89 24.404999999999998 27.485 29.095 19.015 90-94 24.485 27.245 28.93 19.34 95-99 24.29 27.255000000000003 28.794999999999998 19.66 100-104 24.41 27.250000000000004 28.560000000000002 19.78 105-109 24.36 27.425 28.725 19.49 110-114 24.52 27.189999999999998 28.32 19.97 115-119 24.19 27.725 28.645 19.439999999999998 120-124 24.21 27.355 29.04 19.395 125-129 24.709999999999997 27.305 28.865000000000002 19.12 130-134 24.11 28.04 28.395 19.455 135-139 25.095 27.589999999999996 28.634999999999998 18.68 140-144 25.53 27.715 28.27 18.485 145-149 26.035000000000004 27.58 27.805000000000003 18.58 150-151 26.637499999999996 27.6 27.187499999999996 18.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 2.5 18 2.0 19 0.0 20 1.0 21 2.5 22 3.5 23 2.5 24 3.5 25 6.0 26 5.5 27 6.0 28 11.5 29 19.5 30 24.0 31 36.0 32 44.5 33 44.0 34 55.0 35 66.5 36 79.0 37 121.5 38 140.5 39 150.5 40 205.0 41 233.0 42 244.0 43 257.5 44 251.0 45 243.5 46 254.0 47 236.0 48 193.5 49 182.0 50 163.0 51 140.5 52 120.5 53 92.5 54 68.5 55 48.5 56 42.5 57 36.5 58 23.0 59 15.5 60 11.5 61 10.5 62 10.5 63 7.0 64 4.5 65 5.0 66 5.5 67 4.5 68 5.5 69 4.5 70 3.0 71 2.5 72 1.5 73 2.5 74 5.0 75 4.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 1.5 84 1.5 85 1.5 86 2.5 87 1.5 88 1.5 89 1.0 90 1.5 91 2.5 92 2.0 93 1.5 94 1.0 95 0.5 96 0.5 97 1.0 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.575 #Duplication Level Percentage of deduplicated Percentage of total 1 92.78963002970563 85.9 2 6.589251957871996 12.2 3 0.5401026194977046 1.5 4 0.027005130974885227 0.1 5 0.0 0.0 6 0.054010261949770454 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GGAGATTGCAAATATTGTGAGGGGTCTAATGGAAGGTGAGGAAGGGAAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.8624999999999998 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 4.2875 0.0 0.0 0.0 0.0 138-139 5.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006618 spots for SRR22215334.sra Written 2006618 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra Read 2006605 spots for SRR22215334.sra Written 2006605 spots for SRR22215334.sra SRR ids: ['SRR22215334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_klxbzt55 SRR22215334.sra spots: 40132113 blocks: [[1, 2006605], [2006606, 4013210], [4013211, 6019815], [6019816, 8026420], [8026421, 10033025], [10033026, 12039630], [12039631, 14046235], [14046236, 16052840], [16052841, 18059445], [18059446, 20066050], [20066051, 22072655], [22072656, 24079260], [24079261, 26085865], [26085866, 28092470], [28092471, 30099075], [30099076, 32105680], [32105681, 34112285], [34112286, 36118890], [36118891, 38125495], [38125496, 40132113]] SRR22215334 file size 13616947 SRR22215334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22215334 SRR22215334_1.fastq SRR22215334_2.fastq Input file: SRR22215334_1.fastq Paired file: SRR22215334_2.fastq trimmed: SRR22215334-trimmed-pair1.fastq, SRR22215334-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:27:57 2025 >> started Tue Feb 11 08:28:44 2025 >> done (46.976s) 40132113 read pairs processed; of these: 331 ( 0.00%) short read pairs filtered out after trimming by size control 174918 ( 0.44%) empty read pairs filtered out after trimming by size control 39956864 (99.56%) read pairs available; of these: 4697225 (11.76%) trimmed read pairs available after processing 35259639 (88.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 19 0.00% 20 1 0.00% 21 13 0.00% 22 6 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 12 0.00% 27 14 0.00% 28 5 0.00% 29 56 0.00% 30 13 0.00% 31 21 0.00% 32 13 0.00% 33 12 0.00% 34 17 0.00% 35 12 0.00% 36 11 0.00% 37 10 0.00% 38 10 0.00% 39 19 0.00% 40 12 0.00% 41 14 0.00% 42 18 0.00% 43 26 0.00% 44 18 0.00% 45 32 0.00% 46 19 0.00% 47 23 0.00% 48 33 0.00% 49 42 0.00% 50 41 0.00% 51 47 0.00% 52 45 0.00% 53 45 0.00% 54 49 0.00% 55 62 0.00% 56 66 0.00% 57 48 0.00% 58 67 0.00% 59 65 0.00% 60 71 0.00% 61 79 0.00% 62 76 0.00% 63 93 0.00% 64 80 0.00% 65 103 0.00% 66 111 0.00% 67 121 0.00% 68 140 0.00% 69 146 0.00% 70 198 0.00% 71 190 0.00% 72 213 0.00% 73 234 0.00% 74 277 0.00% 75 284 0.00% 76 327 0.00% 77 377 0.00% 78 390 0.00% 79 474 0.00% 80 491 0.00% 81 570 0.00% 82 660 0.00% 83 629 0.00% 84 769 0.00% 85 931 0.00% 86 966 0.00% 87 1146 0.00% 88 1227 0.00% 89 1331 0.00% 90 1525 0.00% 91 1617 0.00% 92 1827 0.00% 93 2033 0.01% 94 2256 0.01% 95 2482 0.01% 96 2782 0.01% 97 2972 0.01% 98 3387 0.01% 99 3677 0.01% 100 3953 0.01% 101 4246 0.01% 102 4693 0.01% 103 5319 0.01% 104 5726 0.01% 105 6447 0.02% 106 7017 0.02% 107 8064 0.02% 108 8447 0.02% 109 9490 0.02% 110 10427 0.03% 111 11603 0.03% 112 13008 0.03% 113 14640 0.04% 114 16128 0.04% 115 18302 0.05% 116 20391 0.05% 117 23079 0.06% 118 25709 0.06% 119 29440 0.07% 120 32146 0.08% 121 36261 0.09% 122 40241 0.10% 123 44352 0.11% 124 49840 0.12% 125 54754 0.14% 126 61139 0.15% 127 67842 0.17% 128 75999 0.19% 129 82319 0.21% 130 91514 0.23% 131 99156 0.25% 132 106803 0.27% 133 114617 0.29% 134 122466 0.31% 135 132162 0.33% 136 141591 0.35% 137 152781 0.38% 138 164672 0.41% 139 176813 0.44% 140 187092 0.47% 141 194060 0.49% 142 206112 0.52% 143 213604 0.53% 144 224098 0.56% 145 230883 0.58% 146 239308 0.60% 147 250811 0.63% 148 262726 0.66% 149 271565 0.68% 150 285043 0.71% 151 35259639 88.24% 39956864 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=31 prefix-density=0.23 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=190.10 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.3 sequence=CTTTTTCTTTACTGCAGACTTGGTGACCTTGGCACCAGATGGATCCTTCTTCTCAACACTCTTAATGACACCAACCGCCACGGTCTGACGCATGTCCCTCACTGCAAAACGACCAAGAGGAGGATAGGCAGAAAAGGTCTCAACAACCATAGGCTTGGTGGGAATCATCTTCACAAACCCAGCATCACCATTCTTCAAGAACTTGGGCTCCTTCTCGAGCTCTTTGCCAGATCGCCTGTCAATCTTGGTCAAAATCTCAGCAAACTTGACAGCAATGTGGCAGGTGTGACAGTCAAGGACAGGGGCAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.36 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=3.5 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=23.00 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.3 sequence=CTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAAAGCCTGCAGAAACCGTGGCTGCTGCATAATGTTTATAATACCAATATTTACTATGTGAAACTGTGTTCTACTGGGTTATAGTTAGTTGGGCTTTCTATGATCATGATGTGGATTCTGGATATCCAGCATGCTTTTACTGGGATGTAAGCTATAATAATTTCTCTGGTACATTCATATGGTT SRR22215334 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:29:29 Started mapping on | Feb 11 08:29:29 Finished on | Feb 11 08:33:29 Mapping speed, Million of reads per hour | 599.35 Number of input reads | 39956864 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 36757616 Uniquely mapped reads % | 91.99% Average mapped length | 297.80 Number of splices: Total | 26266521 Number of splices: Annotated (sjdb) | 25658034 Number of splices: GT/AG | 25862062 Number of splices: GC/AG | 315493 Number of splices: AT/AC | 29549 Number of splices: Non-canonical | 59417 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 801096 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 1165407 % of reads mapped to too many loci | 2.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2398152 2398152 2398152 N_multimapping 801096 801096 801096 N_noFeature 1530838 36243117 1690586 N_ambiguous 538691 2072 183123 UnstrandedReadsAssigned:34688087 PositiveStrandReadsAssigned:512427 NegativeStrandReadsAssigned:34883907 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR22215334 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR22215334-trimmed-pair1.fastq SRR22215334-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,956,864 reads, 36,422,448 reads pseudoaligned [quant] estimated average fragment length: 191.744 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR22215334.ke.tsv 34699 SRR22215334.se.tsv 87100 total ==> SRR22215334.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.26 5113 77.8601 Potri.005G024800.1.v4.1 1035 844.256 923 30.4205 Potri.004G059700.1.v4.1 961 770.256 88 3.17897 Potri.007G009000.2.v4.1 1416 1225.26 0 0 Potri.003G141000.2.v4.1 2943 2752.26 675.316 6.82743 Potri.016G087400.1.v4.1 270 83.7864 1917.81 636.898 Potri.015G069301.1.v4.1 564 373.318 0 0 Potri.010G195200.1.v4.1 1773 1582.26 165.557 2.91145 Potri.012G127500.1.v4.1 977 786.256 11698 413.987 ==> SRR22215334.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2126 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 816 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 86 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR22215334 completed mapping pipeline successfully